Download Targeting green fluorescent protein to dendritic membrane in central

Available online at www.sciencedirect.com
Neuroscience Research 61 (2008) 79–91
www.elsevier.com/locate/neures
Targeting green fluorescent protein to dendritic membrane
in central neurons
Hiroshi Kameda a,1, Takahiro Furuta a,1, Wakoto Matsuda a,2, Koji Ohira a,
Kouichi Nakamura a,b, Hiroyuki Hioki a, Takeshi Kaneko a,b,*
b
a
Department of Morphological Brain Science, Graduate School of Medicine, Kyoto University, Kyoto 606-8501, Japan
Core Research for Evolutionary Science and Technology, Japan Science and Technology Agency, Kawaguchi 332-0012, Japan
Received 22 November 2007; accepted 21 January 2008
Available online 6 February 2008
Abstract
Dendritic and axonal processes are input and output sites, respectively, of neuronal information, and detailed visualization of these processes
may be indispensable for elucidating the neuronal circuits and revealing the principles of neuronal functions. To establish a method for
completely visualizing dendritic processes, we first developed green fluorescent protein (GFP)-based proteins and, by using lentivirus with a
neuron-specific promoter, examined whether or not the protein fully visualized the dendritic processes of infected neurons. When GFP with a
palmitoylation (palGFP) or myristoylation/palmitoylation site (myrGFP) was expressed in rat brain with lentiviruses, myrGFP labeled dendritic
membrane better than palGFP. Subsequently, dendrite-targeting efficiencies of three basolateral membrane-sorting and three putative dendritetargeting domains, which were attached to myrGFP C-terminus, were examined in striatonigral GABAergic and corticothalamic glutamatergic
neurons, and in cultured cortical neurons. Of the six domains, C-terminal cytoplasmic domain of low density lipoprotein receptor (LDLRCT) was
most efficient in targeting the protein to dendrites, showing 8.5–15-fold higher efficiency in striatonigral neurons compared with myrGFP.
Finally, dendritic membrane-targeting potency of myrGFP-LDLRCT was confirmed in transgenic mice using Thy1 or Gad1 expression cassette.
Thus, myrGFP-LDLRCT is an excellent synthetic protein for dendritic visualization, and may be a useful tool for the morphological analysis of
neuronal circuits.
# 2008 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.
Keywords: Targeting signal; Dendrite; Low density lipoprotein receptor; Myristoylation; Palmitoylation; Lentivirus
1. Introduction
Since dendrites and axons of neurons are input and output
sites, respectively, of information, detailed visualization of
these processes and their connections may be indispensable for
elucidating the basic design of neuronal circuits and thereby
revealing the principles of neuronal functions. There are several
methods for visualizing the axons of a functional group of
* Corresponding author at: Department of Morphological Brain Science,
Graduate School of Medicine, Kyoto University, Kyoto 606-8501, Japan.
Tel.: +81 75 753 4331; fax. +81 75 753 4340.
E-mail address: [email protected] (T. Kaneko).
1
These authors equally contributed to this work.
2
Present address: Division of Anatomy and Cell Biology, Department of
Anatomy, Shiga University of Medical Science, Tsukinowa-cho, Seta, Otsu,
Shiga 520-2192, Japan.
neurons, such as immunocytochemical staining. For example,
parvalbumin and somatostatin are selectively produced by
different subsets of GABAergic interneurons in the cerebral
cortex, and their immunoreactivities are observed not only in
cell bodies but also in axon fibers and terminals (BennettClarke et al., 1980; DeFelipe et al., 1989; van Brederode et al.,
1991). By contrast, the distal portions of dendrites or dendritic
spines are not visualized well in immunocytochemistry with a
few exceptions such as immunoreactivities for NK1 receptor
(NK1R) (Nakaya et al., 1994) and telencephalin (TLC) (Mitsui
et al., 2005). Only the old method of Golgi stain and
intracellular staining technique completely visualizes dendritic
processes of CNS neurons. However, the Golgi method allows
us to label neurons only in a non-selective manner, and the
intracellular staining technique is usually applied for labeling
of a small number of neurons and unsuitable for entire
visualization of a functional group of neurons. Thus, a novel
0168-0102/$ – see front matter # 2008 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.
