Download Full Text - Molecular Cancer Research

Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Molecular
Cancer
Research
Oncogenes and Tumor Suppressors
Altered Endosome Biogenesis in Prostate Cancer Has
Biomarker Potential
Ian R.D. Johnson1, Emma J. Parkinson-Lawrence1, Tetyana Shandala1, Roberto Weigert2, Lisa M. Butler3,4,
and Doug A. Brooks1
Abstract
Prostate cancer is the second most common form of cancer in males, affecting one in eight men by the time they
reach the age of 70 years. Current diagnostic tests for prostate cancer have significant problems with both false
negatives and false positives, necessitating the search for new molecular markers. A recent investigation of
endosomal and lysosomal proteins revealed that the critical process of endosomal biogenesis might be altered in
prostate cancer. Here, a panel of endosomal markers was evaluated in prostate cancer and nonmalignant cells and a
significant increase in gene and protein expression was found for early, but not late endosomal proteins. There was
also a differential distribution of early endosomes, and altered endosomal traffic and signaling of the transferrin
receptors (TFRC and TFR2) in prostate cancer cells. These findings support the concept that endosome biogenesis
and function are altered in prostate cancer. Microarray analysis of a clinical cohort confirmed the altered endosomal
gene expression observed in cultured prostate cancer cells. Furthermore, in prostate cancer patient tissue specimens,
the early endosomal marker and adaptor protein APPL1 showed consistently altered basement membrane histology
in the vicinity of tumors and concentrated staining within tumor masses. These novel observations on altered early
endosome biogenesis provide a new avenue for prostate cancer biomarker investigation and suggest new methods for
the early diagnosis and accurate prognosis of prostate cancer.
Implications: This discovery of altered endosome biogenesis in prostate cancer may lead to novel biomarkers for
more precise cancer detection and patient prognosis. Mol Cancer Res; 12(12); 1851–62. 2014 AACR.
Introduction
Prostate cancer is the most common form of cancer in
males from developed countries, and the incidence of this
disease is predicted to double globally by 2030 (World
Cancer Research Fund prostate cancer statistics; http://
globocan.iarc.fr). Prostate cancer affects approximately 1 in
8 men globally by the time they reach the age of 70 years (1).
The prostate-specific antigen test is currently used for
prostate cancer screening; however, this assay suffers from
a high percentage of false-positive results (see for example
1
Mechanisms in Cell Biology and Disease Research Group, School of
Pharmacy and Medical Sciences, Sansom Institute for Health Research,
University of South Australia, Adelaide, South Australia, Australia. 2NIDCR,
NIH, Bethesda, Maryland. 3Dame Roma Mitchell Cancer Research Laboratories, School of Medicine, University of Adelaide, Adelaide, South
Australia, Australia. 4Adelaide Prostate Cancer Research Centre, School
of Medicine, University of Adelaide, Adelaide, South Australia, Australia.
Note: Supplementary data for this article are available at Molecular Cancer
Research Online (http://mcr.aacrjournals.org/).
Corresponding Author: Doug A. Brooks, Mechanisms in Cell Biology and
Disease Research Group Leader, School of Pharmacy and Medical
Sciences, Sansom Institute for Health Research, University of South
Australia, GPO Box 2471, Adelaide, SA 5001, Australia. Phone: 61-883021229; Fax: 61-883021087; E-mail: [email protected]
doi: 10.1158/1541-7786.MCR-14-0074
2014 American Association for Cancer Research.
ref. 2), and recently, there have been recommendations to
abandon this procedure, particularly in older men (3). In
addition, the digital rectal examination, which manually
checks the prostate for abnormalities, is limited by the
inability to assess the entire gland and to some degree the
size of the tumor. Understanding the cell biology of prostate
cancer is important to develop new biomarkers for the early
diagnosis and accurate prognosis of prostate cancer.
There is mounting evidence for a central role of endosome–lysosome compartments in cancer cell biology (see
refs. 4–6). Endosomes and lysosomes are directly involved in
the critical processes of energy metabolism (7), cell division
(8) and intracellular signaling (see for example ref. 9) and
would therefore have a direct role in cancer pathogenesis.
The endosome–lysosome system has a specific capacity to
respond to environmental change, acting as an indicator of
cellular function and will consequently be altered in cancer
(10). Moreover, the endosome–lysosome system has a critical role in controlling the secretion of proteins into extracellular fluids (see for example ref. 11), making it an ideal
system to identify new biomarkers that are released from
cancer cells. Cumulative evidence from patient data and cell
lines suggested that the process of lysosomal biogenesis
might be altered in prostate cancer (see for example refs. 12,
13). However, we recently demonstrated that a panel of
lysosomal proteins was unable to effectively discriminate
www.aacrjournals.org
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1851
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Johnson et al.
between a set of nonmalignant and prostate cancer cells (14).
In contrast, the endosomal-related proteins cathepsin B and
acid ceramidase displayed increased gene and protein expression in prostate cancer cells and demonstrated some discriminatory capacity when compared to nonmalignant cells.
Acid ceramidase was previously shown to be upregulated in
prostate cancer tissues, and the overexpression of this enzyme
has been implicated in advanced and chemoresistant prostate
cancer (15). Importantly, we also showed that LIMP-2, a
critical regulator of endosome biogenesis (16), had increased
gene and protein expression in prostate cancer cells (14),
leading us to postulate that endosome biogenesis is altered in
prostate cancer.
Endosome biogenesis involves the synthesis and organization of structural elements of the endosome system to form
an integrated set of functional organelles that eventually
interact with lysosomes (see for example ref. 17). There are
two main endosomal pathways: first, from the biosynthetic
compartments (endoplasmic reticulum and Golgi apparatus)
via specific vesicular traffic toward distal elements of the
endosomal network, including early endosomes, late endosomes, and multivesicular bodies; and from the cell surface
through early endosomes to either recycling endosomes or
toward late endosomes. In each case, the formation
and movement of these dynamic vesicular compartments
is controlled by specific targeting signals and trafficking
machinery (see for example refs. 17, 18). This vesicular
machinery can be used to define individual compartments;
including, for example, the small GTPase Rab5 on
early endosomes and the small GTPase Rab7 on late endosomes (18, 19). Here, we have investigated the gene expression, amount of protein, and intracellular distribution of a
panel of endosomal proteins in prostate cancer and nonmalignant cell lines, to determine whether endosome biogenesis
is altered in prostate cancer cells and to identify potential new
biomarkers.
