Download Xin_Zhou_Master_Thesis

The Pennsylvania State University
The Graduate School
Intercollege Graduate Program in Genetics
THE MOLECULAR BASIS OF SSRA DELETION
PHENOTYPE IN DIFFERENT BACTERIA
A Thesis in
Genetics
by
Xin Zhou
2008 Xin Zhou
Submitted in Partial Fulfillment
of the Requirements
for the Degree of
Master of Science
December 2008
The thesis of Xin Zhou was reviewed and approved* by the following:
Kenneth C. Keiler
Associate Professor of Biochemistry and Molecular Biology
Thesis Advisor
Zhi-chun Lai
Professor of Biology
Richard W. Ordway
Associate Professor of Biology
Chair, Intercollege Graduate Degree Program in Genetics
*Signatures are on file in the Graduate School
iii
ABSTRACT
ssrA, a gene that encodes tmRNA is found in all bacteria that have been examined.
tmRNA is a unique small RNA that has properties of both tRNA and mRNA. Using its
unusual structure, tmRNA plays an important role in ribosome rescue and protein quality
control through a trans-translation process. In this remarkable process, tmRNA first
recognizes stalled translation complex by an unknown mechanism and enters the A site of a
stalled ribosome like a tRNA. After transpeptidation reaction, the nascent polypeptide chain
is transferred to the alanyl-tmRNA. tmRNA then moves from the A site to the P site in the
ribosome and the translation template switches from the former mRNA to the mRNA portion
within tmRNA. Normal translation continues till the ribosome reaches the stop codon within
tmRNA. Release factors are recruited and the ribosomes, which were originally stalled on the
mRNA, get released from the tmRNA and recycled. A peptide tag encoded by tmRNA is
added to the polypeptide. This peptide tag is recognized by a number of intracellular
proteases and therefore targets the tagged protein for rapid degradation.
The deletion of ssrA causes different phenotypes in different bacterial species. In
Caulobacter crescentus, ssrA deletion causes a specific delay in DNA replication initiation as
well as a defect in maintaining pBBR1 family plasmids. In Escherichia coli, ssrA deletion
results in higher sensitivity to heat shock and lower motility on semi-solid agar. In Shigella
flexneri, a closely related species of E. coli, ssrA deletion is lethal. This study has identified
three genes in C. crescentus that inactivation of any of these genes in ∆ssrA strain can bypass
the plasmid maintenance defect. This study has also demonstrated that not only is ssrA
essential in S. flexneri, some DNA element(s) can even bypass this phenotype in S. flexneri.
Understanding the molecular basis of the ssrA deletion phenotypes can shed light on
elucidating the physiological role of tmRNA in different species and understanding how
iv
tmRNA is integrated into bacterial genetic network. Since tmRNA is important for bacterial
pathogenesis, this study may also reveal targets for new antibiotic development.
v
TABLE OF CONTENTS
List of Figures……………………………………………………………………………………..……….vi
List of Tables…………………………………………………………………………………….…..…….vii
Acknowledgement………………………………………………………………………….…………….viii
Chapter 1. TMRNA IN EUBACTERIA ……………………………………………………….………...1
Introduction …………………………………………………………….…………………..…….….……...2
tmRNA structure………………………………………………………….……………………...……….....2
The trans-translation model ………………………………………………………………………...………3
Physiological roles of tmRNA in eubacteria …………………………………………………….…...……..6
What can induce tmRNA tagging?…………………………………………………….……….…….……..7
tmRNA associated protein factors …………………………………………………………….……………9
References ………………………………………………………………………….……….……………..11
Chapter 2. SSRA IS ESSENTIAL IN SHIGELLA FLEXNERI BUT NOT IN THE CLOSE
RELATED SPECIES ESCHRICHIA COLI …………………………………………………………..16
Abstract ………………………………………………………………….………………………………...17
Introduction …………………………………………………………………….…………………….……18
Results…………………………………………………………….…………………………………... …..21
Discussion ………………………………………………………………………….……………………...25
Materials and Methods ……………………………………………………………………...……………..27
References …………………………………………………………………….…………………………...30
Chapter 3. IDENTIFICATION OF MUTANTS THAT BYPASS THE PLASMID MAINTENANCE
DEFECT IN ∆SSRA C. CRESCENTUS ……………………………………………………………..….32
Abstract …………………………………………………………….……………………………………...33
Introduction …………………………………………………………….…………………………..……...34
Results……………………………………………………….……………………………………..……... 36
Discussion………………………………………………….………………………………………..……. 40
Materials and Methods ……………………………………………………………….……………..……..42
References …………………………………………………………………….……………………..…….45
vi
LIST OF FIGURES
Fig.1 Proposed secondary structure of E. coli tmRNA……………………………..…………….…..……..3
Fig.2: Current model suggested for protein degradation through tmRNA pathway.. ………………………5
Fig. 3 Colony PCR of the ssrA::kan replacement…………………………………..…………...…………23
Fig. 4 The ssrA::kan replacement was further confirmed by southern blot……….…………….…….…. .23
Fig. 5 Hfr mapping set……………………………………………………………………………..……….24
Fig. 6 The cell cycle of C. crescentus…………………………………………………….….…..…………35
Fig 7. Processing tmRNA in C. crescentus……………………………………………….…...…..……….35
Fig 8. Souther blot results confirm the knockouts of the three target genes ………………….…….……..37
Fig 9. The growth curve of the three mutations ………………………………………….…...….………..38
Fig 10. Mapping of the transposon insersion…………………………………….……………...…………43
vii
LIST OF TABLES
Table 1 Phage transduction table …………………………….………………….……..……..……………28
Table 2. The doubling time of the three mutants……………………………….…………...…….……… 39
Table 3. Primers for specific gene knockout……………………………………………..…..…………….44
viii
ACKNOWLEDGEMENT
It is impossible to overstate my gratitude to my advisor, Dr. Kenneth Keiler. He possesses
all the characters that the greatest mentor can possibly have: knowledgeable, patient,
supportive, inspiring, understanding, responsible, enthusiastic and many more. It has been an
honor to be his student and I have learned a lot from him, both inside and outside science.
I am so lucky to meet Dr. Richard Ordway, the chair of the Genetics Graduate Program, a
mentor who treats his students like his kids, a friend who is always ready to give a hand, a
person who has changed my life. He is truly the best Program leader I have even seen and I
am greatly indebted to him for his guidance, help and support.
I am very thankful to my committee members, Dr. Zhichun Lai, Dr. Ming Tien, Dr.
Robert Paulson and Dr. Kathleen Postle for all the helpful discussions and suggestions.
I am very thankful to the past and present lab members in the Keiler Lab, Dr. Faith Lessner,
Dr. Lin Cheng, Dennis Lee, Jay Russell, Elisabeth Mahen, Ling Li, Anastasiya Yakhnin for
all the suggestions and help. This is a wonderful group and I am so honored to be part of it.
I also want to thank all my friends at State College. They are a great part of my life at
Happy Valley and they made the past three and half years enjoyable, exciting and
unforgettable to me.
Specifically, I want to express my gratitude to my girlfriend, Yinglu Wang. She brings
color into my life and makes me feel that I have a home and a family here in State College.
She always gives me strength when I am down and I feel blessed to be with her. Without her
help and support, everything that I have achieved, including this thesis, is impossible.
Last but not least, I want to thank my Mom and Dad for their tremendous understanding,
encouragement and love. I feel warm and strong every time I think of them. To them I
dedicate this thesis.
CHARPTER 1
TMRNA IN EUBACTERIA
2
Introduction
Sensing and adaptation to the changing environment is crucial for the survival of
bacteria. Although sensory and regulatory proteins have been found to be important in this
process, more and more evidence suggests that the contribution from small RNAs is not
neglectable. Small RNAs have been found to affect gene expression through three
mechanisms. First, small RNAs can complementarily pair with target mRNAs to affect their
stability and translation (Gottesman, 2002). Second, small RNAs can also bind to proteins
factors
to
affect
the
transcription
or
translation
levels
of
their
regulons.
