Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Spectrum of Transcriptional, Dimerization, and Dominant Negative Properties of Twenty Different Mutant Thyroid Hormone ,&Receptors in Thyroid Hormone Resistance Syndrome T. N. Collingwood*, M. Adams*, Y. Tone, and V. K. K. Chatterjee Department of Medicine University of Cambridge Level 5 Addenbrooke’s Hospital Cambridge, CB2 2QQ, United Kingdom Resistance to thyroid hormone (RTH) is usually dominantly inherited and characterized by elevated thyroid hormone levels, impaired feedback inhibition of pituitary TSH production, and variable hormonal responsiveness in peripheral tissues. We have identified 20 different mutations in the thyroid hormone B-receptor (TRB) gene in RTH and assayed mutant receptor properties using the TSHa subunit gene promoter or promoters containing three different types of positive thyroid response element (TRE). Dominant negative inhibition of wild type TRB action by mutant receptors was also tested. The mutant receptors exhibited differing transcriptional inhibitory properties and dominant negative potential with the TSHa promoter that correlated with their impaired hormone binding, whereas transactivation and dominant negative effects with promoters containing positive TREs varied depending on their configuration. Heterodimeric mutant receptor-retinoid X receptor (RXR) interactions, either in cultured cells or as TRE-bound complexes in gel retardation assays, were uniformly preserved, whereas homodimerit receptor interactions could not be detected in viva, and in vitro homodimer formation on TREs was variably reduced or absent for some mutant proteins. We correlate these findings with the distribution of receptor mutations that cluster in two areas within the hormone binding domain outside putative dimerization regions and show that artificial mutations that impaired heterodimerization abrogated dominant negative activity. Therefore, we suggest that the dominant negative effect of mutant recep tors in the pituitary-thyroid axis generates the characteristic biochemical abnormality of RTH and that variable resistance in other tissues may be due to response element-dependent differences in their 088s8809/94/1282-1277$03,00/O Molecular Endocrinology Copyright 0 1994 by The Endocrine dominant negative potential. ogy 8: 1282-1277,1994) (Molecular Endocrinol- INTRODUCTION Thyroid hormones (T4 and T3) have a number of actions such as the regulation of growth and metabolic processes, augmentation of myocardial contractility, and control of brain development. The synthesis of T4 and T3 in the thyroid is controlled by TSH from the pituitary. In turn, these hormones inhibit TSHa and P-subunit gene transcription as part of a classic negative feedback loop (1). The biochemical hallmark of resistance to thyroid hormone (RTH) is abnormally elevated serum thyroid hormone levels together with a failure to suppress pituitary TSH secretion. In addition, affected individuals exhibit a variable degree of resistance to hormone action in peripheral tissues. Some patients are asymptomatic, with few clinical signs other than a goiter, leading to a diagnosis of generalized resistance (GRTH), whereas peripheral thyrotoxic features in other cases suggest more selective pituitary resistance (PRTH) to the effects of thyroid hormone (2). The actions of thyroid hormone are known to be mediated by a nuclear receptor protein which binds to regulatory DNA sequences [thyroid response elements (TREs)] in target gene promoters and activates or inhibits their expression in a hormone-dependent manner (3). After the demonstration of tight linkage between the thyroid hormone receptor p (TRP) gene locus and generalized resistance (4) several groups have identified a number of different receptor mutations in families with this disorder (2). Recently, receptor mutations have also been documented in cases of selective pituitary resistance (5, 6) suggesting that it is not a separate entity but part of the variable phenotypic spectrum of a single dominantly inherited genetic disorder. Society 1262 Dominant Negative Mutant Receptors in Thyroid Hormone Resistance Genetic analyses of a large number of individuals with RTH indicate that they are heterozygous for TRP mutations that localize to the hormone binding domain of the receptor (7, 8). Previous studies have examined the functional properties of a small number of mutant receptors and established that their ability to bind ligand and modulate target gene expression is impaired (9, 10). In addition, when coexpressed, the mutant proteins are capable of inhibiting the action of their wild type counterparts in a dominant negative manner (9, 11). Evidence to support the importance of dominant negative activity of mutant receptors in the pathogenesis of the disorder is provided by the observation that individuals who are heterozygous for a complete deletion of a single TRP allele are completely normal (12) whereas one individual who was homozygous for a dominant negative receptor mutation exhibited severe resistance (13). In this study we have characterized the properties of 20 different receptor mutants that we have identified in European kindreds with RTH. As a correlate of the defective feedback in the pituitary-thyroid axis, we have assayed the ability of mutant receptors to repress transcription and exert dominant negative effects on the human TSHa: subunit gene promoter. The variable resistance in other tissues is likely to be mediated by the action of thyroid hormone on a number of other target genes and to depend on factors such as the nature of the response element, promoter context, and cell type. Analyses of the promoter regions of T,-inducible genes indicate that they contain TREs that consist of two or more hexameric nucleotide motifs, of consensus sequence A/GGGTCA, arranged as a direct repeat (14) an everted repeat (15) or a palindromic sequence (16). We have examined the influence of response element configuration on mutant receptor function and dominant negative activity using these three types of TRE linked to a common heterologous promoter in the same functionally receptor-deficient cell line. Finally, we have correlated these properties with the ability of wild type and mutant receptor proteins to interact either as homodimers, or as heterodimers with the RXR. In vivo interactions of receptors in cultured cells were assayed by coexpression of hybrid proteins containing the DNA bindingdomain of the yeast transcription factor GAL4 linked to wild type or mutant TR@together with the activating domain of VP16 linked to RXR. In addition, as wild type receptor has also been shown to interact with TREs either as a homodimer (17, 18) or as a heterodimer with RXR (19-21) we have examined these mutant receptor-DNA interactions. We find that the mutant receptors exert variable dominant negative effects both with the TSHa gene promoter as well as with positive TRE containing promoters. Our analyses also indicate that the reduced ligand binding and transcriptionalproperties of mutant receptors, together with preservation of their ability to bind DNA and form heterodimerswith RXR, are essential for dominant negative activity. We suggest that these observationsprovide an explanation for the clus- 1263 tered distributionof mutationswithin the hormonebinding domain of the receptor as well as the biochemical and variable clinical phenotype of this disorder. RESULTS Transcriptional Activity of Mutant Receptors Is Response Element-Dependent In every case of RTH, the diagnosis was made by finding abnormallyelevated serumthyroid hormonelevels together with nonsuppressedpituitary TSH secretion (Table 1). Full detailsof the clinicaland biochemical features in these kindreds will be publishedseparately (M. Adams, C. Matthews, T. N. Collingwood,V. K. K. Chatterjee, manuscript in preparation).We have documented 20 different TRP receptor mutations in unrelated families,including17 missensemutations,two inframe deletions (A430M, A432G), and a single sevennucleotide insertion mutation (frameshift). Based on their TBbindingaffinities(Table l), the mutant receptors can be grouped into three categories. The majority showed a mild to moderate impairment in TS binding Table 1. Clinical Receotors Mutation Wild type R320H P453S R438C R438H R429Q P453T P453A R320L R338W P453H M334R Y321C 1431T V264D R316H G345S G344E A430M A432G Frameb Normal range Data and T3 Binding FT4* pmol liter-’ 29 35 25 36 31 44 25 34 71 45 72 49 25 29 27 See Ref. 62 64 53 39 69 9-20 TSH’ mU liter-’ 2.0 1.5 5.6 2.7 7.8 2.0 1.9 4.2 4.1 9.4 3.2 2.1 1.4 2.5 0.7 4.1 1.0 3.6 2.2 Affinity of Mutant Phenotype GRTH GRTH GRTH GRTH GRTH GRTH PRTH GRTH PRTH GRTH PRTH PRTH PRTH GRTH GRTH GRTH GRTH PRTH PRTH GRTH 2.2 (0.2) 0.83 (0.12) 0.79 (0.19) 0.67 (0.15) 0.51 (0.20) 0.46 (0.11) 0.44 (0.08) 0.38 (0.03) 0.21 (0.06) 0.21 (0.06) 0.15 (0.01) 0.11 (0.03) 0.04 (0.02) 