Materials and Methods
Antibody reagents
A LIMP-2 sheep polyclonal antibody was generated
against the peptide sequence CKKLDDFVETGDIRTMVFP (Mimotopes Pty. Ltd.). Rabbit polyclonal
antibodies (Abcam PLC) were against Appl1 (0.4 mg/mL),
Appl2 (0.4 mg/mL), Rab4 (1 mg/mL), TGN46 (10 mg/mL),
TfR1 (1 mg/mL), and TfR2 (1 mg/mL). Akt (1:1,000) and
phospho-Akt (Thr308; 1:1,000) from Cell Signaling Technology Inc., and horseradish peroxidase (HRP)–conjugated
anti-GAPDH (1:20,000; Sigma-Aldrich Pty. Ltd.). Goat
polyclonal antibodies (Santa Cruz Biotechnology) were
against Rab5 (1 mg/mL), Rab7 (1 mg/mL), and EEA1
(1 mg/mL). A LAMP-1 (1 mg/mL) mouse monoclonal BB6
was provided by Prof. Sven Carlsson (Umea University,
Umea, Sweden). HRP-conjugated secondary antibodies for
Western blot analysis included anti-goat/sheep (1:2,000;
Merck Millipore Pty. Ltd.), anti-rabbit (1:2,000), and antimouse (1:2,000; Sigma-Aldrich). The secondary and other
antibody-conjugated fluorophores that were used included
1852
Mol Cancer Res; 12(12) December 2014
Alexa Fluor 488 (1:250), Alexa Fluor 633 (1:250), Transferrin-633 (1:1,000), Phalloidin-488 (1:100), and LysoTracker (5 mmol/L); all from Life Technologies Pty. Ltd.
Cell lines and culture conditions
The nonmalignant cell lines PNT1a and PNT2 and
prostate cancer cell lines 22RV1 and LNCaP (clone FCG)
were obtained from the European Collection of Cell Cultures via CellBank Australia (Children's Medical Research
Institute, Westmead, NSW, Australia). These cell lines were
absent from the list of cross-contaminated or misidentified
cell lines, version 6.8 (March 9, 2012; ref. 20).
Cell lines were cultured in 75-cm2 tissue culture flasks and
maintained in RPMI-1640 culture medium (Gibco, Life
Technologies), supplemented with 10% fetal calf serum (In
Vitro Technologies Pty. Ltd.) and 2 mmol/L L-glutamine
(Sigma-Aldrich Pty. Ltd.). Cells were incubated at 37 C
with 5% CO2 in a Sanyo MCO-17AI humidified incubator
(Sanyo Electric Biomedical Co., Ltd.). Cells were cultured to
approximately 90% confluence before passage, by washing
with sterile PBS (Sigma-Aldrich), trypsin treatment (Trypsin–EDTA solution containing 0.12% trypsin, 0.02%
EDTA; SAFC; Sigma-Aldrich) to dissociate the cells from
the culture surface and then resuspension in supplemented
culture medium.
Preparation of cell extracts and conditioned culture
media for protein detection
The culture medium was aspirated from cultures at 80%
to 90% confluence, the cells washed once with PBS, and
then incubated with 800 mL of a 20 mmol/L Tris (pH 7.0)
containing 500 mmol/L sodium chloride and 2% (w/v)
SDS. Cells were harvested and an extract prepared by
heating at 95 C and sonication for 1 minute. The lysate
was then passaged six times through a 25-guage needle.
Total protein in the cell extracts was quantified using a
bicinchoninic acid assay according to the manufacturer's
instructions (Micro BCA Kit; Pierce). Samples were
quantified using a Wallac Victor optical plate-reader and
Workout software v2.0 (PerkinElmer Pty. Ltd.), using a
five-point parameter standard curve. Cell extracts were
stored at 20 C.
Protein was recovered from conditioned culture media,
collected at the time of cell harvesting, using trichloroacetic
acid precipitation. Briefly, cell debris was removed from the
culture media by centrifugation (1,000 g for 10 minutes),
sodium deoxycholate (Sigma-Aldrich) added to a final concentration of 0.02% (v/v) and incubated on ice for 30
minutes. Trichloroacetic acid (Sigma-Aldrich) was then
added to a final concentration of 15% (v/v) and incubated
on ice for 2 hours. Protein was collected by centrifugation at
4 C (5,500 g for 30 minutes), washed twice with ice-cold
acetone and resuspended in SDS-sample buffer/PBS solution, and stored at 20 C.
Gene expression
Relative amounts of mRNA from nonmalignant and
prostate cancer cell lines were defined by quantitative PCR
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Altered Endosome Biogenesis in Prostate Cancer
(qPCR). Briefly, cells were lysed with TRI reagent (Applied
Biosystems, Life Technologies) and RNA extraction performed using RNeasy (Qiagen Pty. Ltd.) according to the
manufacturer's instructions. Two micrograms of total RNA
was reverse-transcribed using the High Capacity RNA-tocDNA Kit (Life Technologies) following the manufacturer's
instructions. qPCR was performed with 2 mL of a 1:25
dilution of cDNA in 10 mL of reaction mixture; containing
5 mL Power SYBR Green PCR Master Mix (Life Technologies) and 0.5 mL of both 10 nmol/L forward and reverse
primer. qPCR was performed using a 7500 Fast Real-Time
PCR System (Life Technologies). Each target was assessed in
triplicate on a single plate and quantified relative to GAPDH
endogenous control for each plate, with triplicate biologic
replicates run independently. Oligonucleotides (GeneWorks Pty. Ltd.) were as follows:
GAPDH TGCACCACCAACTGCTTAGC (Fwd) GGCATGGACTGTGGTCATGAG (Rev; ref. 21);
LAMP-1 ACGTTACAGCGTCCAGCTCAT (Fwd) TCTTTGGAGCTCGCATTGG (Rev; ref. 21);
LIMP2 AAAGCAGCCAAGAGGTTCC (Fwd) GTCTCCCGTTTCAACAAAGTC (Rev);
APPL1 ACTTGGGTACATGCAAGCTCA (Fwd) TCCCTGCGAACATTCTGAACG (Rev);
APPL2 AGC TGATCGCGCCTGGAACG (Fwd) GGGTTGGTACGCCTGCTCCCT (Rev);
EEA1 CCCAACTTGCTACTGAAATTGC (Fwd) TGTCAGACGTGTCACTTTTTGT (Rev);
RAB5 AGACCCAACGGGCCAAATAC (Fwd) GCCCCAATGGTACTCTCTTGAA (Rev);
RAB4 GGGGCTCTCCTCGTCTATGAT (Fwd) AGCGCATTGTAGGTTTCTCGG (Rev);
RAB7 GTGTTGCTGAAGGTTATCATCCT (Fwd)
GCTCCTATTGTGGCTTTGTACTG (Rev).