(Gottesman, 2002). Third, tmRNA, a unique small RNA molecule encoded by ssrA, can
affect gene expression through trans-translation (Keiler et al., 1996). tmRNA was first
discovered in E. coli in 1978 (Lee et al., 1978). Then it was subsequently found in all bacteria
species that has been examined. It is highly expressed and conserved in bacteria (Keiler et al.,
2000), suggesting that tmRNA plays an important role in bacterial physiology.
tmRNA structure
As its name suggests, tmRNA has properties of both tRNA and mRNA. It possesses a
very unique structure with a tRNA-like domain and an mRNA-like domain (Fig.1). The 5’
end and 3’ end of mature tmRNA can partially base pair with each other and fold into a tRNA
like structure with a D-arm, a T-arm and an acceptor arm.
The acceptor arm contains a G:U
wobble in the third base pair position just as in alanyl-tRNA (Ushida et al., 1994). In vivo and
in vitro assays showed that tmRNA can be charged with alanine by alanyl-tRNA synthetase
(Komine et al., 1994). The mRNA-like domain contains an open reading frame (ORF), which
can be translated into a short peptide with 8 to 35 amino acids, depending on the species of
the bacterium. There is some variation in the sequence of this short peptide among species
but Ala and Asp are the most commonly used residues (Moore et al., 2007). There are also
3
three to four pseudonknots in the tmRNA molecule, depending on the species (Felden et al.,
1997). The sequences that constitute the pseudoknots are not very conserved among species
(Moore et al., 2007) but this structure seems to be important in tmRNA folding, stability and
associate protein(s) binding (Wower, 2004).
Fig.1 Proposed secondary structure of E. coli tmRNA. The 5’ and 3’ ends of the RNA are folded into a
tRNA-like structure and can be charged with alanine by alanyl-tRNA synthetase. The other half of the
RNA contains an open reading frame that encodes a special peptide that leads tagged proteins to
proteolysis (Dulebohn et al., 2007).
The trans-translation model
Normal translation process in bacteria starts with the binding of ribosomes to mRNA
molecule. The ribosome moves along the mRNA till it encounters a stop codon. The
ribosome then dissociates from the mRNA with the help from release factors and the finished
peptide is released. However, in bacteria, transcription and translation are coupled. Therefore
4
even if an mRNA is truncated due to premature transcription termination, partial degradation,
or physical/chemical damage (Roche et al., 1999), ribosomes will still bind to the mRNA and
start translation. The consequence is that ribosomes frequently reach the end of an mRNA
without terminating at a stop codon and cannot be released. It is estimated that this event
occurs about 13000 times per cell per generation (Moore et al., 2005) so it is obvious that
there must be some mechanisms through which cells can recycle these stalled ribosomes and
maintain a pool of active ribosomes for new translation.
tmRNA solves this problem by tagging the incomplete protein for rapid degradation and
releasing the stalled ribosomes from the mRNA. In this remarkable mechanism, tmRNA first
recognizes the stalled translation complex and enters the A site of a stalled ribosome like a
tRNA. Transpeptidation reaction occurs and the nascent polypeptide chain is transferred to
alanyl-tmRNA. tmRNA then moves with the nascent peptide chain at the 3’ end of the
acceptor arm from the A site to the P site in the ribosome. The translation template switches
from the former mRNA to the mRNA portion within tmRNA. The mRNA is released from
the complex and degraded. Normal translation continues and terminates at the stop codon
within tmRNA. The stalled ribosomes get released and recycled later. A peptide tag encoded
by tmRNA is added to the polypeptides. This peptide tag is recognized by a number of
intracellular proteases and targets the tagged protein for rapid proteolysis (Gottesman et al.,
1998; Keiler et al 1996; Herman et al., 1998) (Fig.2).
5
Fig.2: Current model suggested for protein degradation through tmRNA pathway. tmRNA charged with
alanine enters the ribosomal A site acting like a tRNA. The nascent protein is transferred to alanyl-tmRNA
by a normal transpeptidation reaction. Then the translational reading frame switches from the original
mRNA to a reading frame within the tmRNA. Translation resumes using the reading frame in tmRNA and
the peptide tag is added to the nascent polypeptid. The tmRNA-encoded peptide tag targets the incomplete
protein for rapid degradation. (Keiler, 2007)
Data from many experiments have been found to be in accordance with this
trans-translation model. For example, the N-terminal domain of namda repressor generated
from an mRNA without in frame stop codon was found to be tagged at the C terminal by
tmRNA and was rapidly degraded (Keiler et al., 1996). tmRNA can only associate with 70s
ribosomes but not 30s or 50s subunits (Ushida et al., 1994; Komine et al., 1996). Also a
cryoelectron microscopy structure has shown the association of tmRNA and ribosome (Valle
et al., 2003).
The correct tag sequence is critical and sufficient for the recognition of the intracellular
proteases. For example, GFP with the tag sequence in E. coli can be rapidly degraded both in
6
vivo and in vitro (Cheng et al., 2007). It has also been reported that after the last two residues
in the tmRNA ORF were changed from alanine to aspatate, the variant tmRNAs can still
recognize stalled the ribosomes and tag their substrates. However, the half-life of most of the
tagged proteins is noticeably longer (Keiler et al., 1996).
To sum up, there are three outcomes after the trans-translation process. 1) The stalled
ribosomes are rescued. 2) The truncated mRNA is degraded. 3) The incomplete protein is
degraded. These three outcomes are important for the well-being of cells. It is estimated that
the ribosome stalling events occurs about 13000 times per cell per generation (Moore et al.,
2005). So if there is no ribosome recycling mechanism, all ribosomes would be stalled on
mRNAs in less than one cell cycle and the cell will die (Keiler, 2007). Also, the polypeptides
synthesized from truncated mRNAs are incomplete. They may have some malfunctions
because of misfolding, or they may clog the chaperone and proteolysis pathways and
generating detrimental activities (Keiler, 2007). Last but not least, the truncated mRNAs will
keep trapping and stalling ribosomes if they are not degraded. Since tmRNA pathway solves
these three fundamental problems, it should play a critical role in bacterial physiology.
Physiological roles of tmRNA in eubacteria
tmRNA is important for bacterial pathogenesis
It is found that tmRNA is important for bacterial pathogenesis. For example, in Yersinia
pseudotuberculosis, without tmRNA the bacterium is no longer able to cause lethal phenotype
in mice (Okan et al., 2006). In Salmonella typhimurium, deletion of ssrA results in lower
virulence in mice (Julio, 2000). In Neisseria gonorrhoeae, ssrA is an essential gene (Huang et
al., 2000). Data in this study showed that ssrA is also essential in Shigella flexneri. All of
these evidences suggest that tmRNA plays an important role in bacterial pathogenesis.
7
tmRNA is important for bacterial stress tolerance
It is found that tmRNA is important for bacterial stress tolerance. For example, ssrA
deletion in E. coli is not lethal. However, ∆ssrA E. coli strain exhibits higher sensitivity to
heat shock (Kirby et al., 1994) and antibiotic treatment (Abo et al., 2002). It also displays
lower motility in semi-solid ager (Kirby et al., 1994) and slower recovery from carbon
starvation (Oh et al., 1991). ∆ssrA B. Subtilis also shows higher sensitivity to high
temperature (over 40oC) and high concentrations of ethanol or cadmium chloride (Muto et al.,
2000).
tmRNA is important for bacterial development
It is also found that tmRNA is important for bacterial development. For example, in C.
crescentus, the deletion of ssrA causes a specific delay in chromosomal DNA replication
initiation (Keiler et al., 2003). In Bradyrhizobium japonicum, the deletion of ssrA results in
slower growth under free living conditions and a severe defect in colonizing the root nodules
(Ebeling et al., 1991).
What can induce tmRNA tagging?
Figuring out what can induce tmRNA tagging is crucial for understanding its biological
function in bacteria. Although initially only mRNAs without stop codons were found to be
tagged by tmRNA (Keiler et al., 1996), recent studies have shown that the tmRNA pathway is
far more complicated than what were originally expected.
Truncated mRNAs without stop codon
Several pathways in bacterial cells can result in truncated mRNAs without stop codon,
including premature transcription termination, partial degradation, and physical/chemical
8
damage (Roche et al., 1999). Transcript and translation in prokaryotes are coupled so even
the 3’ end of an mRNA is truncated, ribosomes will still bind to the 5’ of the mRNA and start
translation. When the ribosomes reach the end of the mRNA without stop codon, they cannot
get dissociated and released because release factors cannot be recruited (Keiler et al., 1996).
tmRNA pathway can release the truncated mRNA, dissociate the subunits of the ribosomes
and tag the incomplete peptide for degradation.