0.02 (0.01) co.02 co.02 co.02 BND BND BND BND 0.4-4.0 Codon nomenclature is based upon a predicted protein sequence containing 461 residues (63). BND, Binding not detected. ’ Thyroid function tests and clinical phenotype are in the index case from each kindred. b An insertion of ACTCTTC after nucleotide 1638 leading to a shift in reading frame and addition of residues to the extreme carboxyterminus. MOL ENDO. 1994 1264 [association constant (KJ values ranging from 0.83 to 0.02 x 10” M-‘1; three (V264D, R316H, G345S) retained very low TB binding capabilities with affinities that could not be quantified (K, < 0.02 x 10” M-‘), and four mutants (G344E, A430M, A432G, frameshift) exhibited no detectable TJ binding. In the first instance we assayed the ability of wild type and mutant receptors to inhibit transcription of the human TSHa-gene promoter, and the results are shown in Fig. 1A and B. The wild type receptor inhibited TSHaLUC activity in a T3 dose-dependent manner with maximal inhibition occurring at 1 nM TJ. In keeping with their impaired ligand affinities, the majority of mutant receptors exhibited a reduction in sensitivity to hormone such that higher TS concentrations were required to exert a comparable inhibitory effect. With mutant receptors that retained TS binding, the rank order of their inhibitory potencies (Fig 1, A and B: WT > R338W = R320H = Y321C > R316H = R320L > M334R > V264D > G345S; WT > P453S = R438C = R438H = P453T = P453A > R429Q = l431T = P453H) was broadly comparable to their relative K, values (Table 1: WT > R320H > R338W = R320L = M334R > Y321C > R316H = V264D = G345S; WT > P453S = R438C > R438H = P453T = P453A = R429Q > P453H > 1431 T). The four non-hormone-binding mutants (G344E, A430M, A432G, frameshift) showed almost flat T3dependent inhibition profiles that did not differ significantly from inhibition in mock transfected cells. We next performed similar studies with reporter genes, which are all activated by wild type receptor in a ligand-dependent manner. MAL-TKLUC contains a natural direct repeat TRE from the malic enzyme gene (14) and is maximally stimulated by wild type receptor at 5 nM TJ (Fig. 1, C and D). As with negative transcriptional regulation, most mutants showed a right-shift in activation profiles and achieved the same maximal induction as wild type receptor at high TJ concentrations. However, several mutants were unable to attain full activation, despite the presence of supramaximal TJ concentrations. Interestingly, this effect was observed with several different mutations at a single codon (P453A, P453H, P453S P453T). In addition, two mutations at codon 438 (R438C R438H), each with similar K. values, showed divergent activation profiles; R438C stimulated MAL-TKLUC activity to a greater extent than wild type receptor whereas activation by R438H was markedly impaired. Mutant Y321 C, which binds T3 with a greatly reduced affinity, also exhibited a higher maximum activation level than the wild type receptor. The four non-T3-binding mutants (G344E, A430M, A432G, frameshift) did not activate gene expression through the malic enzyme TRE. These results were compared with activation profiles obtained using a palindromic response element (PAL), which was derived by optimizing the TRE in the rat GH gene (22). When tested with PAL-TKLUC, the mutant receptors again showed a range of Tadependent activation profiles (Fig. 1, E and F). As with MAL-TKLUC, mutant Y321C was supraactive compared to wild type receptor, and the four non- Vol8 No. 9 hormone-binding mutants did not activate even in the presence of 1 FM TJ. However, some TRE-dependent differences were apparent. In contrast to their profiles with the malic enzyme TRE, mutants 1431T, R438H, P453A, P453H, P453S and P453T all stimulated PALTKLUC to the same extent as wild type receptor. Conversely, mutants R338W, G345S and R429Q were all less active on the palindromic vs. the malic enzyme TRE. These response element-specific differences were investigated further using a third type of TRE. F2TKLUC contains the F2 response element from the chicken lysozyme gene, which consists of two hexamer motifs arranged as an ever-ted repeat separated by six base pairs (15). As the maximum activation of this reporter gene was less than that achieved with other TRE configurations (maximal -15-fold induction with wild type receptor at 5 nM T3), it was not possible to generate TJ dose-dependent profiles for each mutant. The activity of wild type and mutant receptors at intermediate (1 nM) and supramaximal(1 PM) T3 concentrations is shown in Fig. 2. Once again, at 1 nM TB transactivation by each mutant receptor was diminished, reflecting their reduced hormone responsiveness. With the exception of the non-Ts-binding mutants (G344E, A430M, A4326, frameshift), this impairment was reversible with supramaximal levels of T3 (1 PM). However, a number of mutants (V264D, R338W, G345S R429Q 1431T, P453H) again showed an inability to activate fully, despite the presence of sufficient T3 to overcome their reduced affinity for ligand. Our results indicate that the reduction in TJ binding affinities of mutant receptors leads to a right shift in hormone-dependent repression or activation profiles on the response elements tested. With respect to negative regulation of the TSHa gene promoter, it appears that impaired transcriptional activity is mainly due to a reduction in T,-binding affinity. However, on positively regulated TREs additional factors are involved such that a number of mutants exhibit impaired transactivation properties, depending on the configuration of the response element. Variable Dominant Receptors Negative Inhibition by Mutant Using the same reporter genes, we investigated whether mutant receptors also varied in their ability to inhibit wild type receptor action in a dominant negative manner. In these studies, wild type and mutant receptors were coexpressed, and reporter gene activities were assayed at two hormone concentrations. A submaximal concentration of TS (0.3 nM for TSHa LUC, 1 nM for F2-TKLUC, MAL-TKLUC, and PAL-TKLUC), at which impaired mutant receptor function would be expected, was used to compare their relative dominant negative potencies, and a supramaximal T3 level (10 nM for TSHCILUC, 1 PM for FBTKLUC, MAL-TKLUC, and PAL-TKLUC) was used to assess the reversibility of these effects. Although mutant to wild type receptor ratios of 5:l were used with some reporter genes to I’\1 0. I I hl I 10 I? I’\1 I ( I WJ -‘I hl.l C 1ooU In\11 Fig. 1. T,-Dependent Activity of Wild Type and Mutant Receptors on the TSt& Promoter, Mallc Enzyme. and Palindromic TREs The data shown in this and subsequent figures are the mean of at least three separate experiments, each done In duplicate In on the TSHcc promoter. JEG-3 each case the SEM was less than 1 200 Panels a and b. Actlvlty of wild type and mutant receptors cells were transfected with 2 pg TSHtrLlJC 100 ng receptor expresslon vector. and 200 ng BOS-3gal and incubated with various concentrations of TB (O-l PM) Hormonedependent InhIbItion of luclferase actlvlty by wild type and mutant receptors IS expressed relative to the activity In cells Incubated without T, after normalization for ;r-galactosldase actlvlty Typically 35”., InhIbItion of TSHaLUC acbvtty was observed In control cells transfected with RSVCAT at 1 PM T3 Panels c and d. Actlvlty of wild type and mutant receptors on the direct repeat mailc enzyme TRE JEG-3 cells were transfected with 2 pg MAL-TKLUC. 100 ng receptor expresslon vector and 200 ng of BOS-$gal Luciferase activity was determlned after lncubatlon with O-l PM T3 and normalized for $-galactosdase activity In each experiment the maximum corrected luciferase acbvlty with wild type receptor was taken as 100% and activation by each mutant receptor calculated relative to this Wild type receptor Induced this reporter gene approximately 1 OO-fold in the presence of 5 nM T9 Panels e and 1. Actlvlty of wild type and mutant receptors on a pallndromlc TRE Cells were transfected with 2 pg PAL-TKLUC. 