Western blotting
Ten micrograms of total protein for whole-cell lysates or
the secreted protein from approximately 3 106 cells was
heat-denatured (5 minutes at 100 C in NuPAGE LDS
Sample Buffer and reducing agent), then electrophoresed
at 120 V for 1.5 hours using pre-cast gels in an XCell
SureLock Mini-Cell system (Life Technologies). The
protein was then transferred to polyvinylidene difluoride
membranes (Polyscreen; PerkinElmer). The transfer
membranes were blocked for 1 hour at room temperature
using a 5% (w/v) skim milk solution in 0.1% (v/v) TBSTween (blocking solution) and incubated with primary
antibody overnight at 4 C. The membranes were washed
in 0.1% (v/v) TBS-Tween and then incubated with the
appropriate HRP-conjugated secondary antibody diluted
at 1:2,000 in blocking solution. The membranes were
developed using a Novex ECL chemiluminescent substrate reagent kit (Life Technologies), and proteins were
visualized using an ImageQuant LAS 4000 imager, software version 1.2.0.101 (GE Healthcare Pty. Ltd.). Triplicate samples were analyzed and images quantified relative
to a reference GAPDH loading control using AlphaViewSA software v3.0 (ProteinSimple Pty. Ltd.).
www.aacrjournals.org
Immunofluorescence
Cells were cultured on 22-mm glass coverslips, fixed with
4% (v/v) formaldehyde in PBS for 20 minutes at room
temperature, and then permeabilized with 0.1% Triton-X
(v/v) in PBS for 10 minutes. Nonspecific antibody reactivity
was blocked by incubation with 5% (w/v) bovine serum
albumin (BSA) in PBS for 2 hours at room temperature.
Cells were incubated with primary antibody in 5% BSA for 2
hours at room temperature, followed by fluorophore-conjugated secondary antibody in the dark for 1 hour at room
temperature. Unbound antibody was removed by three PBS
washes and coverslips mounted with ProLong Gold Antifade
Reagent containing DAPI nuclear stain (Life Technologies).
Confocal microscopy was performed using a Zeiss LSM 710
META NLO laser scanning microscope and associated Carl
Zeiss Zen 2009 software. Laser lines of 370, 488, 543, and
633 nm were used for DAPI, Alexa Fluor 488, Cy3, and
Alexa Fluor 633 fluorescence, respectively. Images were
exported as grayscale 16-bit TIFF files and processed using
Adobe Photoshop CS5 (Adobe Systems Inc.).
Immunohistochemistry
Matched human nonmalignant and tumor prostate tissue
sections (3 mm) were mounted on Superfrost Ultra Plus
slides (Menzel-Gl€aser GmbH) and heated overnight at
50 C. Sections were then dewaxed in xylene, rehydrated
in ethanol, and incubated in 0.3% H2O2 in PBS for 15
minutes at room temperature. Heat–Induced Epitope
Retrieval was carried out using 10 mmol/L citrate buffer
(pH 6.5) in a Decloaking Chamber (Biocare Medical LLC)
for 5 minutes at 125 C. Slides were blocked first using an
Invitrogen Avidin/Biotin Kit (as per the manufacturer's
instructions) and then in 5% blocking serum (SigmaAldrich) for 30 minutes at room temperature in a humid
chamber. Sections were then incubated with primary antibody overnight at 4 C in a humid chamber, followed by
incubation with the appropriate biotinylated secondary
antibody (1:400; Dako Australia Pty. Ltd.) for 1 hour at
room temperature in a humid chamber, then streptavidin–
HRP (1:500; Dako Australia Pty. Ltd.) for 1 hour at room
temperature in a humid chamber and finally with DAB/
H2O2. The tissue sections were then counterstained with
Lillie–Mayer hematoxylin, rinsed in water, rehydrated, and
mounted on slides with DPX mounting media (Merck
Millipore Pty. Ltd.). Images were obtained by scanning
slides using a NanoZoomer (Hamamatsu Photonics K.K.).
Data analysis
Quantities of target-gene and endogenous-control
(GAPDH) were calculated from a standard curve from serial
dilutions of control material (LNCaP cDNA). Kruskal–
Wallis nonparametric analysis of variance statistical analyses
were performed using Stata/SE v11.2 (StataCorp LP) to
determine the significance between nonmalignant control
(PNT1a and PNT2) and prostate cancer (22RV1 and
LNCaP) cell lines (95% confidence limit; P 0.05) for
intracellular or secreted protein amount, and gene expression. The Taylor microarray cohort (GSE21034) consisted
Mol Cancer Res; 12(12) December 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1853
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Johnson et al.
of patients treated by radical prostatectomy at the Memorial
Sloan-Kettering Cancer Center (MSKCC; New York, NY;
ref. 22), profiling 150 prostate cancer and 29 nonmalignant
tissue samples that was performed using Affymetrix Human
Exon 1.0 ST arrays. Statistical analysis of microarray gene
expression was performed using a two-tailed unpaired t test
with Welch correction using GraphPad Prism 5.03 (GraphPad Software Inc.).
Results
Increased endosome-related gene and protein expression
in prostate cancer cells
The expression of endosome- and lysosome-related genes
was quantified by qPCR in control and prostate cancer cells
and normalized to the expression of GAPDH mRNA. The
amounts of LIMP2, APPL1, APPL2, RAB5A, EEA1, and
RAB4 mRNA were significantly increased in prostate cancer
when compared with nonmalignant control cell lines (P 0.05; Fig. 1). In each case, there was an approximately 2- to 3fold increase in mRNA expression. There was no significant
difference in the amount of either RAB7 or LAMP-1 mRNA
detected in prostate cancer cells compared with nonmalignant
controls. Western blot analysis (Fig. 2A) demonstrated significant increases in the amount of LIMP-2, Appl1, Appl2,
EEA1, and Rab4 protein in extracts from prostate cancer cells
when compared with nonmalignant control cells (P 0.05; Fig. 2B). Moreover, for both LIMP-2 and Rab4, the
increase was approximately 2- to 4-fold for prostate cancer
when compared with nonmalignant cells (Fig. 2B). There was
no significant difference in the amount of Rab5, Rab7, and
LAMP-1 protein detected in nonmalignant compared with
prostate cancer cells (Fig. 2B).
Altered distribution of endosomes and lysosomes in
prostate cancer cells
Representative confocal images for the distribution of
endosomes and lysosome proteins (Fig. 3) show evidence
of increased staining and altered distribution in prostate
cancer compared with the nonmalignant controls. In nonmalignant control cells, LIMP-2 was concentrated in the
perinuclear region, with some punctuate vesicular staining in
the remainder of the cytoplasm. In contrast, prostate cancer
cells displayed relatively smaller LIMP-2 compartments,
which had an even distribution throughout the cytoplasm.
Appl1-positive endosomes were detected throughout the cell
cytoplasm of nonmalignant control cells, whereas in prostate
cancer cells, these compartments were more concentrated at
the cell periphery, particularly near the plasma membrane in
cellular extensions/pseudopodia. In nonmalignant control
cells, both Rab5 and its effector EEA1 were concentrated in
the perinuclear region, whereas in prostate cancer cells, these
endosomal compartments were found throughout the cytoplasm, with some compartments located toward the cell
periphery in cellular extensions. Rab7-positive endosomes
were located mainly in the perinuclear region of both
nonmalignant control and prostate cancer cells. In nonmalignant control cells, LAMP-1 compartments were concen-
1854
Mol Cancer Res; 12(12) December 2014
Figure 1. Quantification of endosomal and lysosomal gene expression in
control and prostate cancer cell lines. Levels of mRNA transcripts in
nonmalignant control cell lines (white bars) and prostate cancer cell lines
(black bars) were evaluated by qPCR in triplicate experiments. Data were
expressed relative to GAPDH endogenous control and analyzed by the
Kruskal–Wallis rank-sum method. Statistical significance (P 0.05) is
represented by an asterisk.
trated in the perinuclear region, whereas in prostate cancer
cells the LAMP-1 compartments were distributed away from
the perinuclear region and concentrated in cellular extensions. Consistent with the LAMP-1 staining, LysoTracker
positive acidic compartments were concentrated mainly in
the perinuclear region of nonmalignant control cells, whereas in prostate cancer cells, these compartments were detected
in both the perinuclear region and in cytoplasmic extensions
(Fig. 3).