Intact mRNAs with rare codons or inefficient stop codons
Under stress conditions such as amino acid starvation, rare codons may trigger tmRNA
tagging activity, especially when there are more than one consecutive rare codons. The
ribosomes may stall at the rare codons and the mRNA will be cleaved within or beside the
ribosome A site (Li et al., 2006). This process generates an mRNA molecule without a stop
codon, which can trigger tmRNA tagging. Over expression of the cognate tRNA to the rare
codon reduces the level of tmRNA tagging while depletion of the cognate tRNA increases the
level of tagging (Roche et al., 1999).
Changing the rare codon to the more preferred codon
in the species can also reduce the level of tagging (Hayes et al., 2002). It has also been found
that translational readthrough, which is caused by inefficient opal stop codon (UGA) can lead
to tmRNA tagging too (Sunohara et al., 2002). Similarly, changing the inefficient opal stop
codon to a more efficient ochre stop codon can reduce the level of tmRNA tagging (Hayes et
al., 2002).
DNA motif
Most recent study in our lab has shown that among all the tmRNA substrates in
Caulobacter crescentus, about 66% of them contain a conserved DNA motif
“CGACAAGATCGTCGTG” (Hong et al., 2007). When the motif is mutated, the level of
9
tmRNA tagging decreases. However, the mechanism why this DNA motif can lead to
tmRNA tagging is still unknown.
The C terminal sequence of some proteins
The C terminal sequences of some proteins are also critical in tmRNA tagging
determination. For example, YbeL, an E. coli protein, can be tagged by tmRNA in full length.
It has been found that the C-terminal residue, proline, of YbeL is sufficient to induce tmRNA
tagging. It has also been found that the penultimate amino acid can positively affect the level
of tagging if they are Asp, Glu, Ile, Pro or Val (Hayes et al., 2002).
tmRNA associated protein factors
tmRNA does not act alone. There are several protein factors that are important for the
function and stability of tmRNA.
SmpB
SmpB is required for tmRNA function. It binds to tmRNA specifically and mediates the
interaction between tmRNA and the ribosome (Metzinger et al., 2005, Karzai et al., 1999,
Hallier et al., 2004). In C. crescentus, SmpB is also required for tmRNA stability (Hong et al.,
2005). Deletion of the smpb gene results in the same phenotype as deletion of ssrA gene
(Karzai et al., 1999, Julio et al., 2000, Keiler et al 2003).
Alanine tRNA synthetase and EF-Tu
Since tmRNA has properties of an Ala-tRNA, it is not surprising that Alanine tRNA
synthetase and EF-Tu, the two translational factors are also required for tmRNA function.
Alanine tRNA synthetase can charge the 3’ end of tmRNA with Alanine (Komine, Y., et al.,
10
1994). EF-Tu protects the ester bond of Alanine charged tmRNA and delivers the tmRNA to
ribosomes (Barends, 2000; Rudinger-Thirion et al., 1999, Valle et al., 2003).
RNase R
RNase R, encoded by rnr, is a highly conserved exoribonuclease (Zuo et al., 2001). In
E. coli, it is important for non-stop mRNAs degradation (Karzai et al., 2001). In C. cresentus,
it degrades tmRNA in the absence of SmpB (Hong et al., 2005). In S. flexneri, it is required
for the expression of virulence genes, which may have some relationship with tmRNA
activity (Tobe et al., 1992).
11
References
Abo T, Ueda K, Sunohara T, Ogawa K, Aiba H. SsrA-mediated protein tagging in the presence of
miscoding drugs and its physiological role in Escherichia coli. Genes Cells, 2002. 7(7): p. 629-38.
Barends, S., J. Wower, and B. Kraal, Kinetic parameters for tmRNA binding to alanyl-tRNA synthetase
and elongation factor Tu from Escherichia coli. Biochemistry, 2000. 39(10): p. 2652-8.
Cheng L, Naumann TA, Horswill AR, Hong SJ, Venters BJ, Tomsho JW, Benkovic SJ, Keiler KC.
Discovery of antibacterial cyclic peptides that inhibit the ClpXP protease. Protein Sci, 2007. 16(8): p.
1535-42.
Dulebohn D, Choy J, Sundermeier T, Okan N, Karzai AW. Trans-translation: the tmRNA-mediated
surveillance mechanism for ribosome rescue, directed protein degradation, and nonstop mRNA decay.
Biochemistry. 2007 Apr 24;46(16):4681-93.
Ebeling, S., Kundig, C., and Hennecke, H. (1991). Discovery of a rhizobial RNA that is essential for
symbiotic root nodule development. J Bacteriol 173, 6373-6382.
Felden, B Himeno H, Muto A, McCutcheon JP, Atkins JF, Gesteland FR. Probing the structure of the
Escherichia coli 10Sa RNA (tmRNA). RNA, 1997. 3(1): p. 89-103.
Gottesman, S. (2002) Stealth
regulation:
biological
circuits
with
small
RNA
switches. Genes
Dev 16: 2829–2842.
Hallier, M, Ivanova N, Rametti A, Pavlov M, Ehrenberg M, Felden B. Pre-binding of small protein B to a
stalled ribosome triggers trans-translation. J Biol Chem, 2004. 279(25): p. 25978-85.
Hayes, C.S., B. Bose, and R.T. Sauer, Proline residues at the C terminus of nascent chains induce SsrA
tagging during translation termination. J Biol Chem, 2002. 277(37): p. 33825-32.
12
Hayes, C. S., Bose, B., and Sauer, R. T. (2002b). Stop codons preceded by rare arginine codons are
efficient determinants of SsrA tagging in Escherichia coli. Proc Natl Acad Sci U S A 99, 3440-3445.
Herman, C, Thevenet D, Bouloc P, Walker GC, D’ Ari R. Degradation of carboxy-terminal-tagged
cytoplasmic proteins by the Escherichia coli protease HflB (FtsH). Genes Dev, 1998. 12(9): p. 1348-55.
Huang, C., Wolfgang, M. C., Withey, J., Koomey, M., and Friedman, D. I. Charged tmRNA but not
tmRNA-mediated proteolysis is essential for Neisseria gonorrhoeae viability. EMBO J, 2000. 19(5): p.
1098-107.
Hong, S.J., Lessner FH., Mahen EM., Keiler KC. Proteomic identification of tmRNA substrates. Proc Natl
Acad Sci U S A, 2007. 104(43): p. 17128-33.
Hong, S.J., Q.A. Tran, and K.C. Keiler, Cell cycle-regulated degradation of tmRNA is controlled by
RNase R and SmpB. Mol Microbiol, 2005. 57(2): p. 565-75.
Julio, S.M., D.M. Heithoff, and M.J. Mahan, ssrA (tmRNA) plays a role in Salmonella enterica serovar
Typhimurium pathogenesis. J Bacteriol, 2000. 182(6): p. 1558-63.
Karzai, A.W. and R.T. Sauer, Protein factors associated with the SsrA.SmpB tagging and ribosome rescue
complex. Proc Natl Acad Sci U S A, 2001. 98(6): p. 3040-4.
Karzai, A. W., Susskind, M. M., and Sauer, R. T. (1999). SmpB, a unique RNA-binding protein essential
for the peptide-tagging activity of SsrA (tmRNA). Embo J 18, 3793-3799.
Keiler, K.C. and L. Shapiro, TmRNA is required for correct timing of DNA replication in Caulobacter
crescentus. J Bacteriol, 2003. 185(2): p. 573-80.
Keiler KC, Physiology of tmRNA: what gets tagged and why?
Curr Opin Microbiol. 2007
Apr;10(2):169-75. Epub 2007 Mar 26. Review.
Keiler, K.C., P.R. Waller, and R.T. Sauer, Role of a peptide tagging system in degradation of proteins
synthesized from damaged messenger RNA. Science, 1996. 271(5251): p. 990-3.
13
Keiler, K.C., Shapiro, L., Williams, K.P. ( 2000) tmRNAs that encode proteolysis-inducing tags are found
in all known bacterial genomes: a two-piece tmRNA functions in Caulobacter. Proc Natl Acad Sci USA 97:
7778– 7783.
Keiler KC, Physiology of tmRNA: what gets tagged and why? Curr Opin Microbiol. 2007
Apr;10(2):169-75. Epub 2007 Mar 26. Review.
Kirby, J. E., Trempy, J. E., and Gottesman, S. (1994). Excision of a P4-like crypticprophage leads to Alp
protease expression in Escherichia coli. J Bacteriol 176, 2068-2081.