100 ng receptor expression vector, and 200 ng BOS3gal and incubated with various concentrations of T3 PAL-TKLUC was induced approximately 80.fold by wild type receptor with 10 nM T:, Hormone-dependent activation was calculated as for panels c and d MOL 1266 ENDO. 1994 Vol8 F2-TKLUC is g & 2 40 30 20 10 140, 0 20 n Fig. 2. Activity of Wild Type and Mutant Receptors on the Ever-ted Repeat F2 TRE JEG3 cells were transfected with 4 pg FBTKLUC, 100 ng receptor expression vector, and 200 ng BOS-Pgal. Corrected luciferase activity induced by wild type TRPl in the presence of 1 PM T3 was taken as lOO%, and activation by mutant receptors at 1 nM (hatched bars) and 1 FM TS (solid bars) was calculated relative to this. Wild type receptor induced F2TKLUC activity by approximately 15fold in response to 1 PM T3 stimulation. demonstrate optimum dominant negative activity, these inhibitory effects were also apparent with equal ratios of receptors. At 0.3 nM TJ, each mutant exerted a dominant negative effect on expression of TSHLULUC, although the magnitude of this effect varied. At 10 nM TJ the majority of mutants ceased to exert an inhibitory effect (Fig. 3A). However the dominant negative effects of P453H and the non T,-binding mutants (G344E, A430M, A432G, frameshift) were still apparent. Subsequent experiments indicated that P453H loses dominant negative activity at between 10 and 100 nM TB (see also Ref. 9) whereas the non-T3-binding mutants still inhibit wild type receptor activity at 1 @I TS (our unpublished data). Detailed TJ dose-response studies with three mutants (R316H, R438C, and P453H) also showed that the concentration of hormone required to abrogate dominant negative activity correlated with the ligand binding affinity of each mutant (data not shown). At low (1 nM) hormone concentrations, the mutant receptors also exhibited a variable spectrum of dominant negative activity when investigated using the three positively regulated reporter genes (Fig. 3, 8, C and D). At supramaximal TB levels, these inhibitory effects were reversible for most mutants but with some notable exceptions. The non-Ts-binding mutants (G344E, A430M, A4326, frameshift) showed potent dominant negative activity on all elements with little reversal at 1 PM TJ; in addition, the effects of codon 453 mutants (P453A, P453H, P453S, P453T) were also poorly reversible, particularly on MAL-TKLUC and FBTKLUC, No. 9 consistent with their impaired activation profiles on these TREs. However, dominant negative activity did not necessarily correlate with the impairment of activation potential, as exemplified by the weak dominant negative activities of l43lT and R338W mutants on PAL-TKLUC (Fig. 3C). Finally, mutant R429Q illustrated properties that varied with response element configuration, being a strong inhibitor on FBTKLUC but considerably weaker on the other two response elements. These results suggest that the dominant negative effects of mutant receptors with TSHL~LUC appear to correlate with the degree of impairment of hormonedependent repression of this promoter. However, with positively regulated TREs, the dominant negative effects are variable, and factors other than the reduction in ligand-dependent transactivation are involved. Wild Type and Mutant Receptors Interact hRXRa When Coexpressed in Viva with A seriesof nine heptad repeatsof hydrophobic residues mediatingdimerization has been delineatedwithin the hormonebindingdomainof the thyroid hormonereceptor (23), raisingthe possibilitythat the mutationsin RTH also modulate this function. Although TR can interact with responseelementseither as a homodimeror as a heterodimer with RXR, whether such protein-protein interactionscan occur in cellshas not beendetermined. Accordingly, an assay used previously to demonstrate interactions between the retinoic acid receptor (RAR) and RXR (24) was used to detect TR and RXR interactions in viva in cultured cells. Expression vectors (GAL4-TRs), encoding the DNA-binding domain of the yeast transcription factor GAL4 (GAL4-DBD) fused to the hormone binding domains of wild type or mutant TR@(residues 174-461) or RXR (residues198-467), were cotransfected with a secondvector containingthe activating domain of VP16 fused to either hRXRa (VP16-RXRa) or TRP (VP16-TR). Interaction between these fusion proteins results in VP18mediated transcriptional activation of a reporter gene (UAS-TKLUC) which contains GAL4 binding sites. In addition, we also studied the dimerization propertiesof two artificial mutants, L42lR and L428R, in which the hydrophobic leucine residuesat each end of the ninth heptad have been changedto arginine.UAS-TKLUCactivity was not stimulated upon cotransfection with wild type GALC TR, VP1~-RXRLU,or VP16-TR expressionvectors individually (data not shown), or with a combination of VP16-RXRa and GALCDBD (Fig. 4). However, cotransfection of VP16-RXRa with wild type GALCTR resulted in a marked induction of luciferase activity (Fig. 4), as did cotransfection of VPlG-TR and GAL4-RXRLU expression vectors (data not shown), indicating a heterodimeric interaction between the carboxy-terminal domainsof TR and RXRa. Similarly, cotransfection of vectors encoding mutant GAL4-TRs with VP16-RXRa also increased reporter gene activity, indicating that each mutant retained the ability to heterodimerizewith Dominant Negative Mutant Receptors *IL a in Thyroid Hormone Resistance TSH 0. LUC 1267 m-lr 11 MAL-TKLUC l:i?-TKLUC PAL-TKLUC Fig. 3. Dominant Negative Inhibition of Wild Type Receptor Activity by Mutant Receptors Is T3-Dependent In this and subsequent experiments no significant differences in luciferase activity were obtained after transfection of either 600 ng wild type receptor expression vector or 100 ng wild type expression vector plus 500 ng RSVCAT. a, JEG3 cells were transfected with 2 pg TSHaLUC, 200 ng BOS-@gal, and 100 ng wild type plus 500 ng of either wild type or mutant receptor expression vectors. Inhibition of normalized luciferase activity at 0.3 nM TB (upper panel) or 10 nM TB (rower panel) is expressed relative to values in the absence of hormone. b, Cells were transfected with 2 pg MAL-TKLUC, 200 ng BOS-@gal, 100 ng wild type plus 500 ng wild type or mutant receptor expression vectors. Normalized luciferase activity after incubation in 1 nM T3 (upper panel) or 1 PM TB (lower pane/) is expressed relative to values in cells transfected with wild type receptor with 1 PM TB. c, Cells were transfected as in panel b except 2 pg PAL-TKLUC were used. Dominant negative effects of mutant receptors at 1 nrv (upper pane/) or 1 PM T3 (lower pane/) were calculated as in panel b. d, Dominant negative effects of mutant receptors on FP-TKLUC. Cells were transfected with 4 pg F2-TKLUC, 200 ng BOS-Bgal, 100 ng wild type plus 100 ng wild type or mutant receptor expression vectors. The upper and lower pane/s show the effects of mutant receptors on induction by wild type receptor at 1 nM or 1 PM TS, respectively. Results were calculated as in panel b. RX!% in ceils. However, both of the heptad mutants, L421R and L428R, were inactive in this assay reflecting a lossof dimerizationcapacity. Importantly, cotransfection of wild type VPlG-TR with either wild type or mutant GAL4-TR expression vectors did not result in any detectable increase in UASTK-LUC reporter gene activity (data not shown), suggesting an absence of homodimericinteractionsin vivo. Homodimerization of Receptor Response Element-Dependent Previous studies have established Mutants Is that the thyroid hor- mone receptor can interact with TREs as a homodimer (25). On the basisthat variable dimerizationof mutant receptors could influencetheir transcriptionaland dominant negative properties, we studied the interaction of these proteins with TREs using gel mobility shift assays. In accordance with previous observations (25) we observed homodimerformation most readily with the everted repeat (F2) and palindromicconfigurations of responseelement but were unable to demonstrate significant homodimer formation on the direct repeat TRE from the malicenzyme gene. On the F2 element most mutants showed binding comparableto wild type receptor but a few (R338W, R438C P453A) exhibited moderately reduced homo- MOL 1268 ENDO. 1994 Vol8 No. 9 Fig. 4. In Viva Interaction between RXRa and Wild Type and Mutant TRs Cells were transfected with 5 fig UAS-TKLUC, 200 ng VPlG-RXRa expression vector, 1 rg GAL4-TR (wild type or mutant) expression vectors, and 300 ng BOS-pgal. Reporter gene activation by wild type or mutant TR fusion proteins and VP1 6-RXRa is expressed relative to normalized activity in cells cotransfected with VPlG-RXRa and GAL4 DNA-binding domain (GALCDBD) vectors. Each point is the mean (+SEM) of three experiments, done in triplicate. dimer formation. For two mutants (R316H, R429Q), homodimer formation was severely diminished or absent, and three others (M344R, A430M, 1431T) showed enhanced homodimer binding (Fig. 5A). A similar study using the palindromic response element generated a markedly different profile of homodimer formation by mutant receptors (Fig. 58). In this case dimerization of R316H and R429Q was preserved, whereas R338W and P453H showed impaired binding. Interestingly, homodimer formation by A432G appeared to be significantly enhanced on PAL, contrary to F2, while M334R and l431T exhibited increased dimerization on both response elements. Lastly, dimer formation by R438C and P453A was moderately weakened on PAL, as with the F2 element. These results suggested that the mutant receptors differed in their ability to form homodimers and that these differences varied with the type of TRE. Mutant Receptors Retain the Ability to Form Heterodimers with RXRa and Show Differential Homodimer Dissociation in Response to Ligand Previous studies have