Altered distribution of endocytosed transferrin in
prostate cancer cells
Previous studies have reported increased uptake of transferrin in prostate cancer cells, prompting the investigation of
receptor expression and transferrin endocytosis in relation to
the observed increase in endosome protein expression and
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Altered Endosome Biogenesis in Prostate Cancer
Figure 2. Detection and
quantification of intracellular
lysosomal proteins in
nonmalignant control and prostate
cancer cell lines. A, representative
images from Western blot analysis
of 10 mg whole-cell lysate from
nonmalignant control cell lines
PNT1a and PNT2, and cancer cell
lines 22RV1 and LNCaP, examined
in triplicate. B, protein amount was
quantified by densitometry relative
to a GAPDH endogenous control.
Data were analyzed by the Kruskal–
Wallis rank-sum method with
statistical significance represented
by an asterisk. ( , P 0.05;
, P 0.01).
altered endosome distribution. In nonmalignant control
cells, endocytosed transferrin was observed in punctate
intracellular structures after 5 minutes and in the perinuclear
region at 15 and 30 minutes (Fig. 4). The prostate cancer
cells endocytosed relatively more transferrin than the non-
www.aacrjournals.org
malignant control cell lines within the first 5 minutes
of incubation and at the 30-minute incubation point. In
nonmalignant cells at 30 (Fig. 4) and 20 minutes (Fig. 5),
this transferrin was tightly concentrated in close proximity to
the nucleus. After 15 minutes of incubation, the internalized
Mol Cancer Res; 12(12) December 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1855
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Johnson et al.
Figure 3. Confocal micrographs of endosomal markers in prostate cancer cell lines compared with nonmalignant control cell lines. Fixed cells were probed for
endosome markers (green) and counterstained with DAPI nuclear stain (blue) and visualized by laser-scanning confocal microscopy. Cell outlines were
visualized by transmitted light illumination and cell periphery depicted by white dotted line. Antibody labeling was performed in triplicate experiments and a
minimum of 5 cells were visualized in each cell line for each assay. Similar fluorescence staining was observed in all cells for each cell line/antibody label. An
additional confocal micrograph from an independent labeling assay is presented in Supplementary Fig. S1.
transferrin was not as concentrated in the perinuclear region
of prostate cancer cells, with more transferrin-labeled compartments in the cell periphery and distributed throughout
the cytoplasm when compared with the nonmalignant cells
(Fig. 4). There was also a marked reduction in actin staining
for the prostate cancer compared with the nonmalignant
control cell lines (Fig. 4). In the nonmalignant control cells,
transferrin was clustered mainly in LIMP-2- and Rab7positive endosomes localized in the perinuclear region (Fig.
5). Although the prostate cancer cells had some LIMP-2- and
transferring-positive staining in the perinuclear region and
some colocalization of transferrin with the Golgi marker
TGN46 (yellow colocalization), the majority of transferrin
was localized in different endosomal compartments (i.e.,
Appl1, Rab5, and EEA1) distributed throughout the cytoplasm and in cellular extensions (Fig. 5). The Rab4 recycling
endosomes and LAMP-1–positive lysosomes had similar
patterns of transferrin staining for the prostate cancer and
nonmalignant control cell lines (Fig. 5). Further analysis of
the transferrin receptors revealed variable gene and protein
expression for TfR1 (TFRC) and TfR2 (TFR2; Fig. 6A and
B). There was a significant increase in TFRC gene expression
(P 0.05) in prostate cancer cells when compared with
nonmalignant controls (Fig. 6A), but only a qualitative
increase in TfR1 protein in the prostate cancer cell line
22RV1 and not for LNCaP (Fig. 6B). Although there was
significantly more TfR2 protein detected in prostate cancer
cells when compared with the nonmalignant cells (P 0.05), there was only an increase in TFR2 gene expression
1856
Mol Cancer Res; 12(12) December 2014
in the LNCaP cancer cell line (Fig. 6A). Colocalization of TfR1
and transferrin was observed in all cell lines, and was in a
perinuclear location in nonmalignant cell lines PNT1a and
PNT2 compared with a broader cytoplasmic distribution in
the cancer cell lines 22RV1 and LNCaP. Conversely, there
appeared to be no colocalization of transferrin with TfR2 in
nonmalignant cells and limited colocalization of transferrin
with TfR2 compartments in the prostate cancer cells (Fig. 6C).
Altered Akt signaling in prostate cancer cells
The total amount of Akt protein detected in nonmalignant
control cells was similar to that detected in prostate cancer
cells (Fig. 6D and E). There were, however, differences in the
amount of phosphorylated Akt in the prostate cancer lines,
with 22RV1 showing a marked reduction in the amount of
phosphorylated Akt, whereas LNCaP had an increased
amount of phosphorylated Akt (Fig. 6D), a phenomenon
previously observed by Shukla and colleagues (23) and
related to mutations of PTEN in LNCaP. More importantly,
following the addition of transferrin, there was a significant
increase in the amount of phosphorylated Akt in the nonmalignant control cell lines, but no change in the amount of
phosphorylated Akt in either of the cancer cells (Fig. 6E).
LAMP-1and APPL1 mRNA expression in a prostate
cancer microarray cohort and distribution of LAMP-1
and Appl1 in prostate tissue
To support the hypothesis of altered endosome biogenesis in prostate cancer, the percentage change of mRNA
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Altered Endosome Biogenesis in Prostate Cancer
Figure 4. Time-course of transferrin uptake in prostate cell lines.
Representative confocal micrographs from triplicate staining
experiments showing increased uptake and altered distribution of
transferrin in prostate cancer cell lines compared with nonmalignant
control cell lines. Cell cultures were incubated with transferrin Alexa Fluor
633 conjugate (red) for a period of 5, 15, and 30 minutes before cell
fixation and F-actin labeled with phalloidin Alexa Fluor 488 (green).
Arrows in the control cells depict transferrin that was concentrated in
close proximity to the nucleus at 30 minutes. Additional confocal
micrographs of transferrin uptake are presented in Supplementary
Fig. S2.
expression for LAMP-1 and APPL1 was analyzed from the
Taylor microarray cohort (Fig. 7A). LAMP-1 gene expression was significantly decreased (P 0.01) in prostate
cancer tissue compared with nonmalignant prostate tissue.