Komine, Y., Kitabatake M., Yokogawa T., Nishikawa K., Inokuchi H. A tRNA-Like Structure is Present in
10Sa RNA, a Small Stable RNA from Escherichia coli. Proceedings of the National Academy of Sciences,
1994. 91(20): p. 9223-9227.
Komine, Y., M. Kitabatake, and H. Inokuchi, 10Sa RNA is associated with 70S ribosome particles in
Escherichia coli. J Biochem, 1996. 119(3): p. 463-7.
Lee, S.Y., S.C. Bailey, and D. Apirion, Small Stable RNAs from Escherichia coli: Evidence for the
Existence of New Molecules and for a New Ribonucleoprotein Particle Containing 6S RNA. J. Bacteriol.,
1978. 133(2): p. 1015-1023.
Li, X., Yagi M., Morita T., Aiba H. Cleavage of mRNAs and role of tmRNA system under amino acid
starvation in Escherichia coli. Molecular Microbiology, 2008. 68(2): p. 462-473.
Li, X., Hirano R., Tagami H., Aiba H. Protein tagging at rare codons is caused by tmRNA action at the 3'
end of nonstop mRNA generated in response to ribosome stalling. RNA, 2006. 12(2): p. 248-55.
Metzinger, L., Hallier, M., and Felden, B. (2005). Independent binding sites of small protein B onto
transfer-messenger RNA during trans-translation. Nucleic Acids Res 33, 2384-2394.
Moore, S.D. and R.T. Sauer, The tmRNA System for Translational Surveillance and Ribosome Rescue.
Annual Review of Biochemistry, 2007. 76(1): p. 101-124.
14
Moore, S.D. and R.T. Sauer, Ribosome rescue: tmRNA tagging activity and capacity in Escherichia coli.
Molecular Microbiology, 2005. 58(2): p. 456-466.
Muto, A., Fujihara, A., Ito, K. I., Matsuno, J., Ushida, C., and Himeno, H. (2000).
Requirement of
transfer-messenger RNA for the growth of Bacillus subtilis understresses. Genes Cells 5, 627-635.
Oh, B. K., and Apirion, D. (1991). 10Sa RNA, a small stable RNA of Escherichia coli, is functional. Mol
Gen Genet 229, 52-56.
Okan, N.A., J.B. Bliska, and A.W. Karzai, A Role for the SmpB-SsrA system in Yersinia
pseudotuberculosis pathogenesis. PLoS Pathog, 2006. 2(1): p. e6.
Roche, E. D., and Sauer, R. T. (1999). SsrA-mediated peptide tagging caused by rare codons and tRNA
scarcity. Embo J 18, 4579-4589.
Rudinger-Thirion, J., R. Giege, and B. Felden, Aminoacylated tmRNA from Escherichia coli interacts with
prokaryotic elongation factor Tu. RNA, 1999. 5(8): p. 989-92.
Sunohara, T., Abo T., Inada T., Aiba H. The C-terminal amino acid sequence of nascent peptide is a major
determinant of SsrA tagging at all three stop codons. RNA, 2002. 8(11): p. 1416-27.
Tobe, T., Sasakawa C., Okada N., Honma Y., Yoshikawa M. vacB, a novel chromosomal gene required for
expression of virulence genes on the large plasmid of Shigella flexneri. J Bacteriol, 1992. 174(20): p.
6359-67.
Ushida, C., Himeno H., Watanabe T., Muto A. tRNA-like structures in 10Sa RNAs of Mycoplasma
capricolum and Bacillus subtilis. Nucleic Acids Res, 1994. 22(16): p. 3392-6.
Valle, M., Gillet R., Kaur S., Henne A., Ramakrishnan V., Frank J. Visualizing tmRNA Entry into a
Stalled Ribosome. Science, 2003. 300(5616): p. 127-130.
Wower, I.K., C. Zwieb, and J. Wower, Contributions of Pseudoknots and Protein SmpB to the Structure
and Function of tmRNA in trans-Translation. J. Biol. Chem., 2004. 279(52): p. 54202-54209.
15
Zuo, Y., and Deutscher, M. P. (2001). Exoribonuclease superfamilies: structural analysis and phylogenetic
distribution. Nucleic Acids Res 29, 1017-1026.
16
CHAPTER 2
SSRA IS ESSENTIAL IN SHIGELLA FLEXNERI BUT NOT IN THE
CLOSELY RELATED SPECIES ESCHRICHIA COLI
17
Abstract
Shigella flexneri and Escherichia coli are taxonomically indistinguishable. The sequence
of the open reading frame (ORF) of ssrA, a universally conserved gene among bacteria, is
exactly the same in these two species. Though ssrA deletion only results in mild phenotypes
in E. coli, our data demonstrated that ssrA deletion in S. flexneri is lethal. It has also been
found that after conjugating the S. flexneri 2457T with an E. coli Hfr strain, S. flexneri
colonies that do not require ssrA were identified, suggesting that some DNA element(s) can
bypass the ssrA-essential phenotype in S. flexneri. Since ssrA is important in S. flexneri and
many other pathogenic species, it can be a potential target for new antibiotic development.
18
Introduction
ssrA is found in all bacteria that have been examined (Keiler et al., 2000). Its product,
transfer messenger RNA (tmRNA), is a small RNA with a very unusual structure. As its name
suggests, tmRNA has properties of both tRNA and mRNA. The 5’ and 3’ ends of the RNA are
folded into a tRNA-like structure, which can be charged with alanine by alanyl-tRNA
synthetase (Komine et al., 1994; Ushida et al., 1994). The other half of the RNA contains an
open reading frame, which can be translated into a short peptide like a normal mRNA (Keiler
et al., 1996).
The functions of tmRNA identified so far are ribosome rescue and protein quality control
(Keiler et al., 2007). In bacteria, unlike in eukaryotes, transcription and translation are
coupled. Therefore even if an mRNA is truncated due to premature transcription termination,
partial degradation, or physical/chemical damage (Roche et al., 1999), ribosomes still bind to
the mRNA and start translation. The consequence is that ribosomes frequently reach the end
of an mRNA without terminating at a stop codon and cannot be released. This is a serious
problem because if there is no ribosome recycling, all ribosomes will be stalled on mRNAs in
less than one cell cycle and the cell will die (Keiler, 2007). In addition, the polypeptides
synthesized from the incomplete translation might be toxic to the cell. tmRNA solves this
problem by tagging the incomplete protein for rapid degradation and releasing the stalled
ribosomes from the mRNA. tmRNA first recognizes the stalled translation complex through
an unknown mechanism. Then it enters the A site of a stalled ribosome like a tRNA.
Transpeptidation reaction occurs and the nascent polypeptide chain is transferred to
alanyl-tmRNA. tmRNA then moves with the nascent peptide chain at the 3’ end of the
acceptor arm from the A site to the P site in the ribosome. The translation template switches
from the former mRNA to the mRNA portion within tmRNA. Normal translation continues
and terminates at the stop codon within tmRNA. Therefore stalled ribosomes get released and
19
a peptide tag encoded by tmRNA is added to the polypeptides. This peptide tag will be
recognized by a number of intracellular proteases and target the tagged protein for rapid
proteolysis (Gottesman et al., 1998; Keiler et al 1996; Herman et al., 1998).
The sequence of the peptide tag is important for the recognition by proteases. Mutations
in this tag sequence can abolish the proteolysis of some tagged proteins. For example, if the
last two residues of the tag peptide in tmRNA are changed from alanines (SsrA-AA) in wild
type to aspartates (SsrA-DD), the variant tmRNA can still tag its substrates, but tagged
proteins cannot be recognized and proteolysed rapidly by proteases, so the half-life of most
SsrA-DD tagged proteins are be much longer (Keiler et al., 1996; Keiler et al., 2003, Fujihara
et al 2002; Keiler, 2007).
If tmRNA only functions in protein quality control and ribosome rescue, then most of
the proteins in bacteria should be substrates of tmRNA, and they should be tagged at random
locations. However, during the identification of tmRNA substrates, it is found that not all
proteins are tagged at random sites with even frequency. Some proteins have higher
frequency to be tagged and prefer specific tagging sites (Wiegert et al., 2001). All these
results indicate that tmRNA has substrate specificity. In addition, sometimes tmRNA tags a
protein at its C-terminus instead of the truncated site (Roche et al., 2001). This suggests that
tmRNA may have some function in regulating gene expression.