established that TR interacts with response elements not only as a homodimer but also as heterodimers with receptor-associated auxiliary proteins (TRAPS) (26, 27) and several groups have shown that the retinoid X receptor meets the criteria for this activity (20, 28). We therefore investigated the heterodimeric interaction of mutant receptors with human RXRa, the predominant retinoid X receptor isoform present in the cell line (JEG-3) used in our transfection assays (29). We tested the ability of mutant receptors to form homodimers and heterodimers on F2 and palindromic response elements and examined the influence of T3 on these processes, since it was known that ligand decreases homodimer but not heterodimer formation by wild type TR (18, 25). On the F2 response element (Fig. 6, A and B) the variable homodimer profile of mutant receptors was attenuated to differing extents by TS, in keeping with their altered ligand binding affinities. In contrast, the interaction of each mutant with RXRL~ was uniformly preserved and was not affected by TJ. Using the palindromic TRE (Fig. 6, C and D), the formation of TRRXRa complexes was favored over homodimeric interactions and again preserved for all mutant receptors. In contrast to F2, we were unable to demonstrate any effect of ligand on homodimer formation with this element, in accordance with the observations of other groups (25). Once again, heterodimer formation on this element was not affected by the presence of thyroid hormone. Lastly, mutant receptor interactions with the malic enzyme TRE were evaluated (Fig. 7, A and B). We were able to document only heterodimeric receptor interactions with this configuration of TRE, and this was not influenced by the mutations or the presence of TJ. Overall, these studies show that for each RTH mutant the formation of TR-RXRa heterodimers is preserved on each of three different configurations of TRE. In contrast, the stability of a TRP mutant homodimer is dependent upon its affinity for ligand and the type of Dominant Negative Mutant Receptors in Thyroid Hormone Resistance FZ - nnnnnn 1269 _ B Pal -- Fig. 5. Gel Mobility Shift Assays Showing Differential Homodimer Formation by Receptor Mutants on TRE-FP and TRE-PAL in the Absence of Ligand Equal amounts (-35 fmol) of in vitro translated mutant receptors were incubated in the presence of the specified labeled DNA oligonucleotide. RL, Nonprogrammed reticulocyte lysate; Wt, wild type receptor. All other lanes contain receptor mutants as indicated. A, Complexes formed with TRE-FP (40 fmol probe). B, Complexes formed with TRE-PAL (20 fmol probe). So/id arrows show specific receptor complexes. Open arrows show nonspecific complexes. T/r denotes TRj3 homodimer. responseelement to which it is bound, in addition to the integrity of its dimerizationregions. Loss of Dominant Negative Activity Correlates with Loss of Heterodimerization Function In order to test the hypothesis that dimerization is importantfor dominantnegative activity, we studiedthe propertiesof two artificialmutant receptors, L421R and L428R which were shown to markedly reduce heterodimeric interactions between TR and RXR in vivo. Ligandbindingstudiesshowedthat mutant L421R bound T3 weakly with a K, c 2 x 1OSM-‘, whereasthe L428R mutant exhibited negligibleT3 binding. Consistentwith these properties, the L421R mutant activated or repressedreporter genes fully at supramaximalT3 concentrations, whereasthe L428R mutant was transcriptionally inactive (our unpublisheddata). These mutants also exhibited divergent dimerization potential that was responseelement dependent. On the F2 TRE, both homo- and heterodimerization of mutant L421R was markedly impaired in the absence of ligand (Figs. 5A and 66) whereas the L428R mutant formed homodimers despite an inability to heterodimerize with RXR (Fig. 6B). A similar pattern was observed with the palindromicTRE, with both mutations retaining homodimer formation yet showing weak (L421R) or absent (L428R) heterodimerization(Figs. 5B and 6D). On the malicenzyme TRE, the ability of both mutants to form heterodimerswas also impaired(Fig. 7B). Interestingly, the addition of T3 altered the dimerizationpropertiesof L421R, restoring its ability to form heterodimerson F2 (Fig. 6B) and to a lesser extent on the malic enzyme element, but did not modulate the DNA-binding of L428R. While these studies were in progress, similar properties were described for analogousmutations introduced into the retinoic acid and chick a-thyroid hormone receptors (30). To determine the relative importance of home- vs. heterodimerizaton in dominant negative activity, we carried out further studies with two “double mutant” receptors containing a resistance mutation together with either the artificial L421R or L428R dimerization mutations. The frameshift mutant was used in these studies,owingto its negligibletranscriptionalresponses to TJ, ability to form both homo- and heterodimers,and its strong dominant negative potency. We examined the DNA bindingpropertiesof each individualmutation, and those of the double mutants on the F2 response element(Fig. 8), and assesseddominantnegative activity on F2-TKLUC and TSH~YLUC(Fig. 9A and B). The frameshift mutation showed strong dominant negative effects with both reporter genes, whereas neither L421R nor L428R mutants inhibitedwild type receptor function significantly. The properties of individual mutations in gel shift assays were also as shown previously, except that the effects of ligandin reducing wild MOL ENDC. 1994 1270 Vol8 No. 9 RXR A RXR 1 RLTWT wI.m1.,1 w-r V2S4D n. R316H R32OH ,,.I,. R320L FZ _ B I R42W T3:I. nnnnnn M334R R33W I+, I- G344E 03465 I _ + I I . +, f - RXR A43OM +I,- 14311 A432G +I I-*II-.II-+II-v1I- R438C F2 C Y3ilC _ R438H - “““““n RXR RLI;;:WY T3:I.l-Fl1--*11-+11-R)- I P453A P463H I-. P453S I- P4632 Prime L42?R 441.. V2640 R316H I l 1 4 RXR WT L428R +a,. I R32OH R320L Y32lC M334R R338W G344E +a,. +,I+I,+a,*II. 0345s PaI -- D , RI. T5:rnb. RXR RWQ AA3OM MIT +a,. +II.+II.*II,,. M32G R438C Pal R43SH P453A P483H P463S +,,+,I+1,.,. P&32 +,I. Frame L421R L428R +,I+,I+, I _ Rg. 6. Gel mobility shii assay showing differential effects of ligand on the stabllity of mutant receptor homodimers with TRE-FP and TRE-PAL and preservation of TRB/RXRa heterodimers. RL, Nonprogrammed reticulocyte lysate; Wt, wild type receptor. All other lanes contain receptor mutants as indicated. Equal amounts (35 fmol) of in vitro translated mutants were incubated with the spscified labeled DNA oligonucleotide and in vitro translated RXRcr (-6 fmol in panels A and B; -3 fmol in panels C and D) in the absence (-) or presence (+) of 10 nM T3. A and B, Complexes formed on TRE-F2 (40 fmol probe). C and D, Complexes formed on TRE-PAL (20 fmol probe). So/id arrows show specific receptor complexes. Open arrows show nonspecific complexes. T/T denotes TR@ homodlmer. R/T denotes TRB/RXRa hetercdimers. Dominant Negative Mutant Receptors in Thyroid Hormone Resistance A RXR I RL RL T3:l. .,I. B , RL W +,1.,. R4ZBQ TJ:rnI. VZ64D A430M em,. MIT +,a. R316H R320H R33OL V32,C M334R R33SW 63441 G345S +,,. +,I. +,,. +,,. +I,+,,+,,. +, 1271 I RXR I A433G R43SC R43SH P4S3A P4S3H P4S3S P4S3T Frame L431R L42SR +I, _ +a,,I#. ‘II. +I,. +a,. *,I. +,I. .,I_ ,I,. +I Fig. 7. Gel Mobility Shift Assay Showing Preservation of Mutant TRP/RXRCY Heterodimers on the Malic Enzyme TRE (TRE-ME) RL, Nonprogrammed reticulocyte lysate; Wt, wild type receptor. All other lanes contain mutant receptors as indicated. Equal amounts of in vitro translated mutants (35 fmol) were incubated with TRE-ME (40 fmol) with 6 fmol of in v/fro translated RXRa in the absence (-) or presence (+) of 10 nrv T3. Solid arrows show specific receptor complexes. Open arrows show nonspecific complexes. R/T denotes TRfi/RXRa heterodimers. RXR I 13: RL mt. WT L421R +,I. F2 - L428R +,I. Frame +,, _ *,I L421R L428R Frlme _ +,I Frime _ +l ’ nnnnnn - Fig. 8. Gel Mobility Shift Assay Showing Modulation of Dimerization in a Dominant Negative Mutant Receptor Equal amounts (-35 fmol) of in vitro translated TRB mutants were incubated with -6 fmol in vitro translated RXRCYand TRE-F2 (40 fmol) in the absence (-) or presence (+) of 1 @I T3. The lanes labeled L421 R+Frame and L428R+Frame contain double mutants. So/id arrows show specific receptor complexes. Open arrows show nonspecific complexes. T/r denotes TR@ homodimers. R/T denotes TRB/RXRa heterodimers. type homodimerformation and augmentingheterodimer formation were more marked at this TOconcentration (1 PM). However, L421R/frameshift showed markedly impaired homo- and heterodimerization that was not T3-reversible,and L428R/frameshift showed a marked reduction in heterodimerformation with preservation of homodimerizationthat was not modulatedby ligand. In transfection studies both frameshift/L421R and frameshift/L428R exhibited negligibledominant negative activity (Fig. 9, A and 6). These