Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Journal of General Virology (1994), 75, 2349 2354. Printed in Great Britain 2349 Identification of human herpesvirus 6 uracil-DNA glycosylase gene Shigeo Sato, Takeshi Yamamoto, Yuji Isegawa and Koichi Yamanishi* Department o f Virology, Research Institute f o r Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565, Japan Uracil-DNA glycosylase encoded in many species functions as a DNA repair enzyme that removes uracil residues from DNA. To investigate the potential function of uracil-DNA glycosylase encoded by human herpesvirus 6 (HHV-6), we sequenced a DNA clone (pSTY09), identified an open reading frame of 765 bp and compared the putative amino acid sequence with other uracil-DNA glycosylases, by computer analysis. The amino acid sequence of HHV-6 had similarities to other uracil-DNA glycosylases, with the highest degree of similarity to those of human cytomegalovirus and Epstein-Barr virus. Two strongly conserved regions in uracil-DNA glycosylase of other species also existed in HHV-6. The gene product which was expressed in Escherichia eoli demonstrated uracil-DNA glycosylase activity. This is the first report to identify and characterize the uracil-DNA glycosylase gene in HHV-6. Introduction et al., 1994). A nomenclature has been adopted desig- Human herpesvirus 6 (HHV-6) was first isolated in 1986 from the peripheral blood of patients with lymphoproliferative disorders and AIDS (Salahuddin et al., 1986). The distinct nature of HHV-6 compared with other human herpesviruses was confirmed by molecular and immunological analyses (Josephs et al., 1986). The virus replicates predominantly in CD4 + lymphocytes (Lusso et al., 1988; Takahashi et al., 1989) and may establish latent infection in cells of the monocyte/ macrophagelineage (Kondo et al., 1991). Infection with this virus causes exanthem subitum (ES) or roseola infantum, a common illness of infancy (Yamanishi et al., 1988). Nucleotide sequence analysis of the genome has demonstrated that HHV-6 is more closely related to human cytomegalovirus (HCMV), a betaherpesvirus, than to the neurotropic alphaherpesviruses such as herpes simplex virus (HSV) and varicella-zoster virus (VZV) or to the lymphotropic gammaherpesviruses such as Epstein-Barr virus (EBV) (Efstathiou et al., 1992; Lawrence et at., 1990). Furthermore, two variants of HHV-6 have been identified based on differences in epidemiology, in vitro growth properties, reactivity with monoclonal antibodies, restriction endonuclease profiles and nucleotide sequence (Wyatt et al., 1990; Ablashi et al., 1991 ; Aubin et al., 1991, 1993; Schirmer et al., 1991 ; Chandran et al., 1992; Gompels et al., 1993; Yamamoto Nucleotide sequence data reported in this paper will appear in the GSDB, DDBJ, EMBL and NCBI nucleotidesequence databases with the accessionnumber D25277. 0001-2338 © 1994 SGM nating viruses HHV-6A (variant A) and HHV-6B (variant B) (Ablashi et al., 1993). To characterize biochemical properties, some enzyme assays have been performed in HHV-6-infected cells (Williams et al., 1989; Shiraki et al., 1989; Teo et al., 1991). In those reports, it was described that there were significant increases in the activities of DNA polymerase and DNase in extracts from virus-infected cells when compared to those from mock-infected cells; however, there was no significant increase in the activities of thymidine kinase (TK), dUTPase and uracil-DNA glycosylase. Uracil-DNA glycosylase is a D N A repair enzyme that removes uracil residues from DNA. Because it has been reported that neurons, in which HSV reactivation takes place, lack not only T K and D N A polymerases, but also uracil-DNA glycosylase (Focher et al., 1990, 1993), it is expected that uracil-DNA glycosylase may be a new target of antiviral agents against HSV infection. In this study, to investigate the potential function of uracil-DNA glycosylase encoded by HHV-6, we analyse the sequence of the D N A clone (pSTY09) and express the 765 bp open reading frame (ORF) in Escherichia coll. Methods Virus. The virus strain used in this study was HHV-6 strain HST which was isolatedfrom a patient with ES and belongsto the HHV-6B group (Yamanishi et al., 1988). The virus was propagated in fresh human peripheral mononuclear cells as described previously (Yamanishi et al., 1988). DNA sequencing and analysis. In our laboratory, the DNA sequencingof HHV-6B strain HST is in progress for the identification Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 