Deletion of the tmRNA coding gene ssrA generates different phenotypes in different
bacterial species. In Caulobacter crescentus, deletion of ssrA causes a specific delay in DNA
replication initiation and defect in maintaining pBBR1 plasmids (Keiler et al., 2003). In E.
coli, deletion of ssrA causes higher sensitivity to heat shock and lower motility on semisolid
agar (Ranquet et al., 2007). In some pathogenic strains such as Neisseria gonorrhoeae, deletion
of ssrA is lethal (Huang et al., 2000). The variation in the phenotype of ssrA deletion in
different species further suggests that tmRNA may play a regulatory role in bacterial
20
physiology in addition to protein quality control and ribosome rescue. Also, since tmRNA is
important in pathogenic strains, it can be a potential target for new antibiotic development.
As previously mentioned, ssrA deletion in E. coli results in mild phenotypes. On the
other hand, preliminary research in our lab suggests that ssrA deletion in S. flexneri may be
lethal. S. flexneri is an important human pathogen and responsible for the majority of
endemic bacillary dysentery cases prevalent in developing countries. It is so closely related to
E. coli that the two species are taxonomically indistinguishable (Wei et al., 2003). Therefore
it is surprising to find such a marked difference in ssrA deletion phenotypes between the two
closely related species. The goal of this project is to confirm the lethal phenotype of ssrA
deletion in S. flexneri and identify the gene(s) that is responsible for the difference in ssrA
deletion phenotypes between the two species.
21
Results
In S. flexneri 2a 2457T, the chromosomal copy of ssrA cannot be deleted unless a
plasmid copy of ssrA is present.
Previous research in our lab showed that no colonies could be obtained when knocking
out ssrA in S. flexneri 2a 2457T, suggesting that ssrA is essential in this species. To confirm
this result, the Wanner method (Kirill et al., 2000) was performed to knock out the
chromosomal copy of ssrA in S. flexneri 2a 2457T with and without a plasmid copy ssrA. A
covering plasmid which expresses wild type tmRNA was first generated and transformed into
S. flexneri 2a 2457T strain. A helper plasmid was transformed into both wild type S. flexneri
2a 2457T and S. flexneri 2a 2457T with the covering plasmid. The helper plasmid produces
Red recombinase to promote homologous recombination. A linear DNA fragment which
consists of a kanamycin resistance gene with 40 base pairs S. flexneri ssrA flanking regions
on both ends was generated by PCR. This linear PCR fragment was transformed directly into
the S. flexneri strain with only the helper plasmid and the S. flexneri with both the helper
plasmid and the covering plasmid. Cells in which ssrA was replaced by the kanamycin
resistance gene were selected on LB plates containing kanamycin. In principle, using this
method ssrA can be deleted in both strains. But in practice, results from colony PCR showed
that ssrA::kan colonies can only be obtained from S. flexneri with the covering plasmid
(Fig.3). The knockout was further confirmed by southern blot (Fig.4). This result suggests
that ssrA is essential in S. flexneri 2a 2457T.
Co-transduction experiment also showed ssrA is essential in S. flexneri 2a 2457T.
To further confirm that ssrA is essential in S. flexneri, a co-transduction experiment was
also performed. If ssrA is truly essential in S. flexneri, the ssrA::kan marker cannot be
co-transduced into wild type S. flexneri with an adjacent marker unless a covering plasmid is
22
present. To perform this experiment, a tetracycline resistance gene was inserted just upstream
of the ssrA locus in the ssrA::kan S. flexneri strain by phage transduction (Singer et al., 1989).
The locus of the tet marker is 58.97 min. and the locus of the ssrA::kan marker is 59.35 min.
on the chromosome. The distance between the two markers is d=59.35-58.97=0.38min. Since
a phage particle can package as much as 2.1 min of DNA, the two markers are close enough
to
be
co-transduced.
According
to
the
equation
of
co-transduction
frequency:
F=[1-(d/2.1)]3=[1-(0.38/2.1)]3=54.9%. This number suggests that when P1 phage is prepared
from this strain, if one marker (e.g. the TetR marker) is packaged into a phage particle, there is
54.9% chance that the other marker (e.g. the KanR marker) is also packaged into the same
particle. The phage was used to infect both S. flexneri strains with and without the covering
plasmid. Tetracycline resistance colonies were first selected on LB plates with tetracycline
and the percentage of these TetR colonies that are also KanR was determined by patching the
tetR colonies onto LB plates with kanamycin. It was found that when transducing into S.
flexneri with the covering plasmid, 59% of the tetR colonies were also kanR; when
transducing into S. flexneri without the covering plasmid, none of the tetR colonies were also
kanR. This result showed that the ssrA::kan marker can not be co-transduced with the tet
marker unless a covering plasmid is present, which further confirms that ssrA is essential in S.
flexneri 2a 2457T.
S. flexneri 2a 2457T colonies that do not require ssrA were identified after conjugation
with an E. coli Hfr strain
As previously mentioned, S. flexneri and E. coli are closely related. But unlike in S.
flexneri, ssrA is not essential in E. coli. In order to find what is responsible for this difference
in phenotypes, S. flexneri cells were conjugated with a set of seven E. coli Hfr strains that
cover the whole E. coli genome (Fig. 5). Following the conjugation, cells that do not require
23
tmRNA were selected by knocking out ssrA in all the transconjugants using the dual-marker
(TetR, ssrA::Kan) phage transduction. The dual-marker phage instead of the single marker
ssrA::kan phage was used because spontaneous KanR mutations were prone to occur when
kanamycin was the only antibiotic. The addition of the tetracycline can eliminate the
spontaneous mutants.
In the experiment, after conjugating S. flexneri strain with the E. coli No.4 Hfr strain, S.
flexneri colonies that did not require tmRNA were identified. The loci of the oriT and
selected marker on the No.4 Hfr choromosome are 45min. and 25min (Fig. 5). This result
suggested that either some DNA element(s) in the 25min.-45min. region on the E. coli
chromosome is responsible for making ssrA non-essential in E. coli, or some S. flexneri
chromosomal DNA element(s) in the corresponding region is responsible for making ssrA
essential in S. flexneri. In addition, since colonies that can bypass the phenotype were not
found after No.3 or No.5 Hfr conjugation, the part that contains the responsible element(s)
can even be narrowed down to the transfer region in No.4 that does not overlap with No.3
and No.5 Hfr (35min~42min).
ssrA::kan
Wild type
control
Fig. 3 Colony PCR showed the ssrA::kan replacement. This replacement can only be
obtained from S. flexneri with covering plasmid but not from wild type S. flexneri.
Wild type
control
ssrA::kan
Fig. 4 The ssrA::kan replacement was further confirmed by southern blot.
24
Fig. 5 Hfr mapping set. Arrowheads indicate the origin and direction of transfer for each
Hfr strain; bars indicate the positions of the selective markers on the transfer region.
25
Discussion
The data here demonstrated that ssrA is essential in S. flexneri but not in E. coli. More
importantly, some DNA element(s) can bypass the ssrA-essential phenotype in S. flexneri
after the conjugation. So the immediate plan for the downstream research would be to map
and identify the DNA element(s) that is responsible for bypassing the phenotype. After
mapping the responsible DNA element(s), depending on which species the responsible DNA
element belongs to, two distinct models can be proposed.
If the responsible DNA element belongs to E. coli
If some E. coli specific gene(s) is found to be recombined into the S. flexneri genome
through Hfr conjugation, it is possible that this gene complements the ssrA deletion
phenotype in S. flexneri through a gain-of-function manner. So the possible model can be that
the product of this responsible gene has similar function as tmRNA and therefore constitutes
a backup system for tmRNA.
If the responsible DNA element belongs to S. flexneri
If some S. flexneri specific gene(s) is lost or truncated from the Hfr conjugation, it is
possible that the inactivation of this gene bypasses the ssrA deletion phenotype in S. flexneri
through a loss-of-function manner. So a possible model can be that some protein produced
from this responsible gene is toxic when their level in the cell is too high. tmRNA may
directly or indirectly regulate the level of these proteins in the cell through tagging and
degradation so the amount of the proteins is controlled at a certain level. When the
responsible genes are inactivated, the toxic proteins will not be produced so tmRNA is no
longer required to control the level of the proteins.
tmRNA is important for bacterial pathogenesis. It is indispensable for full virulence In
26
Salmonella typhimurium and Yersinia pseudotuberculosis. (Julio, 2000; Okan, et al., 2006). It
is also essential in Shigella flexneri and Neisseria gonorrhoeae. (Huang, et al., 2000).