results suggest that, in order to exert a dominant negative effect, a mutant receptor should exhibit impairedtranscriptionalproperties yet retain the ability to form heterodimerswith RXR. Thus, L421R has no dominant negative activity because it both forms heterodimersand is transcriptionallyactive when liganded. Although L428R is transcriptionally inactive, it is not a dominantnegative inhibitor,presumablydue to severely attenuated heterodimerizationwith RXRa. Both these mutations abrogate the dominant negative effect of frameshift; although L421R/frameshift remains transcriptionallyinactive it is unableto form either homo-or heterodimers. The L428R/frameshift mutant is even more informative as homodimerformation is preserved, indicating that loss of dominant negative activity is associated with selective impairmentof heterodimerization. MOL 1272 ENDO. 1994 Vol8 140 = FZ-TKLUC 60, b TSHa No. 9 LUC 1 Fig. 9. Dominant Negative Effects of Dimerization a, JEG3 cells were transfer&d with mutant expression vectors and incubated TSHaLUC, 200 ng BOS-pgal, and 100 with 0.3 nM T3. Results were calculated the Frameshift Mutant Regulatory Abolished by Additional Receptor Mutations That Prevent 4 pg F2-TK-LUC, 200 ng BOS+gal, and 100 ng wild type plus 100 ng of wild type or with 1 PM TS. Results were calculated as for Fig. 3d. b, Cells were transfected with 2 pg ng wild type plus 500 ng wild type or mutant receptor expression vectors and incubated as for Fig. 3a. DISCUSSION Transcriptional TRB Receptors Are Properties of Mutant In this paper we describe the properties of 20 different mutant thyroid hormone p-receptors identified in our series of unrelated European kindreds with RTH. Eight of these receptor mutations have been documented previously in this disorder (2) but a further 12 are novel mutations not previously described. In a comprehensive survey of mutant receptor function, we have compared the ligand binding and dimerization properties of these proteins with their variable transcriptional and dominant negative potential on both positively and negatively regulated reporter genes. Our studies have shown that, consistent with their location in the hormone binding domain, the ability of these mutant receptors to bind ligand is variably affected. Consequently, with the exception of nonhormone-binding mutants, their ability to inhibit transcription of the TSHa promoter was impaired at low levels of Tg but generally reversible at higher ligand concentrations. In contrast, qualitatively different responses were obtained with positively regulated target genes, where transactivation was not always linked to hormone binding. Furthermore, a single mutant could exhibit markedly divergent profiles that varied with response element configuration, suggesting that these differences were unlikely to be due to variations in expression of mutant proteins. In general, four types of response profile were seen: 1) right-shifted responses with attainment of a maximum activation equivalent to wild type receptor but requiring higher TB levels; 2) negligible response to ligand with non-T3 binding mutants; 3) mutants exhibiting higher levels of activation relative to wild type receptor; and 4) mutant receptors that were unable to transactivate to wild type levels despite the presence of saturating concentrations of TB. It is interesting to note that several different mutations of the proline residue at codon 453 exhibited this last type of profile on the malic enzyme and F2, but not the palindromic, TREs. This residue precedes a putative amphipathic a-helical sequence at the extreme carboxy terminus of the receptor which is highly conserved among many members of the nuclear receptor family and is deleted in the transcriptionally inactive oncogene verbA (31). Indeed, mutational analyses of a homologous sequence motif in c-erbAcy and the retinoic acid receptor (32) as well as in the estrogen and glucocorticoid receptors (33) suggest it is involved in transactivation. We propose that the various codon 453 mutants may represent natural examples of receptors whose ability to transactivate is selectively impaired on some response elements (F2, MAL) but not on others (PAL). Whether these effects are due to response elementspecific differences in mutant receptor interaction with basal transcription factors such as TFIIB, which interacts with both TRa and TRP (34, 35) or other adapter proteins, remains to be determined. The ability of mutant receptors to exert dominant negative inhibitory effects also differed depending on the nature and configuration of response elements. Thus, with the TSHU promoter the dominant negative potential of mutant receptors correlated with their impaired ligand binding and transcriptional properties such that, at near saturating levels of hormone, dominant negative effects were abrogated for mutants with detectable hormone binding. In contrast, dominant negative effects on positive TREs were variable and correlated poorly with transactivation, being unexpectedly weak (e.g. R338W on PAL) or strong (e.g. R429Q on Dominant Negative Mutant Receptors in Thyroid Hormone Resistance F2) in some cases. In addition, we observed that the dominant negative activity of a number of different codon 453 mutants was poorly reversible on the malic enzyme, F2, and palindromic response elements, which agrees with a previous study of a single mutant at this position (36). Dimerization Function of Mutant TRB Receptors In X-linked androgen insensitivity syndrome, mutations have been described throughout the androgen receptor protein (37) and in autosomal recessive vitamin D resistance they are largely confined to the DNA binding and hinge domains (38). In contrast, with one exception, the RTH mutations we have described in this study localize to two regions of the ligand binding domain (Fig. lo), and an analysis of other published RTH mutations indicates that they cluster within these areas also (2). Amino acid sequence alignments of the carboxy-terminal domains of nuclear receptors have delineated a series of nine conserved heptad repeats of hydrophobic residues potentially capable of mediating protein-protein interactions (23, 39). Previous mutational analyses of the estrogen receptor (40) as well as deletion mutants of TRB, have indicated that the integrity of the carboxy-terminal ninth heptad is important for dimerization (41). In this context, it is significant that one cluster of mutations (codons 316-345) overlaps the first heptad, whereas the second (codons 429-461) is carboxy-terminal to the ninth heptad (Fig. 10). In addition, the mutations lie outside a conserved sequence motif (residues 286-305) that is involved in receptor interactions with TRAPS as well as heterodimer formation with RXRP (29). Accordingly, our analyses of the dimerization properties of mutant receptors provides a further insight into the structural determinants for these interactions. By coexpressing hybrid GALQTRP receptors and VP18tagged RXR, we have demonstrated an interaction between the carboxy-terminal domain of TRP and 1273 RXR in viva in cultured cells, as has previously been shown for RXR and RAR (24). We have also shown that each resistance mutant retains this property, although the strength of interaction varies slightly. However, homodimeric TR solution interactions in vivo were not detected, in accordance with previous observations using either RAR or RXR (24). In subsequent experiments, which examined TR-TR and TR-RXR interactions in the presence of DNA, we have shown that homodimer formation by the mutant receptors is variably altered relative to wild type receptor and, furthermore, that the ability of individual mutants to form homodimers differed depending on the configuration of TRE. In contrast, heterodimer formation between mutant receptors and RXRa was fully preserved on all response elements tested. These results provide indirect evidence to support the importance of the heptad repeats in mediating dimerization, although they suggest that the first heptad repeat is either not required for this interaction or that its functional integrity is not compromised by these mutations. The ability of some mutant receptors (e.g. R316H, R429Q) to form heterodimers but not homodimers, as well as differences in homodimer formation with different TRE configurations, suggests that the two interactions may be subject to different structural constraints. Evidence in favor of this notion is provided by the recent observation that the isolated DNA binding domains of TR and RXR are capable of heterodimer formation on direct repeat TREs, whereas the intact receptors are required for interactions on an inverted palindromic response element (42). It is intriguing to note that, apart from the V264D mutation described in this study and another mutation at codon 234 (43) no RTH mutations have been described in the hinge region, although