doi:10.1016/j.neures.2008.01.014
80
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
Fig. 1. The effect of fatty acylation sites. (A, B) The constructs of lentiviral vectors with human synapsin I promoter (SYN). Lentiviral vectors expressing GFP,
palGFP and myrGFP under the control of human synapsin I promoter were injected into the caudate-putamen (C–E’) and cerebral cortex (F–J). Intensity of GFP
immunolabeling in somatodendritic portion of infected striatal and cortical neurons was in the order of myrGFP, GFP and palGFP. Dendritic spines of striatal neurons
were most clearly labeled with myrGFP (C’–E’). Confocal laser-scannning microscopic images of GFP-immunoreactive apical dendritic tufts labeled by the avidinbiotin immunofluorescence method were compared between GFP- (I, K–M) and myrGFP-labeled pyramidal cells (J, N–P). The images were taken as a z-stack with
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
method for fully visualizing the dendrites of a functional
neuron group has long been desired in the field of neuroscience.
Recently, gene-technological devices such as viral vectors,
which introduce a gene for enhanced green fluorescent protein
(GFP) attached with a plasma membrane-targeting signal, have
been developed for labeling of axonal and dendritic contours
(Moriyoshi et al., 1996; Tamamaki et al., 2000; Furuta et al.,
2001). If a more sensitive and selective tool for labeling
dendrites in a Golgi-stain-like manner is developed, the input
sites of a functional neuron group can be visualized by
combining the tool with techniques generating transgenic
animals. Here we first re-examined GFPs with a plasma
membrane-targeting signal by using replication-deficient
lentivirus with a neuron-specific promoter (Hioki et al.,
2007). Lentiviral vectors were used because genes delivered
by lentivirus are incorporated into host genome, and thereby the
vector might be a good precursory test system for gene
expression in transgenic animals. Second, dendritic membranetargeted GFP was developed by fusing the plasma membranetargeted GFP with basolateral sorting signals of polarized
epithelial cells and putative dendrite-targeting signals of
neurons. We finally applied GFP fused with the best dendritic
membrane-targeting signal to transgenic animal generation and
succeeded in entirely visualizing the dendrites of a neuron
group determined by gene expression.
2. Materials and methods
The experiments were conducted in accordance with the Committee for
Animal Care and Use of the Graduate School of Medicine at Kyoto University
and that for Recombinant DNA Study in Kyoto University. All efforts were
made to minimize animal suffering and the number of animals used.
2.1. Generation of lentiviral vectors
The lentiviral vectors with human synapsin I promoter (SYN) for expressions
of myristoylation/palmitoylation site-attached GFP (myrGFP) and palmitoylation
site-attached GFP (palGFP) were produced as reported previously (Fig. 1A; Hioki
et al., 2007). Briefly, oligonucleotide set OF1/OR1 (see Supplemental table)
encoding the myristoylation/palmitoylation site of Fyn N-terminus [1–15] was
annealed to form double-stranded DNA, inserted into the SmaI site of pEGFP-N3
(BD Bioscience Clonetech, Palo Alto, CA), and the myrGFP DNA fragment was
amplified by polymerase chain reaction (PCR) with primer set PF2/PR4. The
DNA fragment encoding palGFP was amplified from pSinRep5-palGFP (Furuta
et al., 2001) with primer set PF3/PR4. After PCR amplification, SYN (primer set
PF6/PR6; 1889–2289 of gb: M55301; Hioki et al., 2007), myrGFP or palGFP, and
woodchuck hepatitis virus posttranscriptional regulatory element (WPRE; primer
set PF7/PR7; nucleotides 1093–1684 of gb: U57609; obtained from a plasmid
gifted generously by Dr. Hope, Northwestern University, Chicago, IL; Zufferey
et al., 1999) were inserted into the HincII, EcoRVand SmaI sites of pBluescript II
SK (+) (pBSII; Stratagene, La Jolla, CA), respectively. These two constructs were
confirmed by sequencing and named as pBSII-SYN-MTS-GFP-WPRE, where
MTS = myr or pal.