12:06:52 S. Sato and others 2350 C T G C A G G A T A A C C C A G A G C A A C T A C G C A C A T T G T T T G C G C T G A T A G G G G A C C C A G A A T C T C C~;GACA A T TC-GC T A A A C T T TTTCAATGGC~'rC C A G A C A T G T T C G C C T T e C G T C G G ~ T A 120 121 1 ACAACC TGCATC AGCGATAACTGTAGAAAATATTTGC CTGAAAGAATTAC GTAC GTCAATAAC TTTTTTGTTGATAACATTGCAGGTC TC GAGTTTAACATTTCAGAAAACACAGAC AGT 240 241 TTTTACAGCAACATTGGTTTTTTATTATACTTGGAGAATC C T G C T A C A G G C A T C A C A A A A A T T A T C A G G T T C C C T T T T A A C T C T T T G A C T C TC T T T G A T A C G A T T T T G A A T T G T T T A A A G 360 361 T A T T T C C A C T T G A A A A C C G G A G T A G A A T T C G A C C T G C T A A A A C A G A T G G A A G C C T A C A A T T C T A A A C T A C C T T T C CGAAGTTCCCC~_CC T A C G A T T C T G A T T A G A A A C A C A T A A T T G G C T 480 481 1 A T G A C A T C A C G T C C C A T T C A C A T A A A A T G C T C C T A G G G A A T T T A A T C C A C T G C A T T T C A T T T C C C A A C C A ~ G C CC T A C T A C A G T G G A T G T T A G A T C A C G T T C A G G A T G A A G A A A A A A A C ****** M A L L Q W M L D H V Q D E E K N 600 17 601 18 T A T G A A A A C C~'fT C A A T A G A T G A T C A G C A T T C A C T C T T C G G C A T A A A C A G A G A C T G G T T G A G T T T C C T G C A A C T C T C C A A G T T A G A A A T T A C A C A T C T T A A G C A T G T T T A T A A A ~ T G Y E N L S I D D Q H S L F G I N R D W L S F L Q L S K L E I T H L K H V Y K L 720 57 721 58 GACAAC GATAGAGC TCATCTAACC GTC CAC CCC TCTTC GGATAAC GTC C AC GC C TGGAGTTT TTT GTGCAAAC C CAC CGATGTTAAAGTTGTGATTCTGGGACACGAT CCGTATC CC GAC D N D R A H L T V H P S S D N V H A W S F L C K P T D V K V V I L G H D P Y P D 840 97 841 98 GGCAGAGGTTGCGGTTTGC4•CTTcGGTACAGTGAAAGAGTGCTCGATTCCAGAATCTcTAAAGAATATATTTAAAGAACTGGAAAGAAGCATC•cGAATTTTTCC•C•CcTGAcAACGC•• 960 137 961 138 T G T T T A A A C T C C T G G T G T A G A G A A G G A G T C C T A C T G C T A A A C TC G A T A T T C A C T G T A G T T C A T G G A T T A C C A A T G T C C C A C G A G G C A T T T G G T T G C 4 Z A A A C A C T G A G C T A C A A G A T T A T C C L N S W C R E G V L L L N S I F T V V H G L P M S H E A F G W Q T L S Y K I I 1080 177 1081 178 A G C A G A C T A T C G G A A C A A A T G A A C T C T C T C G T T T T C T T G T T G T G G G G A A A A C A T G C C C G G A A A C T C T C T T A T C T A A T A G A C G C A C A G A A A C A T C TC G T C T T A G A A A G T G C A C A T C C A T C A S R L S E Q M N S L V F L L W G K H A R K L S Y L I D A Q K H L V L E S A H P S 1200 217 1201 218 C C C A A A G T G A A A G C T G C A A G A A T G C C A T T T A T T G G T T G C A A T C A T T T T G T G C G A A C AAATTTAT'Fr C T T A C T G A G C AC G G G A A A G A C C C A A T C A A T T G G A A C A T TC T G A A C G A A T A G ~ C P K V K A A R M P F I G C N K F V R T N L F L T E H G K D P I N W N I L N E 1320 255 G R G C G L A F G T V K E C S I P E S L K N I F K E L E R S I P N F S P P D N V G 1321 CTATTTAGTTTACATAAGAATTACAATACAGCAATAAAATTCA~AGTGTTTccAATATTGTGGTTGCCAGTAAGTCTTCATTAAAACTCCCAGcATTTT~AAAGTTTTCGGTTTCGCTGC 1440 1441 TATCGTcTATGACAATTGCAGAATTTTGTGTCcTTAAATTATTTAGATTGGAATTCCGTCTccTGGGAACTCTCCCTCGGCCACGTCCTcGTGCTcTGCCCCGGTTTTGTccTGAAATAA 1560 1561 CACGC TGCTGCC C GATTGCAC eATCTGTTGATCCGACGGTTGTTCTGGTCCGTTGTC 1680 1681 TCTCACACACAGGTACC GAAC TCTTe TTGC GTTCTGC GTTGTTTC AGTTTCAAATAC TeGCATGTC GATAAACGGTTTAA 1697 Fig. 1. Nucleotide sequence and predicted amino acid sequence of the PstI KpnI fragment of pSTY09. The 765 bp ORF starts with an ATG at position 550 and ends with a TAG at 1315, indicated by underlining. The amino acid sequence is shown below the nucleotide sequence. The sequence indicated by asterisks represents a candidate TATA box at position 501, the broken underline indicates a putative Spl-binding site at position 444, GGGCGG, and the double underline indicates a consensus polyadenylation signal, AATAAA, at position 1353. of viral genes. Genomic DNA was purified as described elsewhere (Martin et al., 1982), digested with a restriction enzyme PstI (Takara Shuzo Co.) and cloned into pUC19 (Yanisch-Perron et al., 1985). The 5.5 kb PstI fragment was cloned and designated pSTY09. Unidirectional progressive deletions of pSTY09, which spanned approximately 200 bp. were prepared with a deletion kit for kilo-sequencing (Takara Shuzo Co.) and used as a template in the dideoxynucleotide chain termination method (Sanger et al., 1977). The sequence data were then assembled using the ABI sequencing system and analysed for the presence