Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Name _____________________________________ Date __________________ Period ____ Telephone Cladogram Activity Objective: The purpose of this activity is to explore the concept of cladograms and how they help visualize evolutionary relationships between organisms. Background: Cladograms are tools that biologists use to visualize evolutionary relationships. The way that they show evolutionary relationships is by branching when two organisms differ from each other in some way, whether that be anatomical, behavioral, functional, or molecular. Admittedly, they can get to be quite complex and confusing. In order to simplify the concept, we will be working with cladograms revolving around the invention of the telephone. The following cladograms will deal with the history of telephones from the first phones to today’s modern cell phones. 1. First, we will consider the simple cladogram below, which shows the relationship between different types of cell phones. Feature Standard Keypad Standard Screen Full Keypad Touch Screen Phone A X X Phone B X X Phone C X X a. Looking at the about cladogram, which phone is closest in relationship to Phone C? Why? b. Charts, like the one shown above, are sometimes used to help put cladograms together. The chart shows what features each organism—or phone, in this case— has in common or how they differ. What is/are the difference(s) between Phone A and Phone C? c. In your own words, what does a cladogram show? How? 2. Good! Now, let’s consider a more complex cladogram that traces the evolution of telephones from Alexander Graham Bell to present. a. Show where the following phones would go in the cladogram above. b. Based on the cladogram, what can you infer about Phones B and C? Explain. 3. Biologically, one could use anatomical features, behavior, or molecular similarities and differences in constructing a cladogram. Molecularly, one could look at the number of mutations in a common strand of DNA. Another way would be to compare strings of amino acids and note differences in the order of the amino acids. Cytochrome C is a protein located in the mitochondria of cells involved with cellular respiration. Below is a table showing the amino acid sequences for Cytochrome C in several organisms. Organism Biochemical Data Amoeba Amino Acid Sequence: ISO-SER-ASP-GLN-PHE-ILE-LEU-GLN-SER-ARG-LEU-LEU-HIS DNA Sequence: ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTTCAT Kangaroo Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Earthworm Amino Acid Sequence: LEU-ISO-ASP-PRO-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: CTTATCGACCCGTTTATCCTACATTCCCGTCTACCTTCGT Cat Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Shark Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Dolphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Lizard Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Sponge Amino Acid Sequence: ISO-ISO-ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT a. The more amino acids that organisms have in common with another, both type and order, indicates the closer the relationship. The same is true for nucleotides. Compare the biochemical data above. Which organism is most closely related to the lizard? Why? b. Which organism is most closely related to the dolphin? Why? c. How do you think different amino acid sequences would affect organisms? Explain your answer. 4. Construct a cladogram using the table below. Label the branches with the appropriate structures. Characters Cells with flagella Symmetry Bilateral Symmetry Mesoderm Head develops first Anus develops first Segmented body Calcified Shell Chitonous Exoskeleton Water-vascular system Sponge Jellyfish Flatworm Earthworm x x x x x x x x x x x x x Snail x x x x x x Fruit fly x x x x Starfish x x x x x x x x x x 5. Understand that you follow the chart or description in order to form a cladogram. It does not matter if you know what a structure is or what it does, but how to separate