Therefore it has the potential to become the target for developing new antibiotics. Since no
tmRNA has been found in eukaryotes, antibiotics against tmRNA can be very specific with a
broad target range but has little side effect on human beings or animals.
27
Materials and methods
Bactiarial Strains
The wild-type S.flexneri strain used in this study is Shigella flexneri 2a 2457T (From
ATCC center). The wild-type E. coli strain used in this study is mg1655. Both S. flexneri and
E. coli strains were grown at 37°C in Luria-Bertani broth (Sambrook et al.1989)
supplemented with 100 µg/ml ampicillin, 30 µg/ml chloramphenicol, or 30µg/ml kanamycin
as necessary, and monitored by optical density at 600 nm.
Transformation
S. flexneri was grown at 37°C in Luria-Bertani broth to OD of ~0.3 at 600nm. 5ml of
bacterial culture was harvested by centrifugation and the supernatant was disregarded. The
cell pellet was washed with 1.5ml ice-cold ddH2O three times and resuspended in 50ul
ice-cold ddH2O. Plasmid was added into the solution and kept on ice for at least 20 minutes.
The mixture was then electroporated and resuspended in 0.5ml LB broth immediately. The
culture was shaked at 37°C for at least 2 hours. 50ul of the culture will then be spreaded onto
LB plates with appropriated antibiotics and kept at 37°C over night.
Gene knock out using the Wanner method
The helper plasmid used in this study is pkd46 (Kirill, 2000). The help plasmid is pJS14
inserted with E. coli ssrA driven by its endogenous promoter. The primers used to amplify the
linear kanamycin knock out fragment from pKD4 is Shi ssra del-F (5’-CACAAATGTTGCC
ATCCCATTGCTTAATCGAATTTGAGCGATTGTGTAGGCTGGAGCTGCTTC-3’)
and
Shi ssra del-R (5’-TCGGATGACTCTGGTAATCACCGATGGAGAATTTTGATGGGAAT
TAGCCATGGTCC-3’)
28
P1 Transduction
The recipient strain is grown in LB broth over night. 1ml culture is harvested by
centrifugation and the supernatant is disregarded. The cell pellet is resuspended in 0.5 ml
solution of 10mM MgSO4, 5mM CaCl2. The cell suspension and the P1 phage is mixed
according to table 1.
Table 1 Phage transduction table
Cell suspension
P1 phage
Group 1
100ul
0ul
Group 2
100ul
10ul
Group 3
100ul
50ul
Group 4
100ul
100ul
Group 5
0
100ul
The mixture from each group is incubated at 37°C for 30 min with the cap of the tube
open. Then 1ml of fresh LB broth is added and the mixture is incubated at 37°C for another 1
hour before spreading onto LB plates with appropriate antibiotics (Miller, 1972).
Southern Blot
Equal amount of genomic DNA (~2mg) was digested with appropriate Restriction
enzyme over night at 37 °C and loaded onto 0.7% agarose gel. After 6 hour electrophoresis at
~50V, the DNA fragments were transferred to membrane, hybridized with [32P]-labeled
DNA probes at 65 °C and visualized by using a PhosphorImager. The primers used to amplify
the probe from the S. flexneri genomic DNA are shi ssra south F (5’-cgcgaatagcttcttcaacc-3’)
and shi ssra south R (5’-tcttcgtcataagcgtcgtg -3’).
29
Hfr Conjugation
Hfr donor and recipient strains were grown at 37°C over night. 0.5ml of each strain was
mixed and harvested by centrifugation at 13,000 rpm for 1 minute. The cell pellet was
washed with ddH2O twice. The mixture was then kept at 37°C for ~ 30 minutes with the cap
of the tube open. The pellet was resuspended in 1ml LB broth. The solution was then vortex
for at least 2 minutes to break the pili between the donor and recipient strains. The mixture
was finally spreaded onto LB plates with appropriate antibiotics and kept at 37°C over night.
The donor and recipient strains were killed by the antibiotics and only the transconjugants
can survive (Singer et al., 1989).
30
Reference
Gottesman, S., Roche E., Zhou Y., Sauer RT. The ClpXP and ClpAP proteases degrade proteins with
carboxy-terminal peptide tails added by the SsrA-tagging system. Genes Dev, 1998. 12(9): p. 1338-47.
Fujihara A, Tomatsu H, Inagaki S, Tadaki T, Ushida C, Himeno H, Muto A: Detection of
tmRNA-mediated trans-translation products in Bacillus subtilis. Genes Cells 2002, 7:343-350.
Herman, C., Thevenet D., Bouloc P., Walker GC., D’Ari R. Degradation of carboxy-terminal-tagged
cytoplasmic proteins by the Escherichia coli protease HflB (FtsH). Genes Dev, 1998. 12(9): p. 1348-55.
Huang, C., Wolfgang, M. C., Withey, J., Koomey, M., and Friedman, D. I. Charged tmRNA but not
tmRNA-mediated proteolysis is essential for Neisseria gonorrhoeae viability. EMBO J, 2000. 19(5): p.
1098-107.
Julio, S.M., D.M. Heithoff, and M.J. Mahan, ssrA (tmRNA) plays a role in Salmonella enterica serovar
Typhimurium pathogenesis. J Bacteriol, 2000. 182(6): p. 1558-63.
Keiler KC, Physiology of tmRNA: what gets tagged and why? Curr Opin Microbiol. 2007
Apr;10(2):169-75. Epub 2007 Mar 26. Review.
Keiler, K.C. and L. Shapiro, TmRNA is required for correct timing of DNA replication in Caulobacter
crescentus. J Bacteriol, 2003. 185(2): p. 573-80.
Keiler, K.C., P.R. Waller, and R.T. Sauer, Role of a peptide tagging system in degradation of proteins
synthesized from damaged messenger RNA. Science, 1996. 271(5251): p. 990-3.
Keiler, K.C., Shapiro, L., Williams, K.P. ( 2000) tmRNAs that encode proteolysis-inducing tags are found
in all known bacterial genomes: a two-piece tmRNA functions in Caulobacter. Proc Natl Acad Sci USA 97:
7778– 7783.
Kirill A. Datsenko and Barry L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli
K-12 using PCR products. PNAS, June 6, 2000, vol. 9, no. 12
31
Komine, Y., Kitabatake M., Yokogawa T., Nishikawa K., Inokuchi H. A tRNA-like structure is present in
10Sa RNA, a small stable RNA from Escherichia coli. Proc Natl Acad Sci U S A, 1994. 91(20): p. 9223-7.
Miller, Jh 1972. Experiments in molecular genetics. Cold Spring Harbor, NY
Okan, N.A., J.B. Bliska, and A.W. Karzai, A Role for the SmpB-SsrA system in Yersinia
pseudotuberculosis pathogenesis. PLoS Pathog, 2006. 2(1): p. e6.
Ranquet, C., Gottesman S.Translation regulation of the Escherichia coli stress factor RpoS: a role for ssrA
and lon. J bacterial 200 189(13): 4872-4879
Roche, E.D. and R.T. Sauer, SsrA-mediated peptide tagging caused by rare codons and tRNA scarcity.
Embo J, 1999. 18(16): p. 4579-89.
SINGER, M., Baker TA., Schnitzler G., Deischel SM., Goel M., Dove W., Jaacks KJ., Grossman AD.,
Erickson JW., Gross CA. A Collection of Strains Containing Genetically Linked Alternating Antibiotic
Resistance Elements for Genetic Mapping of Escherichia coli. MICROBIOIOGICAL REVIEWS. Mar.
1989. p. 1-24
Tabata, S., Higashitani A., Takanami M., Akiyama K., Kohara Y., Nishimura Y., Nishmura A., Yasuda S.,
Hirota Y. Construction of an ordered cosmid collection of the Escherichia coli K-12 W3110 chromosome.
J Bacteriol 1989 171(2) p1214-1218
Ushida, C., Himeno H., Watanabe T., Muto A. tRNA-like structures in 10Sa RNAs of Mycoplasma
capricolum and Bacillus subtilis. Nucleic Acids Res, 1994. 22(16): p. 3392-6.