of ORFs by using the computer program DNASIS (Hitachi). Comparisons of the predicted amino acid sequences of HHV-6 with those of other species were made using the SWISSPROT and National Biomedical Research Foundation Protein Identification Resource databases. Comparisons of amino acid sequences were carried out using arithmetic means (Higgins et al., 1992). (100 ~tg protein) as described elsewhere (Williams et al., 1989). Reaction mixtures were incubated at 37 °C for 1 h and terminated by chilling to 0 °C followed by the addition of 25 ml of sheared calf thymus DNA solution (1 mg/ml) and 25 ml of 4 M-perchloric acid. After 10 min at 0°C, the samples were centrifuged at 1400g for 10 min and the supernatants were placed in vials with scintillant and counted in a scintillation counter (Aloka, LSC700). A unit of uraci~DNA glycosylase activity was defined as the amount of enzyme required to release 1 pmol of uracil as acid-soluble material per min at 37 °C, as described elsewhere (Williams et al., 1989). Tramformation. The N c o I - K p n I fragment of pSTY09 containing the 765 bp ORF was inserted into the prokaryotic expression vector pTrc99A (Amann et al., 1988) and designated p99/UNG. E. coli strain CJ236, which is defective in uraciNDNA glycosylase activity (Kunkel et al., 1987), was transformed using the method of Hanahan (1985). Each culture broth (25 ml) of E. coli CJ236 containing plasmids p99/UNG or pTrc99A was grown at 37 °C to an A600 of 0.8 in LB medium with 50 mg/ml of ampicillin, and IPTG was added to a final concentration of 1 mM. After further incubation for 2 h, the cells were washed by centrifugation in general extraction buffer (0.15 M-NaCI, 1 mM-EDTA, 50 mM-Tris-HC1 pH 7.5) and suspended in the same buffer. The cell suspensions were frozen and thawed four times in a dry ice and ethanol bath and then subjected to sonication. The samples were centrifuged to remove precipitated material and used as cell-free extracts for enzyme assays. Results Sequence analysis of the uracil-DNA glycosylase locus E n z y m e assays. Activated calf thymus DNA was labelled with [5'3H]dUTP (15 Ci/mmol) and [methyl, I',2'-3H]dTTP (90Ci/mmol) (Amersham), respectively, as described elsewhere (Caradonna & Cheng, 1980). The uracil-DNA glycosylase reaction mixture contained, in a total volume of 0.2 ml, 50 mM-Tri~HCI pH 7.5, 10 mg BSA, 2 mMDTT, 10 mM-EDTA, labelled DNA (104 d.p.m./l~g) and the cell extract Protein determinations. Protein was estimated by using the Pierce BCA Protein Assay Reagent (Pierce Chemicals), using BSA as the standard. From the results of DNA sequencing, it was observed that there were several ORFs in pSTY09. We were particularly interested in the 765 bp ORF, because it had a high similarity to HCMV UL114 which is thought to encode uracil-DNA glycosylase. There were also ORFs upstream and downstream of the 765 bp ORF and they showed similarities to HCMV U L l l 5 and ULll3, respectively (data not shown). A region of DNA sequence in pSTY09 (1697 bp), numbered from positions 1 to 1697, is shown in Fig. 1. The 765 bp ORF starts with an ATG at position 550, ends with a TAG at position 1315 and was expected to encode 255 amino acids, a polypeptide of approximately 29K. The sequence surrounding the initiation codon, CCACCATGG, is identical to Kozak's optimal ATG context, CCPuCCATGG Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 12:06:52 Uracil-DNA gtycosylase of HHV-6 (Kozak, 1989), and is preceded by a candidate TATA box at position 501, CATAAA, which is identical to the TATA box of the HSV TK gene and the HHV-6 DNA polymerase gene (McGeoch et al., 1988; Teo et al., 1991). Furthermore, at position 444, there was a putative binding site for Spl, GGGCGG, one of several transcription factors, and the stop codon TAG at position 1315 was followed by a consensus polyadenylation signal, AATAAA, at position 1353. From these aspects, it was expected that the 765 bp ORF could encode a protein. Comparison of the predicted amino acids constituting putative uracil-DNA glycosylases of HHV-6 and other herpesviruses Comparison of amino acid sequences of uracil-DNA glycosylases from humans, yeast, E. coli and other human herpesviruses revealed a striking similarity between all these proteins. The alignment of the uracilDNA glycosylases of different species demonstrated that they were highly conserved regions of various sizes, reported previously as consensus sequences (Mullaney et al., 1989), and Fig. 2 shows that the HHV-6 