Download Supplementary information

Development 143: doi:10.1242/dev.126573: Supplementary information
Supplementary Materials and Methods
Constructs
For transient transgenesis in chick, the following expression plasmids were used: pCA containing
GFP (0.4 g/ml), pCAAGS containing RFP (0.4 g/ml), pCA containing full-length chick Sdf1 (0.8
g/ml) subcloned from chicken EST clones (MRC chicken database), and pCA containing a chick
dominant-negative form of CXCR4 (DN-Cxcr4, 0.8 g/ml). The DN-Cxcr4 construct was designed by
mutating the amino acid 217 to introduce a stop codon. This results in the truncation of the
intracytoplasmic tail of the CXCR4 protein, thereby eliminating the sequences that confer G protein
phosphorylation activity and -arrestin recruitment, the major signal transduction pathways implicated
in its chemotactic activity (Cronshaw et al., 2010). For miRNA experiments, pcDNA6.1 Gw/EmGFPmiR chick Cxcr4 (miRNA-Cxcr4, 1.0 g/ml) and pcDNA6.1 Gw/EmGFP-miR control (miRNA-cont,
1.0 g/ml) were constructed as described in the manufacturer's instructions using BLOCK-iT Pol II
miR RNAi Expression Vector Kit (Invitrogen, K4935-00). The three following CXCR4 target
sequences were used: TGTTGGCTGCCGTATTACATT (Liang et al., 2007),
AAGCTGTTGGCTGAGAAGATT and GATTGGCTCAGCTGACTAT (Kasemeier-Kulesa et al.,
2010). All three miRNAs tested individually were found to give comparable results, notably to repress
Electroporation
For in ovo neural tube electroporation, plasmids of interest were mixed with plasmids encoding GFP
or RFP at the concentrations indicated above and microinjected into the lumen of the neural tube.
Electrodes (CUY610 platinum-coated, Sonidel, Ireland) were applied onto the vitelline membrane on
either side of the appropriate neural tube region and 5 square pulses (20 V, 50 ms length, 500 ms gap)
were delivered. For the analysis of pharyngeal NC derivatives, pulses were delivered bilaterally to
electroporate both sides of the neural tube. Embryos were reincubated for up to 8 days after
electroporation, harvested in phosphate-buffered saline (PBS) and monitored for GFP or RFP
fluorescence at the appropriate axial levels. The efficiency of the transfections was verified on whole
Development • Supplementary information
CXCR4 expression (Fig. S5).
Development 143: doi:10.1242/dev.126573: Supplementary information
mount or sections by in situ hybridizations for Sdf1 and immunofluorescent labelling for CXCR4.
Real-time qRT-PCR
qRT-PCR was performed using LightCycler 480 SYBR Green I Master mix (Roche) and cDNA
synthesized using first-strand cDNA synthesis kit (Roche) from embryonic RNAs isolated with
NucleoSpin RNA/Protein kit (Macherey-Nagel). Pharyngeal region of E9.5 embryos were manually
dissected from Tbx1+/- X Tbx1+/- intercrosses. Expression levels between wild-type (n=8), Tbx1+/(n=6) and Tbx1-/- (n=6) embryos were calculated by the comparative cycle threshold (ΔΔCT) method.
Each experiment was performed in triplicate for each genotype and normalized to endogenous TBP
housekeeping gene. Normalized expression levels in the control (Tbx1+/+) were set to 1.0 for each
gene. Student's t-tests was used to determine statistical significance.
Supplementary references
Cronshaw, D.G., Nie, Y., Waite, J., Zou, Y.R. (2010) An essential role of the cytoplasmic tail of
CXCR4 in protein signaling and organogenesis. PLoS One. 5, e15397.
Liang, Z., Wu, H., Reddy, S., Zhu, A., Wang, S., Blevins, D., Yoon, Y., Zhang, Y., Shim, H.
(2007) Blockade of invasion and metastasis of breast cancer cells via targeting CXCR4 with an
artificial microRNA. Biochem Biophys Res Commun. 363, 542-6.
Development • Supplementary information
Kasemeier-Kulesa, J. C., McLennan, R. , Romine, M. H. , Kulesa, P. M. , Lefcort, F. (2010)
CXCR4 controls ventral migration of sympathetic precursor cells. J Neurosci. 30, 13078-88.
Development 143: doi:10.1242/dev.126573: Supplementary information
Table S1. Quantitation of the skeletal anomalies in the hyoid bone and lower jaw caused by mis-
Development • Supplementary information
regulation of CXCR4 signaling.