Wei, J., Goldberg MB., Burland V., Venkatesan MM., Deng W., Fournier G., Mayhwe GF., Pluckett G 3rd.,
Rose DJ., Darling A., Mau B., Perna NT., Payne SM., Runyen-Janecky LJ., Zhou S., Schwartz DC.,
Blattner FR. Complete Genome Sequence and Comparative Genomics of Shigella flexneri Serotype 2a
Strain 2457T. INFECTION AND IMMUNITY, May 2003, p. 2775–2786
Wiegert, T. and W. Schumann, SsrA-mediated tagging in Bacillus subtilis. J Bacteriol, 2001. 183(13): p.
3885-9.
32
CHAPTER 3
IDENTIFICATION OF MUTANTS THAT BYPASS THE PLASMID
MAINTENANCE DEFECT IN ∆SSRA C. CRESCENTUS
33
Abstract
ssrA is a universally conserved gene found in all bacteria. Its product, tmRNA, plays an
important role in ribosome rescue and protein quality control. ssrA deletion In Caulobacter
crescentus causes two distinct phenotypes: 1) a specific delay in DNA replication initiation 2)
defect in maintaining pBBR1 plasmids. Through genome wide random mutagenesis and
selection in ∆ssrA C. crescentus strain, three mutants that are able to bypass the plasmid
maintenance defect were identified. It is further discovered that the three mutations only
bypasses the plasmid maintenance defect but not the DNA replication initiation delay, which
suggests that the two phenotypes are controlled in two different pathways.
34
Introduction
Caulobacter crescentus is a gram-negative aquatic bacterium with two different cell
morphologies: swarmer cell and stalker cell (Poindexter et al., 1981). C. crescentus starts its
cell cycle from a swarmer cell, which has a single flagellum and therefore motile (Huguenel
et al.,1982). The swarmer cell cannot initiate DNA replication until it differentiates into a
immotile stalk cell. During this process the flagellum is removed and a stalk is constructed at
the same pole of the flagellum. The stalk cell is able to initiate DNA replication and will
asymmetrically divide into a swarmer cell and a stalk cell. The progeny stalk cell will start
DNA replication immediately while the progeny swarmer cell will need to differentiate into a
stalk cell before it can start DNA replication. The morphology change between swarmer cell
and stalk cell coincidents with the G1 to S phase transition in cell cycle, which makes C.
crescentus a great model system to study cell cycle regulation and bacterial development
(Ryan et al., 2003) (Fig 6).
There is a distinctive difference between tmRNA from C.crescentus and most other
bacteria. tmRNA in C. crescentus and other α-proteobacteria, cyanobacteria consists of two
RNA chains while tmRNA in most other bacteria such as E. coli, consist of one RNA chain.
This is because there is a circular permutation in the ssrA gene of these α-proteobacteria. The
one-piece transcript from ssrA gene must be processed into two RNA chains to form a mature
tmRNA molecule. The two-piece tmRNA carries similar function as those one-piece tmRNA
since it can tag proteins from a non-stop mRNA for degradation (Fig 7, Keiler et al., 2000).
When ssrA is deleted in C. crescentus, two phenotypes have been noticed. The first
phenotype is there is a 40 minutes delay in swarmer-cell to stalk-cell transition in ∆ssrA C.
crescentus comparing with wild type C. crescentus, which results in a much longer doubling
time for the deletion strains. Since the morphology change coincident with the G1 to S phase
35
transition in C. crescentus, this specific delay suggest that tmRNA is required for the correct
timing of DNA replication initiation in C.crescentus (Keiler et al., 2003).
The second phenotype is that ∆ssrA C. crescentus is not able to maintain a set of pBBR1
family plasmids, which are readily maintained in wild type C. crescentus (Hong SJ
dissertation). However, the factors which are responsible for this plasmid maintenance defect
are still unknown. Identification of these factors is the focus of this chapter.
Fig. 6 The cell cycle of C. crescentus (Kelly, 1998)
Fig 7. Processing tmRNA in C. crescentus (Keiler et al., 2000)
36
Results
Discovery of Six mutants that bypass the plasmid maintenance defect in ∆ssrA C.
crescentus
To study the factors that are responsible for the the plasmid maintenance defect in ∆ssrA
C. crescentus, ∆ssrA C. crescentus cells were mutagenized and selected for the mutants that
can maintain pBBR1 plasmids. The random mutations were introduced by transposon
mutagenesis (EZ-Tn5™ <R6Kgori/KAN-2>Tnp Transposome™ Kit). The transposon carries
a Kanamycin resistance gene so the mutants were first selected on LB plate with Kanamycin.
All the mutants on the plates were scraped off and collected in one test tube. This mixed
culture was subsequently made competent by ice-cold H2O wash and transformed with pJS14,
a pBBR1 family plasmid that carries a chloramphenicol resistance gene. After the
transformation, all the transformants were spreaded onto LB plates with chloramphenicol. Six
mutants were able to grow on the plates. Plasmid extraction showed that they all harbored
pJS14, which means the mutation does bypass the plasmid maintenance defect.
Identification of the mutants
The insertion loci of the transposon in all the six mutants were mapped and it turned out
that they located in three different genes, CC0153, CC1008 and CC2264. To confirm if
inactivation of these genes does bypass the phenotype, single knock out of each of the three
genes were generated in ∆ssrA C. crescentus. All the knockouts were confirmed by southern
blots (Fig 8). Further transformation of pJS14 into these three knockouts showed that they
were capable of maintaining plasmid, which suggests that the inactivation of any of the three
genes is responsible for bypassing the defect. However, we also noticed that although all the
three knockouts were able to maintain pJS14, their transformation efficiency were 100 to
37
1000 fold lower than transformation of pJS14 into wild type C. crescentus. The reason for
this difference is still unknown.
nactivation of the three genes does not bypass the DNA replication initiation delay in
∆ssrA C. crescentus
In order to test if the inactivation of the three genes can also bypass the DNA replication
initiation delay in ∆ssrA C. crescentus, growth curve experiment of the three knock outs were
performed. Our data showed that they all grew slower than wild type C. crescentus (Fig 9,
Table 2). This data suggests that the mutation only bypass the plasmid maintenance defect in
∆ssrA C. crescentus.
CC0153 knock out
WT
KO
CC1008 knock out
WT
KO
CC2264 knock out
WT
KO
Fig 8. Southern Blot results confirm the knockouts of the three target genes
38
Time (min)
Wild
type
crescentus
0
C.
TmRNA deletion
cc1008 deletion
cc2264 deletion
cc0153 deletion
0.039
0.04
0.046
0.045
0.043
60
0.07
0.06
0.078
0.067
0.063
120
0.126
0.091
0.128
0.109
0.101
180
0.214
0.139
0.178
0.157
0.147
235
0.323
0.193
0.258
0.215
0.207
300
0.471
0.293
0.37
0.299
0.302
360
0.595
0.408
0.487
0.381
0.389
420
0.669
0.514
0.608
0.452
0.452
480
0.715
0.618
0.681
0.531
0.51
530
0.739
0.675
0.721
0.581
0.543
Fig 9. The growth curve of the three mutations
39
Table 2. The doubling time of all three mutants
Strain
Doubling time in PYE (min)
Wt C. crescentus
94.34
tmRNA deletion
114.52
CC1008 deletion
110.44
CC2264 deletion
118.27
CC0153 deletion
113.63
40
Discussion
The data presented here demonstrated that inactivation of CC0153, CC1008 or CC2264
in ∆ssrA C. crescentus bypasses the plasmid maintenance defect. CC0153 encodes a protein
called HrcA, which is a heat shock protein transcription repressor (Michelle et al., 2004).
CC1008 encodes a protein called RsaD, which presumably is a component of the type I
secretion system (Michael et al., 2004; Peter et al., 1998). CC2264 encodes a
phosphomannomutase, which catalyses the transition between α-D-glucose 1 phosphate and
α-D-glucose 6 phosphate (Matthew et al., 2007). Although the three genes seem unrelated
and do not form a very good model why they can bypass the plasmid maintenance defect,
they do give some hints regarding future research. HrcA is a heat shock protein transcription
repressor, which indicates that the tmRNA activity is again linked to stress response. Also
there are several LPS genes located just downstream of CC1008, which means the transposon
insertion in CC1008 may affect the expression of these downstream genes. Meanwhile the
product of CC2264, the phosphomannomutase is involved in LPS synthesis. Therefore the
relationship between LPS synthesis, tmRNA activity as well as plasmid maintenance can be
investigated.