protein also contained these regions. Two regions of the HHV-6 protein, in particular amino acids 87 to 107 and 146 to 169, were highly conserved in the sequences of the different species, and it was expected that these consensus regions were VVI-GqDPYh--gqahGLaFsv and GVLL1Nt-lTV-rg .... SH---GW, respectively. The amino acids indicated with capital letters are conserved among all eight uracil-DNA glycosylases for which sequences are published, and those indicated with lowercase letters are conserved among more than six species. The amino acid sequence identities (Higgins et al., 1992) between uracilDNA glycosylase of HHV-6 and those of six other Table 1. Amino acid identity between uracil-DNA glycosylase of HHV-6 strain H S T and those of other herpesviruses, E. coli, yeast and humans* Origin Identity (%) EBV HCMV VZV HSV-1 HSV-2 EHV- 1 30.5 30.0 t 9-9 13.2 14.1 13-2 24.1 12.1 19-5 E. coli Yeast Human *** • *** 2351 ** ****** HHV-6 (87-107) VVILGHDPYP-DGRGCGLAFGT HCMV (85-105) VVIVGQDPYC-DGSASGLAFGT EBV (85-105) VVILGQDPYHG-GQANGLAFSV VZV (142-163) VVIIGQDPYPTAGHAHGLAFSV HSV-I (172-193) VVIIGQDPYHHPGQAHGLAFSV HSV-2 (93-114) VVIIGQDPYHHPGQAHGLAFSV EHV-I 149-170) VVIVGQDPYHAPGQAHGLAFSV Human 139-160) VVILGQDPYHGPNQAHGLCFSV Yeast 156-177) WIIGQDPYHNFNQAHGLAFSV E.coli (57-78) VVILGQDPYHGPGQAHGLAFSV Consensus WI-GqDPYh--gqahGLaFsv ****** **e*** * ** ** HHV-6 146-169 ) GVLLLNS I F T V V H G L P M - S H E A F G W HCMV 144 - 167 ) GVLLLNTVFTVVHGQPG-SHRHLGW EBV 144-167 ) G V L L L N T ILTVQKGKPG- S HAD IGW VZV 202-225 ) GVLLLNTTLTVRRGTPG- SHVYLGW HSV-I 232 -255 ) GVLLLNTTLTVKRGAAA-SHSRIGW HSV-2 153 - 176 ) G V L L L N T T L T V K R G A A A - S H SKLGW EHV-I 209 - 232 ) GVLL INTTLTVARGKPG- S H A T L G W Human 199- 222 ) GVLLLNAVLTV-RAHQANSHKERGW Yeast 217 -240 ) G V L L L N T S L T V -RAHNANSH SKHGW E.coli 117-140 ) GVLLLNTVLTV -RAGQARSHASLGW Consensus G V L L I N t - I T V - r g .... S H - - - G W Fig. 2. Conserved regions of amino acid sequences of uracil-DNA glycosylases. Amino acid residues 85 to 107 and 146 to 169 from HHV-6 uracil-DNA glycosylase were aligned with amino acid residues derived from uracil-DNA glycosylases of HCMV (Chee et al., 1990), EBV (Baer et al., 1984), VZV (Davison and Scott, 1986), HSV-1 (McGeoch et al., 1988), HSV-2 (McGeoch et al., 1991), EHV-1 (Telford et al., 1992), humans (Olsen et al., 1989), yeast (Percival et al., 1989) and E. co//(Varshney et al., 1988). Gaps in the protein sequences were introduced to yield maximal alignment and are indicated by dashes ( ) . In the consensus sequence, the amino acids conserved amongst all eight species are indicated by capital letters and those conserved in more than six species are indicated by lower case letters. The residues identical between HHV-6 and HCMV are indicated by asterisks. herpesviruses, humans, E. coti and yeast, ranged between 12.1% and 30.5 % (Table 1). Hydropathy profiles of the HCMV and HHV-6 proteins were very similar, suggesting that these proteins have similar structures (data not shown). Expression of uracil-DNA glycosylase in E. coli * The alignments were done separately for each herpesvirus and other species and the location and the number of gaps were different for each pairwise comparison. Amino acid residues for uraciNDNA glycosylase of HHV-6 were aligned with those derived for other species which are listed in Fig. 2. To determine whether or not the product of the putative uracil-DNA glycosylase gene exhibits enzyme activity, the 765 bp ORF was inserted into the prokaryotic expression vector pTrc99A and designated p99/UNG. pTrc99A and p99/UNG were then transferred into uracil-DNA glycosylase-defective E. coli CJ236 and the enzyme assay was performed with crude cell lysates as Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 12:06:52 2352 S. Sato and others Table 2. Enzyme activities in E. coli containing p 9 9 / U N G and pTrc99A* Substrate for uracil-DNA glycosylaseassay Cell lysate CJ236-p99/UNG CJ236-pTrc99A Denatured CJ236-p99/UNG [3H]UTP-labelled DNA 8-0 I-5 0-6 [3H]TTP-labelled DNA 1-6 i-3 NDt * Enzyme activity expressed as units/mg protein. A unit of uracil-DNA glycosylaseactivitywas definedas the amount of enzyme required to release 1 pmol of uracil as acid-solublematerial per rain. t NO, not determined. described in Methods. The data presented in Table 2 summarize the results of the uracil-DNA glycosylase assay. When [3H]dUTP-labelled D N A was used as the substrate, the amount of released label in the cell lysate containing