a transcription activation function has been mapped to the equivalent area in TRal (44). This region also includes the A box sequence motif (Fig. lo), which facilitates DNA binding and heterodimeric interactions of TR (45) as well as sequences necessary for nuclear FS 316 264 * 174 H *A*A** Hl+--il-f-l-i I+-1 *i domain box 193 429 ******* * 0 186 345 286 461 lW-%l 305 421 428 Fig. 10. A schematic representation of the hormone binding domain of human TRP (amino acids 174-461). The location of the mutations described in this study are shown by an asterisk together with their codon boundaries. The two single amino acid deletion mutants are denoted by triangles and the arrowhead shows the position of the insertion mutation that leads to a frameshift (FS) and a predicted protein of 465 amino acids. Regions that have been shown to be important for receptor dimerization are indicated as follows: The A box extends from residues 186-l 93 (45); the TRAP domain has been shown to be necessary for interaction with auxiliary proteins (64); a series of heptad repeats (23) are also shown, and hydrophobic leucine residues in the ninth heptad, which were mutated in this study, are highlighted. MOL 1274 ENDO. 1994 Vol8 localization (46). It is tempting to speculate that the lack of observed mutations within this region may be due to the need to preserve the integrity of these latter functions in order for mutant receptors to exert a dominant negative effect. Variables Influencing Dominant Negative No. 9 tected in our gel retardation assays. Possible differences in mutant receptor interactions with the various RXR isoforms have yet to be determined. In addition, the role of other proteins such as TRAPS or COUP-TF (53) which interact with TR, also remains to be elucidated. Potential Pathogenesis We have shown that reduced ligand binding with consequent impaired hormone-dependent transcriptional regulation, accompanied by the preservation of DNA binding and dimerization functions, are universal properties of these mutant TRs. These features are consistent with two models in which either nonfunctional homodimeric or heterodimeric mutant receptor complexes compete with their wild type counterparts to exert a dominant negative effect. However, we do not favor occlusion of TREs by mutant homodimer complexes as a model for dominant negative activity for several reasons. First, we find that with all response elements, both wild type and mutant receptors exhibited a preference for heterodimeric interactions with RXR, and we suggest that this may reflect preferential solution interactions between TR and RXR in cells. Second, although we have demonstrated impaired dissociation of mutant receptor homodimer complexes in the presence of TJ, in keeping with a previous study with a single RTH mutant (47) we also find that some mutants (R316H, R429Q on F2; R338W on PAL) have virtually lost their ability to form homodimers, yet retain their capacity for dominant negative activity on these response elements. Finally, we have demonstrated that addition of an artificial mutation in the ninth heptad abrogates the dominant negative activity of the frameshift mutant by attenuating heterodimerization while homodimer formation is preserved, confirming a recent similar observation made with two other mutant receptors (48). In this context, we note that two other studies have also correlated the dominant negative activities of unliganded RAR (30) or TR (49) with their ability to interact with RXR. In addition, it has been shown that dominant negative inhibition is not altered by coexpression of RXR, favoring competition between wild type and mutant TR-RXR heterodimers for DNA binding, rather than the sequestration of limiting amounts of RXR by mutant receptors (50). In our studies we have not examined receptor interactions with regulatory elements in the TSHa promoter. Although earlier work (51) had delineated a single negative TRE, several other putative TREs have since been documented (52) and the relative importance of these in mediating negative regulation remains unclear. However, by analogy with the F2 data, we infer that heterodimer formation may also be critical for dominant negative activity on the TSHa promoter. Our studies have not addressed all the variables that may contribute to dominant negative activity. We cannot exclude the possibility of small differences in the ability of mutant receptors to interact with RXR, as suggested by the solution interaction experiments, which were not de- of Phenotype Our studies indicate that RTH is associated with diverse receptor mutations resulting in functionally impaired proteins that inhibit the action of wild type receptor on the TSHa subunit gene promoter. We propose that this dominant negative effect leads to a failure of negative feedback in the pituitary-thyroid axis, resulting in raised serum thyroid hormone levels with nonsuppressed TSH secretion, which is the key biochemical feature of this disorder. However, the dominant negative potency of mutant receptors in vitro does not correlate closely with thyroid hormone levels in vivo. This discrepancy may be explained in part by our recent observation that the biological activity of TSH is enhanced in RTH (54) and is a further variable which modulates thyroid hormone production. Attempts to correlate the functional properties of mutant receptors with other clinical features of RTH are hampered by a lack of precise indices of thyroid hormone action on peripheral target genes. Nevertheless, it is interesting to note that, in our own series (manuscript in preparation) as well as in two other cases (5,6), the R338W receptor mutation, which exerts significantly weaker dominant negative effects on all configurations of positive TRE compared to the TSHa promoter, was associated with peripheral thyrotoxic symptoms despite resistance in the pituitarythyroid axis. Therefore we suggest that the variable dominant negative potential of mutant receptors on different response element configurations may provide a basis for the variable effects of elevated thyroid hormone levels on target genes in peripheral tissues. MATERIALS AND METHODS Expression Vectors and Reporter Constructs Receptor mutations were generated by site-directed mutagenesis of TRPl and verified by sequencing as described previously (51). The full length wild type and mutant human TRfll cDNAs were expressed using a vector containing the Rous sarcoma virus (RSV) enhancer and promoter (51). RSVCAT is a vector containing the same viral sequences driving expression of the chloramphenicol acetyltransferase gene. Fusion proteins were generated after the introduction of artificial EcoRl sites within TRfll and RXRa cDNAs. The GALCTRPl or GAL4-RXRCZ expression vectors were created by insertion of EcoRl fragments encompassing the hormone binding domains of TR>l(residues 174-461j or RXRa (residues ?98467) in frame into pSG424 (55). The same EcoRl fragment of TR/31 was cloned into AASV (56) in order to express VP16TRfll VP1 6-RXRa contains the full length hRXRa cDNA introduced into the EcoRI site of AASV. TSHaLUC contains the 5’-flanking region of the human TSHa-subunit gene, from -846 to +44 base pairs, coupled to the luciferase reporter Dominant Negative Mutant Receptors in Thyroid Hormone Resistance gene of P&Luc (57). The reporter plasmids MAL-TKLUC, PALTKLUC, and FP-TKLUC each contain a different TRE configuration upstream of the viral TK promoter and luciferase (LUC) gene and were constructed in a similar manner. MAL-TKLUC contains the TRE from the malic enzyme gene (14) cloned into the BarnHI site of pBLCAT2 (58). A cassette containina this TRE and the thymidine kinase (TK) promoter region of pBLCAT2 was then amplified using polymerase chain reaction and cloned into the Hindlll site of PA3Luc. The plasmid F2TKLUC was constructed by transferrinq the chicken lysozvme silencer element TRE (FP).and TK promoter from F2-TKCAT (15) into the HindIll site of PAaLuc. PAL-TKLUC contains two copies of a palindromic response element (22) plus the TK promoter of pBLCAT2 inserted into the HindIll site of P&Luc. The GAL4 reporter plasmid, UAS-TKLUC, contains the 17 mer UAS sequences and TK promoter of 17 MX2-tk-CAT (59) polymerase chain reaction-amplified and cloned into the HindIll site of p&LUC. The internal control plasmid BOS-flgal contains the EF-1 a promoter region of pEF-BOS (60) driving expression of the IacZ gene. Cell Culture and Transfection Assays JEG3 cells were grown in Optimem (GIBCO-BRL, Paisley, Scotland) supplemented with 2% (vol/vol) fetal calf serum and 1% (vol/vol) Penicillin, Streptomycin, Fungizone (GIBCO-BRL, Paisley, Scotland). Eighteen hours before transfection the medium was replaced with Optimem containing 2% fetal calf serum depleted of thyroid hormones by treatment with DOWEX l-X8 resin (61). Duplicate plates of cells were transfected by a 4-h exposure to calcium