Development 143: doi:10.1242/dev.126573: Supplementary information
Development • Supplementary information
Fig. S1. CXCR4 is expressed in the aortic arches in PA after NC colonization in both mouse and
chick. (a,b) Horizontal sections through PA2 of a CXCR4-EGFP transgenic mouse embryo at E10.5.
Visualization of GFP (a) and immunolabelling of CD31 (b), a marker of endothelial cells. (c, d) GFP
visualization and CXCR4 immunodetection on cross-sections through PA2 of a GFP-transgenic chick
chimera at E3. CXCR4 is absent from GFP-positive NC in PA and is restricted to the aortic arch. Ao:
aortic arch. Bar: 50 µm.
Development 143: doi:10.1242/dev.126573: Supplementary information
Development • Supplementary information
Fig. S2. High magnification views of the pharyngeal area during early NC colonization in chick.
Cross-sections through PA1 in embryos at E1.5 (15 somite stage) (a-d) and at E2 (25 somite stage) (eh). In situ hybridizations for Sdf1 and Tbx1 and immunolabelings for CXCR4 and HNK1, illustrating
matching expressions of Tbx1 and Sdf1 in the ectoderm and the pharyngeal endoderm while Cxcr4 is
in migrating NC (arrows) and in the aortic arches. Ao: aortic arch, ec: ectoderm, en: endoderm, cm:
cranial mesoderm, ph: pharynx. Bars:150 µm
Development 143: doi:10.1242/dev.126573: Supplementary information
Development • Supplementary information
Fig. S3. Sdf1 and Cxcr4 expressions are restricted to pharyngeal NC in chick. (a-c) Whole-mount
views (a-c) of the anterior region of chick embryos at E2.5 hybridized for Sdf1, Cxcr4 and Sox10.
Contrary to pharyngeal NC which express high levels of Cxcr4 and migrate towards PA1-4 in an Sdf1expressing environment, trunk Sox10-positive NC (arrow in c) express virtually no Cxcr4. In the
trunk, Cxcr4 and Sdf1 mark essentially the intersegmental arteries (arrowheads in a, b). The doubleheaded arrow indicates the limit between the cranial and truncal regions. ht: heart, ov: otic vesicle. (df) Serial cross-sections through the anterior trunk of embryos at E2.5 illustrating the absence of Sdf1 in
the superficial ectoderm and of Cxcr4 in trunk NC (arrows) identified by HNK1 staining. Note, in
contrast, conspicuous Sdf1 expression at the periphery of the aorta while Cxcr4 is found primarily in
the neural tube. ao: aorta, ec: ectoderm, en: endoderm, my: myotome, nt: neural tube ; ov: otic vesicle,
sc:sclerotome. Bars: 50 µm.
Fig. S4. Sdf1 mis-expression causes misrouting of pharyngeal NC migration. (a-e) Cross-sections
through the anterior hindbrain of Sdf1-electroporated embryos at E2 (15 hours post-electroporation;
hpe) (a-b) and at E2.5 (24 hpe) (c-e). In situ hybridizations for Sdf1, Cxcr4 or Sox10 and GFP
visualizations combined with immunodetection for HNK1 and DAPI staining, showing the large
accumulation of Cxcr4-positive NC (arrows) along the Sdf1-transfected side of the neural tube. (f-j)
Whole-mount view (f) and cross-sections at the level of the otic vesicle (g-j) of Sdf1-electroporated
embryos at E3.5 (48 hpe). In situ hybridization for Sdf1 and detection of GFP, CXCR4 and HNK1
combined with DAPI staining, showing NC accumulation (arrows) around the otic vesicle and the
cranial ganglia along the Sdf1-transfected side of the neural tube. Prolonged expression of Sdf1 leads
to CXCR4 down-regulation in both NC and the portion of the neural tube expressing Sdf1, illustrating,
as previously described (Escot et al., 2013), the cross-regulation between the expressions of the ligand
and its receptor. ao:aortic arch, ec: ectoderm, en: endoderm, hb : hindbrain, ov : otic vesicle, VIII, IX :
vestibuloacoustic and glossopharyngeal ganglia. Bars: 100 µm.
Development • Supplementary information
Development 143: doi:10.1242/dev.126573: Supplementary information
Development 143: doi:10.1242/dev.126573: Supplementary information
Development • Supplementary information
Fig. S5. CXCR4 expression is abolished by miRNA-Cxcr4 transfection. GFP visualization
combined with CXCR4 immunodetection. Cross-sections of miRNA-Cxcr4 electroporated-embryos,
showing CXCR4 down-regulation 48 hours post-electroporation (B, arrow) on the electroporated side
(A, arrow).