p 9 9 / U N G was significantly increased relative to that in the lysate containing pTrc99A (8"0 unit/mg compared to 1"5 unit/rag, respectively), and this activity was completely lost by heat denaturation of the cell lysates. Additionally, this activity depended on the amount of lysate and the length of the incubation time (data not shown). However when [3H]dTTP-labelled DNA was used, there was little or no difference between the amount of released label observed for the p99/UNGcontaining lysate and that for the lysate containing the vector pTrc99A (1.6 unit/mg compared to 1.3 unit/mg, respectively). These results showed that the release of uracil from DNA was not a non-specific reaction such as that catalysed by exonuclease, but a uracil-specific reaction, suggesting that the gene product of the ORF in pSTY09 was a functional uracil-DNA glycosylase. The activity in the lysate containing pTrc99A indicated in Table 2 may be caused by a small degree of contaminating exonuclease owing to a decrease in the activity of heat-denatured lysates. Discussion Uracil-DNA glycosylase activity was first detected in extracts of E. coli (Lindahl, 1974), and its gene has been sequenced (Duncan & Chambers, 1984; Varshney et al., 1988). Thereafter~he genes of yeast and human uracilD N A glycosylases were reported (Percival et al., 1989; Olsen et al., 1989). Furthermore, the uracil-DNA glycosylase encoded by HSV has been purified, its cDNA was cloned and the locus mapped to UL2 in the viral genome (Caradonna et al., 1987; Worrad & Caradonna, 1988; Mullaney et al., 1989). Homologous genes were also found in other herpesviruses for which the genomes had been sequenced: gene 59 in VZV (Davison & Scott, 1986; Davison & Taylor, 1987), BKRF3 in EBV (Baer et al., 1984; Perry & McGeoch, 1988), U L l l 4 in HCMV (Chee et al., 1990) and equine herpesvirus type 1 (EHV1) (Telford et al., 1992). It was reported that this enzyme was highly conserved between humans, E. coli, yeast and herpesviruses, and that no other protein was known to be so strongly conserved from bacteria to humans (Olsen et al., 1989). However it was reported that there was no significant increase in the activities of TK, dUTPase and uracil-DNA glycosylase in extracts from HHV-6A (GS strain)-infected cells (Williams et al., 1989). We also failed to detect an increase in enzyme activity in HHV-6B (HST strain)-infected cells relative to mock-infected cells (data not shown). The similarities of genomic configuration between HHV-6 and HCMV were expected because it had been reported already that HHV-6 is closely related to HCMV (Neipel et al., 1991; Teo et al., 1991 ; Josephs et al., 1992; Liu et aI., 1993). As the two viruses also exhibited similarities with respect to the genomic region studied in this paper, the 765 bp ORF in pSTY09 was suggested to be a U L l l 4 (HCMV) homologue, in HHV-6, i.e. its product may have the activity of uracil-DNA glycosylase. To characterize the function of the 765 bp ORF, sequence analysis of this region was performed. As there were consensus signals for transcription and translation in the upstream and downstream regions of the 765 bp ORF, it was suggested that the O R F could encode a protein. Moreover, the putative amino acid sequence was compared to those of uracilDNA glycosylases already published. Table 1 shows that HHV-6 protein was most similar to those of HCMV and EBV among well characterized herpesviruses. In addition, the conserved regions among published uracilDNA glycosylases were also conserved in the putative HHV-6 enzyme, as shown in Fig. 2. As two regions of the HHV-6 protein (amino acids 87 to 107 and 146 to 169) were most strongly conserved among those of different species, it is possible that these regions may be part of the catalytic site. A related D N A sequence (Dambaugh et al; GSDB accession number L14772) for which we have not yet found an accompanying publication, aligns closely with that of HHV-6B (strain Z29), showing 99"8 % nucleotide sequence identity. To determine whether or not the product of the 765 bp O R F in pSTY09 can act as a uracil-DNA glycosylase, the ORF was expressed in uraciLDNA glycosylasedefective E. coli strain CJ236. The following two reasons led to the conclusion that the release of uracil from D N A by the expressed protein was not a non-specific reaction, such as those catalysed by exonuclease, but a uracilspecific reaction carried out by uracil-DNA glycosylase. Firstly, when [3H]dUTP-labelled DNA was used as