phosphate. Cells were exposed to 2 pg (MAL-TKLUC, TSHorLUC, PAL-TKLUC) or 4 fig (F2-TKLUC) of reporter plasmid, together with 100-600 ng wild type or mutant receptor expression vector and 200 ng BOS-Bgal. For solution heterodimerization assays cells were cultured in medium containing 1% Penicillin, Streptomycin, Fungizone and transfected with 5 pg UAS-TKLUC, 1 fig mutant or wild type GALCTRp, and 200 ng VP1 6-RXRa fusion protein expression vectors, in addition to 300 ng BOS-@GAL. After a 38-h incubation, with T3 as appropriate, cells were lysed in buffer containing 25 mM glycine-glycine, 15 mM MgSO.,, 4 mM NaEGTA, 1 mM dithiothreitol, and 1% (vol/vol) Triton X-100, pH 7.8. Luciferase activity was measured using an Autolumat LB 953 luminometer (Berthold, Stevenage, UK). p-Galactosidase activity was also determined and used to normalize luciferase values for transfection efficiency. In Vitro Translation of Mutants and T3 Binding Assays For the measurement of ligand binding affinity, mutant receptors were synthesized in rabbit reticulocyte lysate from cDNA templates in pGEM7Z using the Promega TNT coupled transcription and translation system (Promega, Southampton, UK). The T3 binding affinity of each in vifro translated mutant was measured using a modification of a filter binding assay described previously (62). Data are the mean of at least two separate determinations, each performed in duplicate. For gel retardation assays, mutant proteins were synthesized using a noncoupled transcription and translation system, according to the manufacturer’s recommended protocol (Promega). Capped mRNAs transcribed from the above templates were used to program translation of [35S]methionine-labeled protein in rabbit reticulocyte lysate. After translation, 0.2 mg/ml RNaseA was added followed by 5 min incubation at 30 C, and aliquots of each translation product were analyzed by sddium dodecyl sulfate-polyacrylamide gel electrophoresis. The level of incorporated [%S]methionine was measured using a trichloroacetic acid precipitation method according to the recommended protocol (Promega). An estimate of total methionine incorporation was calculated on the basis that the rabbit reticulocyte lysate contained approximately 5 WM methionine (see Promega technical manual). These data were subsequently used to calculate the total amount of receptor synthe- 1275 sized, taking into account residues for some mutants. efficiency for each mutant intensity of the major band (Molecular Dynamics, Seal, equal amounts of ?S-labeled shift assays. Gel Mobility Shift the addition or loss of methionine In addition, relative translation was quantified by measuring the (-52 kDa) using a phosphorimager UK). This enabled the addition of mutant receptor in gel mobility Assays The nucleotide sequences of the 32P-labeled oligonucleotide duplexes used in gel mobility shift assays (with flanking sequences shown in lower case) were: (F2)5’-aaggggatccl’TATTGACCCCAGCTGAGGTCAAGTTAC Gagatcttcct-3’; (PAL)5’-aaggggatccTAAGATTCAGGTCATGACCTGAGGAG ATagatcttcct-3’; (ME)5’-aaggggatccAGGACGTTGGGGTTAGGGGAGGACAG TGGACagatcttcct-3’. Equal amounts of each 35S-labeled in vitro translated mutant protein (2-4 ~1) were preincubated at room temperature for 20 min in buffer (20 mM HEPES, 50 mrv KCI, 10% glycerol, 2 mM dithiothreitol, pH 7.8) in the presence of 1 pg poly (dl-dC). In vitro translated hRXRa and L-T3 were also present where specified. The total amount of reticulocyte lysate in each assay was standardized by the addition of nonprogrammed translation mixture. 32P-lab&d oligonucleotides were added followed by a further 15-min incubation at room temperature in a total volume of 20 ~1. The protein-DNA complexes were then analyzed using polyacrylamide gel electrophores in 0.5X TBE (44 mM Tris, 44 mM boric acid, 1 mM EDTA). The same amount of each mutant receptor was used in all experiments. The assays were replicated using mutant proteins from at least two independent translation reactions. Acknowledgments We thank R. Renkawitz and R. Evans for providing us with F2TKCAT and RXRa plasmids, respectively. We are indebted to the many physicians who referred cases of thyroid hormone resistance to us, without whom these studies would not have been possible. Received February 2, 1994. Revision received April 27, 1994. Accepted May 12,1994. Address requests for reprints to: V. Krishna Chatterjee, Department of Medicine, University of Cambridge, Level 5, Addenbrooke’s Hospital, Hills Road, Cambridge CB2 2QQ, United Kingdom. This work was supported by the Wellcome Trust and the Medical Research Council (U.K). ‘T. N. Collingwood and M. Adams contributed equally to this work and should both be considered first authors. REFERENCES 1. Shupnik MA, Chin WW, Habener JF, Ridgway EC 1985 Transcriptional regulation of the thvrotropin subunit oenes by thyroid hormone. J Biol Chem 260:2900-2903 2. Refetoff S. Weiss RE. Usala SJ 1993 The svndromes of resistanceto thyroid hormone. Endocr Rev ?4:348-399 3. Evans RM 1988 The steroid and thyroid receptor superfamily. Science 240:889-895 4. Usala SJ, Bale AE, Gesundheit N, Weinberger C, Lash RW, Wondisford FE, McBride OW, Weintraub BD 1988 Tight linkage between the syndrome of generalized thy- MOL 1276 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. ENDO. 1994 roid hormone resistance and the human c-erbAg gene. Mol Endocrinol 2:1217-l 220 Mixson AJ, Renault JC, Ransom S, Bodenner DL, Weintraub BD 1993 Identification of a novel mutation in the gene encoding the @-triicdothyronine receptor in a patient with apparent selective pituitary resistance to thyroid hormone. Clin Endocrinol(Ox9 38:227-234 Sasaki S, Nakamura H, Tagami T, Miyoshi Y, Nogimori T, Mitsuma T, lmura H 1993 Pituitary resistance to thyroid hormone associated with a base mutation in the hormone binding domain of the 3,5,3’-triiodothyronine receptor p. J Clin Endocrinol Metab 76:1254-l 258 Parrilla R, Mixson AJ, McPherson JA, McClaskey JH, Weintraub BD 1991 Characterization of seven novel mutations of the c-erbAg gene in unrelated kindreds with generalized thyroid hormone resistance. J Clin Invest 88:2123-2130 Takeda K, Weiss RE, Refetoff S 1992 Rapid localization of mutations in the thyroid hormone receptor-@ gene by denaturing gradient gel electrophoresis in 18 families with thyroid hormone resistance. J Clin Endocrinol Metab 741712-719 Chatter@ VKK, Nagaya T, Madison LD, Datta S, Rentoumis A, Jameson JL 1991 Thyroid hormone resistance syndrome: inhibition of normal receptor function by mutant thyroid hormone receptors. J Clin Invest 87:1977-l 984 Meier CA, Dickstein BM, Ashizawa K, McClaskey JH, Muchmore P, Ransom SC, Menke JB, Hao E-H, Usala SJ, Bercu BB, S-YCheng S-Y, Weintraub BD 1992 Variable transcriptional activity and ligand binding of mutant 01 3,5,3’-triiodothyronine receptors from four families with generalized resistance to thyroid hormone. Mol Endccrinol 6:248-258 Sakurai A, Miyamoto T, Refetoff S, DeGroot LJ 1990 Dominant negative transcriptional regulation by a mutant thyroid hormone receptor+ in a family with generalized resistance to thyroid hormone. Mol Endocrinol 4:19881994 Takeda K, Balzano S, Sakurai A, DeGroot LJ, Refetoff S 1991 Screening of nineteen unrelated families with generalised resistance to thyroid hormone for known point mutations in the thyroid hormone receptor fi gene and detection of a new mutation. J Clin Invest 87:496-502 Usala SJ, Menke JB, Watson TL, Wondisford FE, Weintraub BD, Berard J, Bradley WEC, Ono S, Mueller OT, Bercu BB 1991 A homozygous deletion in the cerbAS thyroid hormone receptor gene in a patient with generalized thyroid hormone resistance: Isolation and characterisation of the mutant receptor. Mol Endocrinol5:327-335 Desvergne 8, Petty KJ, Nikodem VM 1991 Functional characterization and receptor binding studies of the malic enzyme thyroid hormone response element. J Biol Chem 266:1008-l 013 Baniahmad A, Steiner C, Kohne AC, Renkawitz R 1990 Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site. Cell 61:505-514 Glass CK, Holloway JM, Devary OV, Rosenfeld MG 1988 The thyroid hormone receptor binds with opposite transcriptional effects to a common sequence motif in thyroid hormone and estrogen response elements. Cell 54: 13-323 Wahlstrom GM, Sjoberg M, Andersson M, Nordstrom K, Vennstrom B 1992 Binding characteristics of the thyroid hormone receptor home- and heterodimers to consensus AGGTCA repeat\ motifs. Mol Endocrinol 6:1013-l 022 Yen PM, Darling DS, Carter RL, Forgione M, Umeda PM, Chin WW 1992a Triiodothyronine (T3) decreases binding to DNA by T3-receptor homodomers but not receptor auxiliary protein heterodimers. J Biol Chem 267:35653568 Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM 1992 Retinoid x receptor interacts with nuclear receptors in Vol8 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33 34 35. 36. 