81
When putative dendrite-targeting signals were fused to the C-terminus of
myrGFP, myrGFP DNA fragment was amplified with primer set PF2/PR5 to
remove the terminal codon and introduce PmaCI site, and inserted at EcoRV site
of pBSII, resulting in pBSII-myrGFP’. DNAs encoding C-terminal cytoplasmic
domains (CT) of low density lipoprotein receptor (LDLR; amino acid residues
813–862 in gb: AF425607; obtained from mouse spleen cDNA), immunoglobulin Fcg receptor IIb (FcR; 237–283 in pir:B40071; from mouse spleen),
polymeric immunoglobulin receptor (pIgR; 669–771 in gb:U06431; from
mouse spleen), TLC (859–917 in gb:U06483; from mouse brain), NK1R
(312–407 in gb:J05097; from rat brain) and Delta/Notch-like epidermal growth
factor-related receptor (DNER; 665–737 in gb:AY032924; from mouse cDNA
gifted generously by Dr. Kengaku, RIKEN Brain Science Institute, Japan;
Eiraku et al., 2002) were amplified with PF8–13/PR8–13, respectively, and
inserted into the PmaCI site of pBSII-myrGFP’, resulting in pBSII-myrGFPDTS, where DTS = LDLRCT, FcRCT, pIgRCT, TLCCT, NK1RCT or DNERCT
(Fig. 1B). Finally, myrGFP-DTS fragments were amplified with primer sets
PF2/PR8–13, and inserted with SYN and WPRE into pBSII as described above,
resulting in pBSII-SYN-myrGFP-DTS-WPRE. Eight pBSII-based plasmids
were digested at KpnI and NotI sites, and the fragments were inserted into
KpnI/NotI sites of entry vector pENTR1A (Invitrogen, Carlsbad, CA). The
inserts were transferred to the destination vector pLenti6/Block-iT-DEST by
homologous recombination with LR clonase (Invitrogen), resulting in pLenti6SYN-MTS-GFP-WPRE or pLenti6-SYN-myrGFP-DTS-WPRE. These destination plasmids were cotransfected with the mixture of packaging plasmids
pLP1, pLP2, and pLP/VSVG into the 293FT producer cell line, using Lipofectamine 2000 (ViraPower Lentiviral Expression System; Invitrogen). The
medium was replaced 8 h after transfection with Dulbecco’s modified Eagle’s
medium containing 10% (v/v) fetal bovine serum. Sixty hours after the
transfection, viral particles in the culture supernatant were collected and
concentrated with Centricon Plus-20 (Millipore). Viral titers were determined
by transduction of 293FT cells with serial dilutions of the viral solution and
colony counting after blasticidin selection, and were adjusted to 1.0 106
transducing units (TU)/ml. The virus solution was stored in aliquots at 80 8C
until use. This vesicular stomatitis virus G protein-pseudotyped lentivirus was
replication deficient and had the least change for production of parent viral
particles in the infected cells.
2.2. Generation of transgenic mice
To confirm the in vivo dendrite-targeting activity of LDLRCT, we generated
two kinds of transgenic mice producing myrGFP fused with LDLRCT (myrGFPLDLRCT) under the control of Thy1 (Caroni, 1997; Feng et al., 2000) and Gad1
expression cassettes (Oliva et al., 2000). The myrGFP-LDLRCT fragment was
amplified by PCR with primer set PF14/PR14 (see Supplemental table), and
inserted into XhoI site of Thy1 cassette (a generous gift from Dr. Caroni,
Friedrich Miescher Institute, Switzerland), resulting in pThy1-myrGFPLDLRCT-pA (Fig. 6A). A 2.8 kb fragment of Gad1 gene (7310–10105 of gb:
AB006974) and late polyadenylation (pA) signal of simian virus 40 were
amplified with primer sets PF15/PR15 and PF16/PR16, respectively. The PCR
products were inserted into the KpnI/ClaI sites and SpeI/NotI sites of pENTR1A-SYN-myrGFP-LDLRCT-WPRE, resulting in pENTR1A-Gad1-myrGFPLDLRCT-WPRE-pA (Fig. 6B). Then, pThy1-myrGFP-LDLRCT-pA and pENTR1A-Gad1-myrGFP-LDLRCT-WPRE-pA were linearized with EcoRI/PvuI
and KpnI/XhoI, respectively. The linearized fragments were purified from
1% SeaKem GTG agarose gel (FMC Bioproducts, Rockland, ME) with
Geneclean II Kit (BIO101, La Jolla, CA), microinjected to fertilized BDF1
mouse eggs, and reimplanted into pseudopregrant ICR females. F0 male mice
were processed for the morphological analysis 8 weeks after birth in the present
study.