APPL1 gene expression was significantly increased (P 0.05) in prostate cancer tissue compared with nonmalignant tissue. Immunohistochemistry was used to investigate the distribution of LAMP-1 and Appl1 in prostate
cancer patient tissue samples (Fig. 7B). The lysosomal
marker LAMP-1 showed tumor-specific staining in some
patient samples, but consistent with previous studies,
there were variable results with some patient samples
having little or no LAMP-1 staining (data not shown for
the latter). In nonmalignant tissue, Appl1 clearly delineated basement membranes, whereas in the malignant
tissue there was no evidence of basement membrane
staining (Fig. 7B). In addition, Appl1 specifically delineated the cancer margins and showed increased staining
within the tumor mass (Fig. 7B).
www.aacrjournals.org
Discussion
Prostate cancer is one of the most frequently diagnosed
cancers in men and a leading cause of cancer-related deaths
worldwide, particularly, in the United States and Australasian populations (24, 25). The prostate-specific antigen is
still commonly used to detect prostate cancer, but has
significant problems in terms of miss-diagnosis and prognostic prediction (see for example ref. 26). Some promising
adjunct tests have recently been developed, including prostate cancer antigen 3 (PCA3; ref. 27), the analysis of
cholesterol sulfate (28), and a novel sequence of the gene
protein kinase C-zeta (PRKCZ), which is translated to the
protein PRKC-z-PrC (29). However, these biomarkers do
not provide early and accurate detection of prostate cancer,
which is needed to enable the selection of the most appropriate therapeutic intervention and to avoid potential overtreatment (2). On the basis of our observations of altered
LIMP-2 expression (14), we investigated altered endosomal
biogenesis in prostate cancer to help provide more sensitive
and specific markers for early detection and disease
prediction.
There have been extensive protein and proteomic studies undertaken to identify potential new prostate cancer
biomarkers (see for example ref. 26); however, the ideal
marker with appropriate sensitivity and specificity is yet to
be established. Interestingly, many of the early biomarkers
investigated, and some of the recent proteins identified in
proteomic studies, are either lysosomal hydrolases (e.g.,
lysosomal cathepsins, acid ceramidase, and acid phosphatase), lysosomal membrane proteins (e.g., LAMP-1-3 also
called CD107a, b, and CD63) or proteins that are delivered from the cell surface into the endosome–lysosome
system (e.g., sialomucin/CD164, CD1, CD47, and
CD75). Additional evidence supports the concept that
endosomal–lysosomal biogenesis is altered in prostate
cancer, including the altered distribution of lysosomes
that has been reported in prostate cancer cells (30).
Despite these indications on lysosomal biogenesis, a set
of optimal prostate cancer biomarkers have yet to be
defined. In a recent study of endosome and lysosome
markers in prostate cancer cell lines, we also found that
lysosomal markers were unable to discriminate prostate
cancer from nonmalignant cell lines, but there was evidence suggesting that endosome biogenesis may be altered
in prostate cancer cells (14).
Here, we observed altered distribution of specific endosome subsets and lysosomes into the cellular periphery of
prostate cancer cells, which could have important implications for cancer cell biomarker release and intracellular
signaling. Acidic extracellular pH has been shown to enhance
organelle redistribution, stimulating the traffic of endosome–lysosome–related organelles to the periphery of cancer
cells (10, 31). This altered endosome–lysosome traffic has
been linked with the release of cathepsin B and tumor
invasiveness (32), presumably due to the hydrolysis of
extracellular matrix after the exocytosis of this enzyme
(33). However, cathepsin B has been reported to be more
Mol Cancer Res; 12(12) December 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1857
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Johnson et al.
Figure 5. Transferrin and endosome/lysosome marker cofluorescence. Confocal micrographs and enlargements showing transferrin (red; endocytosed for 20
minutes) and endosome/lysosome marker (green) in nonmalignant control cell lines PNT1a and PNT2, and prostate cancer cell lines 22RV1 and LNCaP.
Colocalization of markers is depicted by yellow fluorescence.
enriched in endosomes (34) rather than lysosomes, whereas
the reverse is true for another proposed prostate cancer
biomarker cathepsin D (35). The movement of lysosomal-related vesicles to the periphery of prostate cancer cells has
been shown to be dependent on GTPases (e.g., RhoA),
microtubules, the molecular motor protein KIF5b, and to
involve PI3K, Akt/Erk1/2 phosphorylation, and MAPK
signaling (32). Moreover, a component of the MAPK
signaling pathway, the endosome-localized MAPK/Erk
kinase (MEK1) p14–MP1 scaffolding complex, has been
shown to specifically interact with and regulate the distri-
1858
Mol Cancer Res; 12(12) December 2014
bution of endosomes via ERK signaling (36). Increases in
Naþ/Hþ exchange activity (acidification), RhoA GTPase
activity, and PI3K activation have been shown to result in
exocytosis from prostate cancer cells (31). The increased
endosomal-associated gene and protein expression observed
here, together with the previously observed cathepsin B
release, suggested that endosome-related proteins may provide an important new focus for prostate cancer disease
biomarker studies.
Increased expression of the endosomal protein LIMP-2
has been shown in oral squamous cell carcinoma and was
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Altered Endosome Biogenesis in Prostate Cancer
Figure 6. Analysis of transferrin
receptor expression and
localization with transferrin.
A, quantification of transferrin
receptor 1 (TFRC) and transferrin
receptor 2 (TFR2) gene expression
in nonmalignant and prostate
cancer cell lines. B, Western blot
analysis and protein quantification
of transferrin receptor 1 (TfR1) and
transferrin receptor 2 (TfR2).
Quantification of gene and protein
expression was relative to GAPDH
gene and protein, respectively.
C, confocal micrographs and
enlargements showing transferrin
(red) and transferrin receptor
(green) in nonmalignant cell lines
PNT1a and PNT2, and prostate
cancer cell lines 22RV1 and
LNCaP. Colocalization of
transferrin receptor and transferrin
is represented by yellow
fluorescence. D, Western blot
analysis and quantification (E) of
AKT phosphorylation relative to
total AKT, prior and subsequent to
treatment of nonmalignant (PNT1a
and PNT2) and prostate cancer
cells (22RV1 and LNCaP) with
transferrin for 20 minutes.
, P 0.05.
associated with tumor metastasis (37). LIMP-2 has been
reported to have a role in endosome biogenesis and its overexpression evoked the enlargement of both early and late
endosomes (16). We observed increased gene and protein
expression of the endosomal protein LIMP-2 in prostate
cancer cell lines (14), prompting us to investigate other
endosomal proteins in prostate cancer cells. The early endosome-associated proteins Appl1, Appl2, EEA1, and recycling
endosome protein Rab4 were significantly upregulated (gene
and protein) in prostate cancer cells, supporting the hypothesis of altered endosome biogenesis in prostate cancer. APPL1
expression was significantly increased in the Taylor prostate
cancer tissue microarray, supporting the expression profiles
www.aacrjournals.org
observed in cell lines. Furthermore, the each EEA1 and Appl1
endosome subpopulations displayed altered intracellular distribution consistent with altered endosome traffic and potentially function. Interestingly, while Rab7 expression was
unaltered, Rab7-positive compartments displayed differential
distribution in prostate cancer compared with nonmalignant
cells. Changes in subcellular localization may affect signaling
in a similar manner to that which transpires through downregulated gene/protein expression that affects prostate cancer
progression through enhanced signaling (38). Thus, the
analysis of compartment distribution may distinguish cancer
cell phenotypes independently of altered gene and protein
expression.