37. No. 9 retinoic acid, thyroid hormone and vitamin DB signalling. Nature 355:446-449 Leid M, Kastner P, Lyons R, Nakshatri H, Chen J-Y, Staub A, Garnier J-M, Mader S, Chambon P 1992 Purification, cloning, and RXR identity of the HeLa cell factor with which-RAR or TR heterodimerizes to bind target seauences efficientlv. Cell 68:377-395 Zhang X-k, Hoffman B, Tran PB-V, Graupner G, Pfahl M 1992 Retinoid x receptor is an auxiliary protein for thyroid hormone and retinoic acid receptors. Nature 355: 441-445 Brent GA, Harney JW, Chen Y, Warne RL, Moore DD, Larsen PR 1989 Mutations of the rat growth hormone promoter which increase and decrease response to thyroid hormone define a consensus thyroid hormone response element. Mol Endocrinol 3:1996-2004 Forman BM, Samuels HH 1990 Interactions among a subfamily of nuclear hormone receptors: the regulatory zipper model. Mol Endocrinol 9:1293-l 301 Nagpal S, Friant S, Nakshatri H, Chambon P 1993 RARs and RXRs - evidence for 2 autonomous transactivation functions (AF-1 and AF-2) and heterodimerization in t&o. EMBO J 12:2349-2360 Andersson ML, Nordstrom K, Demczuk S, Harbers M, Vennstrom B 1992 Thyroid hormone alters the DNA binding properties of chicken thyroid hormone receptors (Y and 8. Nucleic Acids Res 20:4803-4810 Murray MB, Towle HC 1989 Identification of nuclear factors that enhance binding of the thyroid hormone receptor to a thyroid hormone response element. Mol Endccrinol 3:1434-1442 Burnside J, Darling DS, Chin WW 1990 A nuclear factor that enhances binding of thyroid hormone receptors to thyroid hormone response elements. J Biol Chem 265:2500-2504 Bugge TH, Pohl J, Lonnoy 0, Stunnenberg HG 1992 RXRa. a promiscuous partner of retinoic acid and thvroid hormonereceptors. EMBO J 11:1409-1418 Rosen ED. Beninahof EG. Koenia RJ 1993 Dimerization interfaces ‘of thy&d hormone, r&inoic acid, vitamin D, and retinoid x receptors. J Biol Chem 268:11534-l 1541 Au-Fliegner M. Helmer E, Casanova J, Raaka BM, Samuels HH 1993 The conserved ninth C-terminal heptad in thyroid hormone and retinoic acid receptors mediates diverse responses by affecting heterodimer but not homodimer formation. Mol Cell Biol 13:5725-5737 Zenke M, Munoz A, Sap J, Vennstrom B, Beug H 1990 v-erbA oncogene activation entails the loss of hormonedependent regulator activity of c-erbA. Cell 61 :1035-l 049 Saatcioglu F, Bartunek P, Deng T, Zenke M, Karin M 1993 A conserved c-terminal sequence that is deleted in verbA is essential for the biological activities of c-erbA (the thyroid hormone receptor). Mol Cell Biol 13:36753685 Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11 :1025-l 033 Fondell JD, Roy AL, Roeder RG 1993 Unliganded thyroid hormone receptor inhibits formation of a functional preinitiation complex: implications for active repression. Genes Dev 7:1400-1410 Baniahmad A, Ha I, Reinberg D, Tsai S, Tsai M-J, O’Malley BW 1993 Interaction of human thyroid hormone receptor p with transcription factor TFIIB may mediate gene derepression and activation by thyroid hormone. Proc Natl Acad Sci USA 90:8832-8836 Zavacki M, Harney JW, Brent GA, Larsen PR 1993 Dominant negative inhibition by mutant thyroid hormone receptors is thyroid hormone response element and receptor isoform specific. Mol Endocrinol 7:1319-l 330 McPhaul MJ, Marcelli M, Zoppi MS, Griffin JE, Wilson JD 1993 Genetic basis of endocrine disease 4: The spectrum Dominant 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48 49. 50. Negative Mutant Receptors in Thyroid Hormone Resistance of mutations in the androgen receptor gene that cause androgen resistance. J Clin Endocrinol Metab 76:17-23 Kristjansson K, Rut AR, Hewison M, O’Riordan JLH, Hughes MR 1993 Two mutations in the hormone binding domain of the vitamin D receptor cause tissue resistance to 1,25 dihydroxyvitamin D3. J Clin Invest 92:12-l 6 Forman BM, Yang C-R, Au M, Casanova J, Ghysdael J, Samuels HH 1989 A domain containing leucine-zipper-like motifs mediate novel in viva interactions between the thyroid hormone and retinoic acid receptors. Mol Endocrinol3:161 O-l 626 Fawell S, Lees JA, White R, Parker MG 1990 Characterization and colocalization of steroid binding and dimerization activities in the mouse estrogen receptor. Cell 60:953-962 Glass CK, Lipkin SM, Devary OV, Rosenfeld MG 1989 Positive and negative regulation of gene transcription by a retinoic acid-thvroid honone receptor heterodimer. Cell 59:697-708 . Perlmann T, Rangarajan PN, Umesono K, Evans RM 1993 Determinants for selective RAR and TR recoonition of direct repeat HREs. Genes Dev 7:1411-1422 Behr M, Loos U 1992 A point mutation (Ala’= to Thr) in the hinge domain of the c-erbAP thyroid hormone receptor gene in a family with generalized thyroid hormone resistance. Mol Endocrinol6:1119-1126 Lee Y, Mahdavi V 1993 The D domain of the thyroid hormone receptor al specifies positive and negative transcriptional regulation functions J Biol Chem 268: 2021-2028 Kurokawa R, Yu VC, Naar A, Kyakumoto S, Han Z, Silverman S, Rosenfeld MG, Glass CK 1993 Differential orientations of the DNA-binding domain and carboxyterminal dimerization interface regulate binding site selection by nuclear receptor heterodimers. Genes Dev 7: 1423-1435 Hamy F, Helbeque NJ, Henichart P 1992 Comparison between synthetic nuclear localisation signal peptides from the steroid thyroid hormone receptor superfamily. Biochem Biophys Res Commun 182:289-293 Yen PM, Sugawara A, Refetoff S, Chin WW 1992b New insights on the mechanism(s) of the dominant negative effect of mutant thyroid hormone receptor in generalized resistance to thyroid hormone. J Clin Invest 90: 1825-l 831 Nagaya T, Jameson JL 1993 Thyroid hormone receptor dimerization is required for dominant negative inhibition by mutations that cause thyroid hormone resistance. J Biol Chem 268:15766-15771 Barettino D, Bugge TH, Bartunek P, Vivanco Ruiz Md M, Sonntag-Buck V, Beug H, Zenke M, Stunner&erg HG 1993 Unlioanded T3R, but not its oncoaenic variant, verbA, suppresses RARdependent trangactivation by titratina out RXR. EMBO J 12:1343-l 354 Meier CA, Parkinson C, Chen A, Ashizawa K, MeierHeusler S, Muchmore P, Cheng S, Weintraub BD 1993 Interaction of human /31 thyroid hormone receptor and its mutants with DNA and retinoid x receptor 0: T3 response 1277 element-dependent dominant negative potency. J Clin Invest 92:1986-l 993 51. Chatterjee VKK, Lee J-K, Rentoumis A, Jameson JL 1989 Negative regulation of the thyroid-stimulating hormone (Y gene by thyroid hormone: Receptor interaction adjacent to the TATA box. Proc Natl Acad Sci USA 86:9114-9118 52. Pennathur S, Madison LD, Kay TWH, Jameson JL 1993 Localization of promoter sequences required for thyrotropin-releasing hormone and thyroid hormone responsiveness of the glycoprotein hormone a-gene in primary cultures of rat pituitary cells. Mol Endocrinol 7:797-805 53. Cooney AJ, Tsai SY, O’Malley BW, Tsai MJ 1992 Chicken ovalbumin upstream promoter transcription factor (COUP-TF) dimers bind to different GGTCA response elements, allowing COUP-TF to repress hormonal induction of the vitamin DS, thyroid hormone, and retinoic acid receptors. Mol Cell Biol 12:4153-4163 54. Persani L, Asteria C, Tonacchera M, Vitti P, Chatterjee VKK, Beck-Peccoz P 1994 Evidence for the secretion of thyrotropin with enhanced bioactivity in syndromes of thyroid hormone resistance. J Clin Endocrinol Metab 78:1034-l 039. 55. Sadowski I, Ptashne M 1989 A vector for expressing GAL4(1-147) fusions in mammalian cells. Nucleic Acids Res 17:7539 56. Vasavada HA, Ganguly S, Germino FJ, Wang ZX, Weissman SH 1991 A contingent replication assay for the detection of protein-protein interactions in animal cells. Proc Natl Acad Sci USA 88: 10686-l 0690 57. Wood WM, Kao MY, Gordon DF, Ridgeway EC 1989 Thyroid hormone regulates mouse thyrotropin @subunit gene promoter in transfected primary thyrotropes. J Biol Chem 264:14840-l 4847 58. Luckow B, Schutz G 1987 CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulator elements. Nucleic Acids Res 15:5490 59. Webster N, Jin JR, Green S, Hollis M, Chambon P 1988 The human UASG is a transcriptional enhancer in human HeLa cells in the oresence of the GAL4 trans-activator. Cell 52:169-l 78 60. Mizushima S, Nagata S 1990 pEF-BOS, a powerful mammalian exoression vector. Nucleic Acids Res 18:5322 61. Samuels HH, Stanley F, Casanova J 1979 Depletion of L-3,5,3’ -triiodothyronine and L-thyroxine in euthyroid calf serum for use in cell culture studies on the action of thyroid hormone. Endocrinology 105:80-85 62. Adams M, Nagaya T, Tone Y, Jameson JL, Chatterjee VK 1992 Functional properties of a novel mutant thyroid hormone receptor in a family with generalized thyroid hormone resistance syndrome. Clin Endocrinol (0x9 36:281-289 63. Sakurai A, Nakai A, DeGroot LJ 1990 Structural analysis of human thyroid hormone receptor p gene. Mol Cell Endocrinol71:83-91 64. O’Donnell AL, Koenig RJ 1990 Mutational analysis identifies a new functional domain of the thyroid hormone receptor. Mol Endocrinol4:715-720