the substrate, the amount of released radioactivity detected Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 12:06:52 Uracil-DNA gtycosylase of HHV-6 in the cell lysate containing p 9 9 / U N G was five times that in the lysate containing pTrc99A, but this activity was completely lost by heat denaturation of the cell lysates. Secondly, when [3H]dTTP-labelled D N A was used, there was no difference between the amount of released radioactivity observed for the p99/UNG-containing lysate and that for the Trc99A-containing lysate. The results of the enzyme assay and the similarity of amino acid sequences indicated that the 765 bp ORF in pSTY09 had the uracil-DNA glycosylase function. Additionally, the existence of highly conserved regions in amino acid sequences among the different species indicates that this enzyme has an important role in D N A replication. Uracil-DNA glycosylase is thought a target for new antiviral agents against herpesvirus infections, because it was reported that adult neurons lack the activity of not only TK, D N A polymerase ~, 7/e, but also of uracilD N A glycosylase (Focher et al., 1990, 1993). In the case of HSV infection, virus replication depends on viral enzymes in neurons in which reactivation takes place and inhibitors of those enzymes may suppress viral reactivation and replication. Since it has been reported that HHV-6 might invade the central nervous system and cause neurological symptoms (Kondo et al., 1993), the HHV-6 uracil-DNA glycosylase may also be a target of new antiviral agents. Development of agents that specifically inhibit virus-encoded enzymes has been difficult because of the high degree of amino acid conservation and biochemical similarities between human and virus uracil-DNA glycosylase. But several inhibitors of the HSV uracil-DNA glycosylase, such as bacteriophage PBS2-encoded uracil-DNA glycosylase inhibitor and some uracil analogues, have been synthesized and screened for their capacity to discriminate between the virus and human uraci~DNA glycosylase (Wang & Mosbaugh, 1988; Winters & Williams, 1990; Focher et al., 1993). To characterize the biochemical and biophysical properties and to investigate the possibility of developing anti-HHV-6 agents, it will be necessary to overproduce and purify this enzyme and to develop a method of enzyme assay that has higher sensitivity. The D N A sequence data and the enzyme activities expressed in E. coli described in this communication will be helpful in further studies. References ABLASHI, D.V., BALACHANDRAN,N., JOSEPHS, S.F., HUNG, C.L., KRUEGER, G. R. F., KRAMARSKY,B., SALAHUDDIN,S. Z. & GALLO, R.C. (1991). Genomic polymorphism, growth properties, and immunologic variations in human herpesvirus-6 isolates. Virology 184, 545-552. ABLASHI, D. V., AGUT, H., BERNEMAN,Z., CAMPADELLI-FIUME,G., CARRIGAN, D., CECCERINI-NELLI, L., CHANDRAN, B., CHOU, S., COLLANDRE,H., CONE, R., DAMBAUGH,Z., DEWHURST,S., DILUCA, D., FOA-TOMASI, L., FRENJEL, N., GALLO, R., GOMPELS, U.A., 2353 HALL, C. B., JONES,M., LAWRENCE,G., MARTIN,M., MONTAGNIER, L., NICHOLAS, J., PELLETT, P.E., RAZZAQUE, A., TORRELLI, G., THOMSON,B. J., SALAHUDDIN,S. Z., WYATT, L. S. • YAMANISHI,K. (1993). Human herpesvirus-6 strain groups: a nomenclature. Archives of Virology 129, 363-366. AMANN, E., OCHS, B. & ABEL, K.J. (1988). Tightly regulated t a c promoter vectors useful for the expression of unfused and fused proteins in Escherichia coil Gene 69, 301 315. AUBIN,J., COLL~NDRE,H., CANDOTTI,D., INGRAND,D., RouzIoux, C., BURGARD,M., RICHARD,S., HURAUX,J. & AGUT, H. (1991). Several groups among human herpesvirus 6 strains can be distinguished by Southern blotting and polymerase chain reaction. Journal of Clinical Microbiology 29, 367-372. AUBIN, J.-T., AGUT, H., COLLANDRE,H., YAMANISHI,K., CHANDRAN, B., MONTAGNIER,L. & HURAUX,J.-M. (1993). Antigenic and genetic differentiation of the two putative types of human herpesvirus 6. Journal of" Virological Methods 41,223-234. BAER, R., BANKIER,A. T., BIGGIN, M. D., DEININGER,P. L., FARRELL, P. J., GIBSON,T. J., HATFULL,G., HUDSON,G. S., SATCHWELL,S. C., SfiGUIN,C., TUFFNELL,P. S. & BARRELL,B. G. (1984). DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature, London 310, 207~211. CARADONNA, S. & CHENG, Y.