Mol Cancer Res; 12(12) December 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1859
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Johnson et al.
Figure 7. Analysis of gene expression and protein distribution in
prostate cancer compared with nonmalignant tissue. A, box-andwhisker graphs showing percentage change of LAMP1 and APPL1
mRNA expression in normal (n ¼ 29) and prostate cancer tissue (n ¼
150) from metanalysis of the cohort by Taylor and colleagues (22).
Box-and-whisker graphs were plotted with Tukey outliers (black
points). Statistical significance is represented by an asterisk ( , P 0.05; , P 0.01). B, LAMP-1 (a and b) and Appl1 (d and e) expression
in matched human normal (a and d) and malignant (b; Gleason grade
3þ3, e; Gleason grade 3þ4) prostate tissue. Both normal and
malignant mixed-tissue is stained for LAMP-1 (c; Gleason grade 3þ3)
and Appl1 (f; Gleason grade 3þ4). The arrows in d and f show Appl1
staining the basement membrane in nonmalignant prostate tissue.
Scale bar, 100 mm in a, b, and d and 200 mm in c, e, and f.
The significant changes that we observed in endosomeassociated gene and protein expression, together with the
altered distribution of endosome populations prompted us
to investigate transferrin receptor expression together with
transferrin endocytosis, sorting, and Akt signaling as measures of endosome function. Significant increases in the
amount of transferrin receptor have previously been reported
in prostate cancer cells (39), and this has been linked to cMyc activation, which alters proliferation and tumorigenesis
(40). Akt signaling is also essential for regulating cell growth
and survival; and this controls the cell surface expression of
transferrin and growth factor receptors (41). The transferrin
1860
Mol Cancer Res; 12(12) December 2014
receptor has previously been observed to colocalize with
Rab5 and the motor protein myosin VI; the latter of which is
involved in retrograde transport to the plasma membrane
(42). This was consistent with our observations of endosome
populations costaining with labeled transferrin in the cellular
periphery of prostate cancer cells. There also appeared to be a
deregulation of Akt signaling in prostate cancer cells, with
control cells being responsive to transferrin endocytosis, but
prostate cancer cells being unresponsive, despite having
variable high or low amounts of Phospho-Akt/Akt. This
altered signaling may be related to the intracellular location
of the transferrin receptor that can be disturbed through
changes in localization or depletion of PtdIns3P (43) or
affected through variable internalization resulting from
altered Appl1 or Rab5 expression (as is the case with
epidermal growth factor receptor; ref. (44), affecting receptor trafficking and signal modulation.
Appl1 has been shown to be directly involved in insulin
signaling and the translocation of the glucose transporter
GLUT-4, which is mediated by direct binding of Appl1 to
PI3K and Akt (45), inducing endosome relocalization. In
prostate cancer cells, Appl1-potentiated Akt activity has
also been shown to suppress androgen receptor transactivation (46). The increased gene and protein expression of
Appl1 that we observed in prostate cancer cells might be
expected to cause increased glucose uptake, due to its
effect on GLUT-4 and this could have implications for
energy metabolism in these cancer cells. Indeed, Appl1
also regulates other aspects of both lipid and glucose
metabolism, activating AMP-activated kinase, p38
MAPK, and PPARa (see for example ref. 45). Appl2 has
been shown to function as a negative regulator of adiponectin signaling, by competitive binding with Appl1 for
interaction with the adiponectin receptor, again regulating
energy metabolism. The increased expression of both
Appl1 and Appl2 could therefore impact heavily on
prostate cancer cell metabolism with direct significance
for increased energy utilization and prostate cancer cell
survival. The altered Appl1 expression and effect on Akt
signaling in prostate cancer cells would be expected to also
have significant consequence for other aspects of prostate
cancer biology, due to the importance of the Appl1/PI3K/
Akt signaling pathway in leading cell adhesion and cell
migration (47). Notably, Appl1 also acts as a mediator of
other signaling pathways, by interaction with the cytosolic
face of integral or membrane-associated proteins either at
the cell surface or in the endosome pathway; where it is
directly involved in endosome traffic.
Rab GTPases are integrally involved in the control of
endosome traffic, cycling between the cytoplasmic GDPbound state and the active membrane–associated GTPbound state. Rab5 and Rab7 respectively define early- and
late-endosome compartments and during endosome maturation Rab5 recruits the HOPS complex as a mechanism to
activate and be replaced by Rab7. Although mVps39 is
known to be a guanine nucleotide exchange factor (GEF)
that promotes the GTP-bound state on endosomal Rabs,
TBC-2/TBC1D2 is a Rab GTPase-activating protein (GAP)
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Altered Endosome Biogenesis in Prostate Cancer
that promotes the GDP-bound state; and in combination is
used to regulate the membrane localization of Rab proteins.
TBC-2/TBC1D2 is therefore thought to act as a regulator of
endosome to lysosome traffic and is required to maintain the
correct size and distribution of endosomes (48). The altered
distribution of endosome populations that we observed in
prostate cancer cells suggests that TBC-2/TBC1D2 (GAP)
and or mVps39 (GEF) might be functionally impaired;
particularly, as the early endosomes were routed mainly
toward the cell periphery, whereas late endosomes remained
in a perinuclear location. Interestingly, microarray analysis has
detected increased expression of TBC-2/TBC1D2 and
reduced Vps39 mRNA in relation to altered endosomal–
lysosomal traffic (49). This altered GEF and GAP function
has been shown to be critical for endosomal traffic of integrins
and there have been direct links established between altered
Rab GTPase activity and cancer progression (50).
The expression of endosome markers has not previously
been investigated thoroughly in prostate cancer, although
some lysosomal-related cell surface CD (cell differentiation)
markers and LAMP-1/LAMP-2 have been used in tissue
biopsy analysis. The Gleason grading system is used to define
histologic differentiation in conjunction with marker analysis to predict the course of disease in patients with prostate
cancer. The lysosomal membrane proteins LAMP-1-3 and
CD markers CD164, CD1, CD47, and CD75 are often
evident in primary and metastatic cancer biopsies (51), but
their consistency and predictive capacity for disease progression is limited. We observed increased amounts of Appl1
protein in malignant tissue from biopsies of patients with
prostate cancer, confirming the increased gene and protein
expression of Appl1 in prostate cancer cell lines. Appl1
appeared more concentrated in the basement membranes
in nonmalignant tissue, whereas in the malignant tissue,
there was no basement membrane staining, indicating diagnostic/prognostic potential for this biomarker. Further
immunohistochemical and patient tissue analysis of Appl1
and other endosomal proteins is required to establish the
validity and predictive value of these proteins as prognostic
biomarkers in prostate cancer.