the optical slice thickness of 81 nm (pinhole corresponding to 1 Airy unit), using a 63 objective lens (HCX PL APO, NA = 1.40, Leica), and the z-stack was
deconvolved with software Huygens Essential (Scientific Volume Imaging, Hilversum, The Netherlands). Images I and J were chosen from z-stacks at the depths
where the spines traversed by lines ab and cd, respectively, were the maximum in size. The lower right graphs in I and J and lower graphs in K–P are fluorescence
intensity plots along the lines. Only one peak was seen in I and K–M, whereas two peaks were constantly observed in J and N–P, suggesting myrGFP was concentrated
just beneath the plasma membrane of the spine. Arrowheads in J indicate the two walls of a dendritic shaft in the optical section, also indicating myrGFP was
concentrated at the membrane. DTS, dendrite-targeting signal; LTR, long terminal repeat of lentivirus; MTS, membrane-targeting signal; RRE, rev responsive
element; WPRE, woodchuck hepatitis virus posttranscriptional regulatory element; c, packaging signal. Bar in E applies to C–E, that in E’ to C’–E’, that in H to F–H,
that in J to I, J, and that in P to K–P.
82
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
Fig. 2. The effect of addition of basolateral sorting signals (LDLRCT, FcRCT and pIgRCT), and putative dendrite-targeting signals (TLCCT, NK1RCT and DNERCT) to
myrGFP. The lentiviral vectors were injected into the caudate-putamen (CPu; A1–G1), and the brains were immunocytochemically examined with anti-GFP antibody
after 7 days survival. Except for myrGFP-DNERCT, dendritic spines of striatal neurons in the injection sites were clearly labeled with expressed proteins (A2–F2).
Arrowheads in A2–F2 indicate axon collateral fibers. In the external segment of the globus pallidus (GPe) and substantia nigra (SN), anterogradely transported GFP
immunoreactivity was observed clearly except for myrGFP-LDLRCT and myrGFP-DNERCT (arrowheads in A3, C3–F3, A4, C4–F4). With myrGFP-LDLRCT virus,
very weak GFP immunoreactivity was observed in the GPe (arrowheads in B3), but no immunoreactivity was found in the SN (B4). Small arrows in C3 and F3 indicate
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
2.3. Injection of lentiviral vectors and fixation
Forty-six adult male Wistar rats (250–300 g; SLC, Shizuoka, Japan) were
deeply anesthetized with chloral hydrate (35 mg/100 g body weight). Lentivirus
(1.0 ml of 1.0 106 TU/ml) was stereotaxically injected by pressure through a
glass micropipette attached to Picospritzer III (General Valve Corporation, East
Hanover, NJ) into the rat caudate-putamen (CPu) and primary somatosensory
cortex. The rats were allowed to survive for 7–28 days.
The virus-injected rats or the transgenic mice were deeply anesthetized with
chloral hydrate (70 mg/100 g body weight), and perfused transcardially with
200 or 20 ml, respectively, of 5 mM phosphate-buffered 0.9% (w/v) saline
(PBS; pH 7.4), followed by perfusion for 30 min with the same volume of 3%
(w/v) formaldehyde, 75%-saturated picric acid and 0.1 M Na2HPO4 (adjusted
to pH 7.0 with NaOH). The brains were removed, cut into several blocks and
post-fixed for 8 h at 4 8C with the same fixative above. After cryoprotection with
30% (w/w) sucrose in PBS, the blocks were cut into 40-mm-thick frontal
sections on a freezing microtome.