-C (1980). Uracil-DNA glycosylase: purification and properties of this enzyme isolated from blast cells of acute myelocytic leukemia patients. Journal of Biological Chemistry 255, 2293-2300. CARADONNA, S., WORRAD, D. & LmExXE, R. (1987). Isolation of a herpes simplex virus cDNA encoding the D N A repair enzyme uracil DNA glycosylase. Journal of Virology 61,304(~3047. CHANDRAN, B., TIRAWATNAPONG,S., PFEIFFER,B. & ABLASHI,D. V. (1992). Antigenic relationships among human herpesvirus-6 isolations. Journal of Medical Virology 37, 247-254. CHEE, M. S., BANKIER, A.T., BECK, S., BOHNI, R., BROWN, C. M., fERNY, R., HORSNELL,T., HUTCHISON,C. A., III, KOUZARIDES,T,, MARTIGNETTI,J. A., PREDDIE,E., SATCHWELL,S. C., TOMLINSON,P., WESTON, K. M. & BARRELL,B. G. (1990). Analysis of the protein coding content of the sequence of human cytomegalovirus strain AD169. Current Topics in Microbiology and Immunology 154, 125-169. DAVISON,A. J. & SCOTT,J. E. (1986). The complete DNA sequence of varicella-zoster virus. Journal of General Virology 67, 1759 1816. DAVlSON, A.J. & TAYLOR, P. (1987). Genetic relations between varicella-zoster virus and Epstei~Barr virus. Journal of General Virology 68, 1067-1079. DUNCAN, B.K. & CHAMBERS,J.A. (1984). The cloning and overproduction of Escherichia coli uracil-DNA glycosylase. Gene 28, 211-219. EFSTATHIOU,S., LAWRENCE,G. L., BROWN, C. M. & BARRELL,B. G. (1992). Identification of homologues to the human cytomegalovirus US22 gene family in human herpesvirus 6. Journal of General Virology 73, 1661-1671. FOCHER, F., MAZZARELLO,P., VERR1,A., HUBSCHER,U. & SPADARI,S. (1990). Activity profiles of enzymes that control the uracil incorporation into DNA during neuronal development. Mutation Research 237, 65-73. FOCHER, F., VERRI, A., SPADARI,S., MANSERVIG1,R., GAMBINO,J. & WRIGHT, G. E. (1993). Herpes simplex virus type 1 uracit-DNA glycosylase: isolation and selective inhibition by novel uracil derivatives. Biochemical Journal 292, 883-889. GOMPELS, U. A., CARRIGAN,D. C., CARSS,A. L. &. ARNO, J. (1993). Two groups of human herpesvirus 6 identified by sequence analysis of laboratory strains and variants from Hodgkin's lymphoma and bone marrow transplant patients. Journal of General Virology 74, 613-622. HANAHAN,D. (1985). Techniques for transformation of E. coli. DNA Cloning 1, 109-136. HIGGINS, D. G., BLEASBY,A.J. & FUCHS, R. (1992). CLUSTAL V: improved software for multiple sequence alignment. CABIOS 8, 189-191. JOSEVHS, S. F., SALAHUDDIN,S.Z., ABLASHI, D. V., SCHACHTER,F., WONG-STAAL, F. & GALLO, R. C. (1986). Genomic analyses of the human B lymphotropic virus. Science 234, 601-603. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 12:06:52 2354 S. Sato and others JOSEPHS,S. F., ABLASHI,D. V., SALAHUDDIN,S. Z., JAGODZINSKI,L. L., WONG-STAAL,F. & GALLO,R. C. (1992). Identification of the human herpesvirus 6 glycoprotein H and putative long tegument protein genes. Journal of Virology 65, 5597-5604. KONDO, K., KONDO,T., OKUNO,T., TAKAHASHI,M. & YAMANISHI,K. (1991). Latent human herpesvirus 6 infection of human monocytes/ macrophages. Journal of General Virology 72, 1401-1408. KONDO, K., NAGAFUJI,H., HATA, A., TOMOMORI,C. 8~ YAMANISI,K. (1993). Association of human herpesvirus 6 infection of the central nervous system with recurrence of febrile convulsions. Journal of Infectious Diseases 167, 1197-1200. KOZAK, M. (1989). The scanning model for translation: an update. Journal of Cell Biology 108, 229-241. KUNKEL, T. A., ROBERTS,J. D. & ZAKOUR, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods. in Enzymology 154, 367-382. LAWRENCE, G.L., CHEE, M., CRAXTON, M.A., GOMPELS, U.A., HONESS, R. W. & BARRELL,B. G. (1990). Human herpesvirus 6 is closely related to human cytomegalovirus. Journal of Virology 64, 287-299. LINDAHL, T. (1974). An N-glycosidase from Escherichia coli that releases free uracil from DNA containing deaminated cytosine residues. Proceedings of the National Academy of Sciences, U.S.A. 71, 3649-3653. LIU, D.X., GOMPELS, U.A., NICHOLAS, J. & LELLIOTT, C. (1993). Identification and expression of the human herpesvirus 6 glycoprotein H and interaction with an accessory 40K glycoprotein. Journal of General Virology 74, 1847-1857. Lusso, P., MARKHAM,P. D., TSCHACHLER,E., DI MARCOVERONESE,F., SALAHUDDIN, S.Z., ABLASHI, D.V., PAHWA, S., GROHN, K. & GALLO, R. C. (1988). In vitro cellular tropism of human B-lymphotropic virus (human herpesvirus-6). Journalof Experimental Medicine 167, 1659-1670. McGEocH, D.J., DALRYMPLE, M.A., DAVISON, A.J., DOLAN, A., FRAME, M. C., MCNAB, D., PERRY, L. J., SCOTT,J. E. & TAYLOR,P. (1988). the complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. Journal of General Virology 69, 1531 