In summary, we have demonstrated increased expression
of early endosome markers and altered localization of endosome and lysosome compartments in prostate cancer cells,
which was associated with altered endocytosis and recycling
of the transferrin receptor and aberrant Akt signaling. The
alterations to the endocytic machinery that we have observed
here, may increase the amount of endocytosis in prostate
cancer cells, which could increase nutrient uptake/availability, provide additional membrane for cell division (9), and
alter intracellular signaling (10); which are all hallmarks of
cancer cell biology. There appeared to be a specific disconnect between the cellular location of early endosomes (and
lysosomes) in the cell periphery and late endosomes in the
perinuclear region, which could affect degradative and
signaling processes in prostate cancer cells. We concluded
that endosome biogenesis and function is altered in prostate
cancer cells, opening a potentially new avenue to investigate
biomarkers that aid in the diagnosis and prognosis of prostate
cancer. Endosomes are directly involved in the processes of
cellular secretion and exosome release, making these newly
identified endosomal proteins potentially available for detection in patient samples, such as blood and urine.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors' Contributions
Conception and design: I.R.D. Johnson, E.J. Parkinson-Lawrence, T. Shandala,
R. Weigert, L.M. Butler, D.A. Brooks
Development of methodology: I.R.D. Johnson, E.J. Parkinson-Lawrence,
T. Shandala
Acquisition of data (provided animals, acquired and managed patients, provided
facilities, etc.): I.R.D. Johnson, E.J. Parkinson-Lawrence
Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): I.R.D. Johnson, E.J. Parkinson-Lawrence, T. Shandala,
L.M. Butler, D.A. Brooks
Writing, review, and/or revision of the manuscript: I.R.D. Johnson, E.J. ParkinsonLawrence, L.M. Butler, D.A. Brooks
Administrative, technical, or material support (i.e., reporting or organizing data,
constructing databases): E.J. Parkinson-Lawrence, D.A. Brooks
Study supervision: E.J. Parkinson-Lawrence, D.A. Brooks
Acknowledgments
The authors thank Dr. Shalini Jindal and Ms. Marie Pickering (Dame Roma
Mitchell Cancer Research Laboratories, University of Adelaide, South Australia) for
expert assistance with the immunohistochemistry and pathology of human prostate
tissue samples.
Grant Support
This project was funded by a University of South Australia Presidents Scholarship
and a University of South Australia Postgraduate Award, together with additional
support from University of South Australia Research SA Seeding Funds.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
Received February 10, 2014; revised July 9, 2014; accepted July 10, 2014;
published OnlineFirst July 30, 2014.
References
1.
2.
3.
4.
Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer
J Clin 2013;63:11–30.
Schroder FH, Hugosson J, Roobol MJ, Tammela TL, Ciatto S, Nelen V,
et al. Screening and prostate-cancer mortality in a randomized European study. N Engl J Med 2009;360:1320–8.
Moyer VA. Screening for prostate cancer: U.S. preventive services
task force recommendation statement. Ann Intern Med 2012;157:
120–34.
Parachoniak CA, Park M. Dynamics of receptor trafficking in tumorigenicity. Trends Cell Biol 2012;22:231–40.
www.aacrjournals.org
5.
6.
7.
8.
Hurley JH, Odorizzi G. Get on the exosome bus with ALIX. Trends Cell
Biol 2012;14:654–5.
Hu CT, Wu JR, Wu WS. The role of endosomal signaling triggered by
metastatic growth factors in tumor progression. Cell Signal 2013;25:
1539–45.
Settembre C, Fraldi A, Medina DL, Ballabio A. Signals from the
lysosome: a control centre for cellular clearance and energy metabolism. Nat Rev Mol Cell Biol 2013;14:283–96.
Boucrot E, Kirchhausen T. Endosomal recycling controls plasma membrane area during mitosis. Proc Natl Acad Sci U S A 2007;104:7939–44.
Mol Cancer Res; 12(12) December 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1861
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Johnson et al.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
1862
Palfy M, Remenyi A, Korcsmaros T. Endosomal crosstalk: meeting
points for signaling pathways. Trends Cell Biol 2012;22:447–56.
Glunde K, Guggino SE, Solaiyappan M, Pathak AP, Ichikawa Y,
Bhujwalla ZM. Extracellular acidification alters lysosomal trafficking
in human breast cancer cells. Neoplasia 2003;5:533–45.
Stow JL, Murray RZ. Intracellular trafficking and secretion of inflammatory cytokines. Cytokine Growth Factor Rev 2013;24:227–39.
Henneberry MO, Engel G, Grayhack JT. Acid phosphatase. Urol Clin
North Am 1979;6:629–41.
Quintero IB, Araujo CL, Pulkka AE, Wirkkala RS, Herrala AM, Eskelinen
EL, et al. Prostatic acid phosphatase is not a prostate specific target.
Cancer Res 2007;67:6549–54.
Johnson IR, Parkinson-Lawrence EJ, Butler LM, Brooks DA. Prostate
cell lines as models for biomarker discovery: Performance of current
markers and the search for new biomarkers. Prostate 2014;74:547–60.
Camacho L, Meca-Cortes O, Abad JL, Garcia S, Rubio N, Diaz A, et al.
Acid ceramidase as a therapeutic target in metastatic prostate cancer.
J Lipid Res 2013;54:1207–20.
Kuronita T, Eskelinen EL, Fujita H, Saftig P, Himeno M, Tanaka Y. A role
for the lysosomal membrane protein LGP85 in the biogenesis and
maintenance of endosomal and lysosomal morphology. J Cell Sci
2002;115:4117–31.
Huotari J, Helenius A. Endosome maturation. EMBO J 2011;30:
3481–500.
Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev
Mol Cell Biol 2001;2:107–17.
Jordens I, Marsman M, Kuijl C, Neefjes J. Rab proteins, connecting
transport and vesicle fusion. Traffic 2005;6:1070–7.
Capes-Davis A, Theodosopoulos G, Atkin I, Drexler HG, Kohara A,
MacLeod RA, et al. Check your cultures! A list of cross-contaminated
or misidentified cell lines. Int J Cancer 2010;127:1–8.
Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino
VA, et al. A gene network regulating lysosomal biogenesis and function. Science 2009;325:473–7.
Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS,
et al. Integrative genomic profiling of human prostate cancer. Cancer
Cell 2010;18:11–22.
Shukla S, Maclennan GT, Hartman DJ, Fu P, Resnick MI, Gupta S.
Activation of PI3K-Akt signaling pathway promotes prostate cancer
cell invasion. Int J Cancer 2007;121:1424–32.
Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA
Cancer J Clin 2005;55:74–108.