Furthermore, although the inactivation of the three genes can bypass the plasmid
maintenance defect to some extend, the low transformation efficiency comparing with the
wild type suggests that there are other factors that are also involved in the plasmid
maintenance mechanism. More mutagenesis and selection could be done to identify the other
unknown factors.
Last but not least, the inactivation of the three genes only bypasses the plasmid
maintenance defect but not the DNA replication initiation delay, which suggests that the two
phenotypes are controlled in two different pathways. Unfortunately the delay in DNA
replication initiation is not a selectable phenotype and is therefore more difficult to study than
41
the plasmid maintenance defect. To identify mutants that can bypass the DNA replication
initiation delay, one can start with looking for mutants that bypass the two phenotypes at the
same time. To carry out this plan, more mutagenesis and selection can be done and the
“bigger” colonies on plates will be isolated and more closely studied. They are the fast
growers and possibly bypass the DNA replication initiation delay.
42
Materials and methods
Bactiarial Strains
The wild-type C. crescentus strain used in this study is CB15N (Evinger et al., 1977).
CB15N were grown at 30°C in PYE or M2G broth (Ely, 1991) supplemented with 5 mg/ml
kanamycin, 1 mg/ml chloramphenicol as necessary, and monitored by optical density at 660
nm.
Transposon mutagenesis and mutation mapping
The transposon mutagenesis was performed by electroporate the Tn5 transposon into Δ
ssrA C. crescentus and selected on LB plates with kanamycin. To map the mutation, the
genomic DNA of the identified mutants was extracted and digested over night with a chosen
restriction enzyme. All the pieces of the genomic DNA were self ligated into ircular DNA
fragments and transformed into E. coli. Since the transposon has an origin in its sequence, the
circular DNA fragment that contains the transposon becomes a plasmid and therefore could
replicate in E. coli cells. All the other circular DNA fragments that do not contain the
transposon insertion will be lost and those cells cannot grow on media. The plasmid with the
transposon is extracted and sequenced using primers anneal to a fragment in the transposon.
The sequencing data will reveal the exact insertion site of the transposon on the genome (Fig
10).
43
Fig 10. Mapping of the transposon insertion (EZ-Tn5™ <R6Kgori/KAN-2>Tnp
Transposome™ Kit Manual).
Specific Gene knockout
The upstream and downstream 1kb fragments of the ORF of the target gene are cloned
into pNPTS138 (Keiler, 2003) and transformed into ∆ssrA C. cresentus. The target gene is
then knocked out using the two-step recombination method (Gay et al., 1985) and verified by
southern blot analysis.
Southern Blot
Equal amount of genomic DNA (~2mg) was digested with appropriate Restriction
enzyme over night and loaded onto 0.7% agarose gel. After 6 hour electrophoresis at ~50V,
the DNA fragments were transferred to membrane hybridized with [32P]-labeled DNA
probes at 65 °C and visualized by using a PhosphorImager. The probes used in this chapter
are always the upstream 1kb fragments of the OFR of the target genes. The primers used to
generate the knockout construct are listed in table 3.
44
Table 3. Primers for specific gene knockout.
Name
Sequences
Description
0153 Up F
GGACTAGTCGGTCAGGTGGAA
amplify cc0153 upstream 1kb
TCACCTG
this study
0153 Up R
CGCGGATCCGTCCCTGCGCTC
amplify cc0153 upstream 1kb
CGATCAAG
this study
CGCGGATCCGGACTTTACCCA
0153 Down F ATGACCGA
amplify cc0153 downstream 1kb
this study
CTAGCTAGCCGGGTTCAGCCG
0153 Down R CCGCCGGG
amplify cc0153 downstream 1kb
this study
GGACTAGTGATGAAGGCCAA
2264 TA upF GATTCAGC
amplify cc2264 upstream 1kb
this study
CCCAAGCTTTGAAGGCTCGCT
2264 TA upR TCAGTTGA
amplify cc2264 upstream 1kb
this study
2264
downF
TA CCCAAGCTTGTGAGCTGAGAT
amplify cc2264 downstream 1kb
GCTCACCA
this study
2264
downR
TA CTAGCTAGCCGGAAAGATCAT
amplify cc2264 downstream 1kb
GCCGTAGT
this study
GGACTAGTTCCTCGGCCGCTC
1008 upF 1.1 TGGCCGCTGGTA
amplify cc1008 upstream 1kb
this study
1008upR
anneal 1.1
GGGAGAGGCGGACTGACGAA
GGCGCTGTGAGCCTTCAGGAC
amplify cc1008 upstream 1kb
GCCGCGCGA
this study
1008downF
anneal 1.1
TCGCGCGGCGTCCTGAAGGCT
CACAGCGCCTTCGTCAGTCCG
amplify cc1008 downstream 1kb
CCTCTCCC
this study
1008 downR CTAGCTAGCGCGCCCTCGGTG
amplify cc1008 downstream 1kb
1.1
AAGAAGCGCAGGT
this study
Growth curve
Cultures of strain CB15N, tmRNA deletion strain, knockouts of cc1008, cc2264, cc0153
respectively in ∆ssrA CB15N were grown in PYE medium to an OD660 of 0.5-0.6. Cells
were then diluted into fresh PYE at an OD660 of 0.05. Cultures were grown at 30°C to an
OD660 of 0.5-0.6 and samples were taken periodically to monitor the changes in optical
density at 660 nm. The absorbance values were fit to an exponential function to calculate the
doubling time of each strain.
45
Reference
Ely, B. (1991). Genetics of Caulobacter crescentus. Methods Enzymol 204, 372-384. Evinger, M., and
Agabian, N. (1977). Envelope-associated nucleoid from Caulobacter crescentus stalked and swarmer cells.
J Bacteriol 132, 294-301.
EZ-Tn5™ <R6Kgori/KAN-2>Tnp Transposome™ Kit, Cat. No. TSM08KR, Epicentre® Biotechnologies.
http://www.epibio.com/pdftechlit/155pl047.pdf
Gay, P., Le Coq, D., Steinmetz, M., Berkelman, T., and Kado, C. I. (1985). Positive selection procedure for
entrapment of insertion sequence elements in gram-negative bacteria. J Bacteriol 164, 918-921.
Huguenel, E.D. and A. Newton, Localization of surface structures during procaryotic differentiation: role
of cell division in Caulobacter crescentus. Differentiation, 1982. 21(2): p. 71-8.
Jenal, U. and L. Shapiro, Cell cycle-controlled proteolysis of a flagellar motor protein that is
asymmetrically distributed in the Caulobacter predivisional cell. EMBO J, 1996. 15(10): p. 2393-406.
Keiler, K. C., Shapiro, L., and Williams, K. P. (2000). tmRNAs that encode proteolysisinducing tags are
found in all known bacterial genomes: A two-piece tmRNA functions in Caulobacter. Proc Natl Acad Sci U
S A 97, 7778-7783.
Keiler, K. C., and Shapiro, L. (2003). TmRNA is required for correct timing of DNA replication in
Caulobacter crescentus. J Bacteriol 185, 573-580.
Matthew J. Ford, John F. Nomellini, and John Smit
S-Layer Anchoring and Localization of an
S-Layer-Associated Protease in Caulobacter crescentus. J Bacteriol. 2007 March; 189(6): 2226–2237.
Michael C. Toporowski, John F. Nomellini, Peter Awram, and John Smit
Two Outer Membrane Proteins
Are Required for Maximal Type I Secretion of the Caulobacter crescentus S-Layer Protein J Bacteriol.
2004 December; 186(23): 8000–8009. doi: 10.1128/JB.186.23.8000-8009.2004.
Michelle F. Susin, Humberto R. Perez, Regina L. Baldini, and Suely L. Gomes Functional and Structural
46
Analysis of HrcA Repressor Protein from Caulobacter crescentus. J Bacteriol. 2004 October; 186(20):
6759–6767.
Peter Awram and John Smit
The Caulobacter crescentus Paracrystalline S-Layer Protein Is Secreted by
an ABC Transporter (Type I) Secretion Apparatus J Bacteriol. 1998 June; 180(12): 3062–3069.
Poindexter, J.S., The caulobacters: ubiquitous unusual bacteria. Microbiol Rev, 1981. 45(1): p. 123-79.
Ryan KR, Shapiro L. Temporal and spatial regulation in prokaryotic cell cycle progression and
development. Annu Rev Biochem. 2003;72:367-94. Epub 2003 Mar 19.