1574. McGEOCH, D.J., CtmNINGHAM, C., MCINTYRE, G. & DOLAN, A. (1991). Comparative sequence analysis of the long repeat regions and adjoining parts of the long unique regions in the genomes of herpes simplex viruses types 1 and 2. Journal of General Virology 72, 3057 3075. MARTIN, J. H., DOHNER, D. E., WELLINGHOFF,W. J. & GELB, L. D. (1982). Restriction endonuclease analysis of varicella-zoster vaccine virus and wild type DNAs. Journal of Medical Virology 9, 69-76. MUELANEY,J., MOSS, H. W. MCL & MCGEOCH, D. J. (1989). Gene UL2 of herpes simplex virus type 1 encodes a uracil-DNA glycosylase. Journal of General Virology 70, 449-454. NEIPEL, F., ELLINGER, K. & FLECKENSTEIN, B. (1991). The unique region of the human herpesvirus 6 genome is essentially collinear with the U L segment of human cytomegalovirus. Journal of General Virology 72, 2293 2297. OLSEN, L.C., AASLAND, R., WITTWER, C.U., KROKEN, H.E. & HELLAND, D. E. (1989). Molecular cloning of human uracil-DNA glycosylase, a highly conserved DNA repair enzyme. EMBO Journal 8, 3121 3125. PERCIVAL,K. J., KLEIN, M. B. ~,z BURGERS,P. M. J. (1989). Molecular cloning and primary structure of uracil-DNA-glycosylase gene from Saccharomyces cerevisiae. Journal of Biological Chemistry 264, 2593 2598. PERRY, L. J. & McGEOCH, D. J. (1988). The DNA sequences of the long repeat region and adjoining parts of the long unique region in the genome of herpes simplex virus type 1. Journal of General Virology 69, 2831-2846. SALAHUDDIN,S. Z., ABLASHI,D. V., MARKHAM,P. D., JOSEPHS,S. F., STURZENEGGER, S., KAPLAN, M., HALLIGAN, G., BIBERFELD, P., WONG-STAAL,F., KRAMARSKY,B. & GALLO, R. C. (1986). Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 234, 596-601. SANGER, F., NICKLEN, S. & COVLSON,A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, U.S.A. 74, 5463-5467. SCHIRMER, E. C., WYATT, L. S., YAMANISHI,K., RODRIGUEZ,W. J. & FRENKEL, N. (1991). Differentiation between two distinct classes of viruses now classified as human herpesvirus 6. Proceedings of the National Academy of Sciences, U.S.A. 88, 5966-5926. SHIRAKI, K., OKrrNO, T., YAMANISHI,K. & TAKAHASHI,M. (1989). Phosphonoacetic acid inhibits replication of human herpes virus-6. Antiviral Research 12, 311-318. TAKAHASHI,K., SONODA,S., HIGASHI,K., KONDO,T., TAKAHASHI,H., TAKAHASHI, M. & YAMANISm, K. (1989). Predominant CD4 T lymphocyte tropism of human herpesvirus 6-related virus. Journal of Virology 63, 3161-3164. TELFORD, E. A. R., WATSON, M. S., McBRIDE, K. & DAVISON,A. J. (1992). The DNA sequence of equine herpesvirus-1. Virology 189, 304-316. TEO, I. A., GRIFFIN, B. Y. & JONES, M. D. (1991). Characterization of the DNA polymerase gene of human herpesvirus 6. Journal of Virology 65, 4670M680. VARSHNEY,U., HUTCHEON,T. & VANDE SANDE,J, H. (1988). Sequence analysis, expression, and conservation of Escherichia coli uracilDNA glycosylase and its gene (ung). Journal of Biological Chemistry 263, 7776-7784. WANG, Z. & MOSBAUGH, D.W. (1988). Uracil DNA glycosylase inhibition of bacteriophage PBS2: cloning and effects of expression of the inhibitor gene in Escherichia coli. Journal of Bacteriology 170, 1082 1091. WILLIAMS, M. V., ABLASHI,D. V., SALAHUDDIN,S. Z. (~; GLASER, R. (1989). Demonstration of the human herpesvirus 6-induced DNA polymerase and DNase. Virology 173, 223-230. WINTERS, T.A. & WILLIAMS, M.V. (1990). Use of the PBS2 uracil-DNA glycosylase inhibitor to differentiate the uracil-DNA glycosylase activities encoded by herpes simplex virus type 1 and 2. Journal of Virological Methods 29, 233-242. WORRAD,D. M. & CARADONNA,S. (1988). Identification of the coding sequence for herpes simplex virus uracil-DNA glycosylase. Journal of Virology 62, 4774-4777~ WYATT,L. S., BALACHANDRAN,N. 8z FRENKEL,N. (1990). Variations in the replication and antigenic properties of human herpesvirus 6 strains. Journal oflnfectious Diseases 162, 852 857. YAMAMOTO, T., MUKAt, T., KONDO, K. & YAMANISHt, K. (1994). Variation of DNA sequence in immediate-early gene of human herpesvirus 6 and variant identification by PCR. Journal of Clinical Microbiology 32, 473-476. YAMANISHI,K., OKUNO,T., SmRAKL K., T~,KAHASHLM., KONDO,T., ASANO, Y. & Kt~RATA, T. (1988). Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet i, 1065-1067. YAMSCH-PERRON,C., VIEIRA,J. & MESSING,J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the Ml3mpl8 and pUC19 vectors. Gene 33, 103-119. (Received 4 January 1994; Accepted 18 April 1994) Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sun, 18 Jun 2017 12:06:52