Australian Institute of Health and Welfare (AIHW). Cancer in Australia
2010: an overview. Cancer series no. 60. Cat. no. CAN 56. Canberra:
AIHW; 2010 Jan 1.
Roobol MJ, Haese A, Bjartell A. Tumour markers in prostate cancer III:
biomarkers in urine. Acta Oncol 2011;50(Suppl 1):85–9.
Ploussard G, de laTaille A. Urine biomarkers in prostate cancer. Nat
Rev Urol 2010;7:101–9.
Eberlin LS, Dill AL, Costa AB, Ifa DR, Cheng L, Masterson T, et al.
Cholesterol sulfate imaging in human prostate cancer tissue by
desorption electrospray ionization mass spectrometry. Anal Chem
2010;82:3430–4.
Yao S, Ireland SJ, Bee A, Beesley C, Forootan SS, Dodson A, et al.
Splice variant PRKC-zeta(-PrC) is a novel biomarker of human prostate
cancer. Br J Cancer 2012;107:388–99.
Sloane BF, Moin K, Sameni M, Tait LR, Rozhin J, Ziegler G. Membrane
association of cathepsin B can be induced by transfection of human
breast epithelial cells with c-Ha-ras oncogene. J Cell Sci 1994;107:
373–84.
Steffan JJ, Snider JL, Skalli O, Welbourne T, Cardelli JA. Naþ/Hþ
Exchangers and RhoA regulate acidic extracellular pH-induced lysosome trafficking in prostate cancer cells. Traffic 2009;10:737–53.
Mol Cancer Res; 12(12) December 2014
32. Steffan JJ, Cardelli JA. Thiazolidinediones induce Rab7–RILP–MAPK–
dependent juxtanuclear lysosome aggregation and reduce tumor cell
invasion. Traffic 2010;11:274–86.
33. Roshy S, Sloane BF, Moin K. Pericellular cathepsin B and malignant
progression. Cancer Metastasis Rev 2003;22:271–86.
34. Authier F, Kouach M, Briand G. Endosomal proteolysis of insulin-like
growth factor-I at its C-terminal D-domain by cathepsin B. FEBS Lett
2005;579:4309–16.
35. Zaidi N, Maurer A, Nieke S, Kalbacher H. Cathepsin D: a cellular
roadmap. Biochem Biophys Res Commun 2008;376:5–9.
36. Deacon SW, Nascimento A, Serpinskaya AS, Gelfand VI. Regulation of
bidirectional melanosome transport by organelle bound MAP kinase.
Curr Biol 2005;15:459–63.
37. Pasini FS, Maistro S, Snitcovsky I, Barbeta LP, Rotea Mangone FR,
Lehn CN, et al. Four-gene expression model predictive of lymph node
metastases in oral squamous cell carcinoma. Acta Oncol 2012;51:
77–85.
38. Steffan JJ, Dykes SS, Coleman DT, Adams LK, Rogers D, Carroll JL,
et al. Supporting a role for the GTPase Rab7 in prostate cancer
progression. PLoS ONE 2014;9:e87882.
39. Keer HN, Kozlowski JM, Tsai YC, Lee C, McEwan RN, Grayhack JT.
Elevated transferrin receptor content in human prostate cancer cell
lines assessed in vitro and in vivo. J Urol 1990;143:381–5.
40. O'Donnell KA, Yu D, Zeller KI, Kim JW, Racke F, Thomas-Tikhonenko
A, et al. Activation of transferrin receptor 1 by c-Myc enhances cellular
proliferation and tumorigenesis. Mol Cell Biol 2006;26:2373–86.
41. Edinger AL, Thompson CB. Akt maintains cell size and survival by
increasing mTOR-dependent nutrient uptake. Mol Biol Cell 2002;
13:2276–88.
42. Puri C, Chibalina MV, Arden SD, Kruppa AJ, Kendrick-Jones J, Buss F.
Overexpression of myosin VI in prostate cancer cells enhances PSA
and VEGF secretion, but has no effect on endocytosis. Oncogene
2010;29:188–200.
43. Fili N, Calleja V, Woscholski R, Parker PJ, Larijani B. Compartmental
signal modulation: endosomal phosphatidylinositol 3-phosphate controls endosome morphology and selective cargo sorting. Proc Natl
Acad Sci U S A 2006;103:15473–8.
44. Lee JR, Hahn HS, Kim YH, Nguyen HH, Yang JM, Kang JS, et al.
Adaptor protein containing PH domain, PTB domain and leucine zipper
(APPL1) regulates the protein level of EGFR by modulating its trafficking. Biochem Biophys Res Commun 2011;415:206–11.
45. Wang C, Xin X, Xiang R, Ramos FJ, Liu M, Lee HJ, et al. Yin-Yang
regulation of adiponectin signaling by APPL isoforms in muscle cells.
J Biol Chem 2009;284:31608–15.
46. Yang L, Lin HK, Altuwaijri S, Xie S, Wang L, Chang C. APPL suppresses
androgen receptor transactivation via potentiating Akt activity. J Biol
Chem 2003;278:16820–7.
47. Broussard JA, Lin WH, Majumdar D, Anderson B, Eason B, Brown CM,
et al. The endosomal adaptor protein APPL1 impairs the turnover of
leading edge adhesions to regulate cell migration. Mol Biol Cell
2012;23:1486–99.
48. Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau
CE. TBC-2 regulates RAB-5/RAB-7–mediated endosomal trafficking
in Caenorhabditis elegans. Mol Biol Cell 2010;21:2285–96.
49. Peralta ER, Martin BC, Edinger AL. Differential effects of TBC1D15
and mammalian Vps39 on Rab7 activation state, lysosomal morphology, and growth factor dependence. J Biol Chem 2010;285:
16814–21.
50. Subramani D, Alahari SK. Integrin-mediated function of Rab GTPases
in cancer progression. Mol Cancer 2010;9:312.
51. Liu AY, Roudier MP, True LD. Heterogeneity in primary and metastatic
prostate cancer as defined by cell surface CD profile. Am J Pathol
2004;165:1543–56.
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074
Altered Endosome Biogenesis in Prostate Cancer Has Biomarker
Potential
Ian R.D. Johnson, Emma J. Parkinson-Lawrence, Tetyana Shandala, et al.
Mol Cancer Res 2014;12:1851-1862. Published OnlineFirst July 30, 2014.
Updated version
Supplementary
Material
Access the most recent version of this article at:
doi:10.1158/1541-7786.MCR-14-0074
Access the most recent supplemental material at:
http://mcr.aacrjournals.org/content/suppl/2014/07/31/1541-7786.MCR-14-0074.DC1
Cited articles
This article cites 50 articles, 15 of which you can access for free at:
http://mcr.aacrjournals.org/content/12/12/1851.full.html#ref-list-1
E-mail alerts
Sign up to receive free email-alerts related to this article or journal.
Reprints and
Subscriptions
Permissions
To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at
[email protected].
To request permission to re-use all or part of this article, contact the AACR Publications Department at
[email protected].
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.