2.4. Primary cultures of cortical neurons
Primary cultures of cortical neurons were prepared from embryonic day
16.5 Wistar rat embryos by modifying the method of Sahara and Westbrook
(1993). The cortices were cut into 1-mm-thick slices, and dissociated by gentle
trituration with Pasteur pipettes. Dissociated cells were plated at 40,000 cells/
well of 12-well dish on cover glasses (ø18 mm, Fisher Scientific, Pittsburgh,
PA) coated with poly-L-lysine (Sigma, St. Louis, MO), and incubated at 37 8C
with 5% CO2 gas in the culture medium containing DMEM (Invitrogen), 0.6%
(w/v) glucose, 10% (v/v) heat-inactivated fetal bovine serum, 10 U/ml penicillin and 15 mg/ml streptomycin (Invitrogen). Cytosine-b-D-arabinofuranoside
(10 mM; Sigma) was added at 1 day in vitro after plating to suppress cell
proliferation, and the cells were infected with the lentiviral vectors 3 days after
plating, followed by a half exchange of the medium every 3 days. Seven days
after the virus infection, the cells were fixed for 30 min at room temperature
with 4% (w/v) formaldehyde in 0.1 M PB (pH 7.2), and then incubated for 1 h
with the PBS containing 10% (v/v) normal donkey serum, 1% (w/v) bovine
serum albumin and 0.2% (v/v) Triton X-100.
2.5. Immunofluorescence visualization
The brain sections of lentivirus-injected rats and trangenic mice were
single-labeled for GFP immunofluorescence by (1) the indirect immunofluorescence or (2) the avidin-biotin immunofluorescence methods. Briefly, sections were incubated overnight with 1 mg/ml affinity-purified anti-GFP rabbit
antibody (Tamamaki et al., 2000). (1) Some sections were further incubated for
1 h with 5 mg/ml AlexaFluor (AF) 488-conjugated anti-rabbit IgG goat antibody (Molecular Probes, Eugene, OR). (2) The other sections were incubated
for 1 h with 10 mg/ml biotinylated anti-rabbit IgG goat antibody (Vector
Laboratories, Burlingame, CA), and then for 1 h with 2 mg/ml AF488- or
AF594-conjugated streptavidin (Molecular Probes). When the sections were
double-labeled for GFP and microtubule-associated protein 2 (MAP2), they
were incubated overnight with 1 mg/ml anti-GFP guinea pig antibody (Tamamaki et al., 2000) and 1/200-diluted anti-MAP2 rabbit immunoglobulin (Santa
Cruz Biotechnology, Santa Cruz, CA), and then for 1 h with 10 mg/ml
biotinylated anti-rabbit IgG goat antibody (Vector Laboratories). These sections were further incubated for 1 h with 2 mg/ml AF488-conjugated streptavidin and 5 mg/ml AF594-conjugated anti-guinea pig IgG goat antibody
(Molecular Probes) in the presence of 10% (v/v) normal rabbit serum. All
the incubations were carried out at room temperature in PBS containing 0.3%
(v/v) Triton X-100, 0.25% (w/v) l-carrageenan and 1% (v/v) donkey serum
(PBS-XCD), and followed by a rinse with PBS containing 0.3% (v/v) Triton X100 (PBS-X). The sections were mounted onto gelatinized glass slides and
coverslipped with 90% (v/v) glycerol and 2.5% (w/v) triethylene diamine in
20 mM Tris–HCl, pH 7.4.
83
The cultured cells were incubated in PBS-XCD for 1 h at room temperature
with a mixture of 1 mg/ml anti-GFP rabbit antibody and 5 mg/ml anti-tau protein
mouse IgG2a (clone Tau-1 [PC1C6]; Chemicon, Temecula, CA), or a mixture of
1 mg/ml affinity-purified anti-GFP guinea pig antibody (Tamamaki et al., 2000)
and 1/200-diluted anti-MAP2 rabbit immunoglobulin (Chemicon). After a rinse
with PBS, the cells were incubated for 1 h with a mixture of AF488-conjugated
anti-rabbit IgG goat antibody and AF594-conjugated anti-mouse IgG goat antibody (Molecular Probes), or a mixture of AF488-conjugated anti-guinea pig IgG
goat antibody and AF594-conjugated anti-rabbit IgG goat antibody (Molecular
Probes) at the concentration of 10 mg/ml for each secondary antibody. After a
rinse with PBS, the cover glasses with stained cells were mounted on the glass
slides with Permafluor (Beckman Coulter, Fullerton, CA).
The samples labeled for immunofluorescence were examined under fluorescence microscope Axiophot (Carl Zeiss, Oberkochen, Germany) with appropriate filter sets (450–490-nm excitation and 514–565-nm emission for AF488;
530–585-nm excitation and 615-nm emission for AF594). The digital images
with the fluorescence microscope were captured with digital camera QICAM
(QIMAGING, Burnaby, BC, Canada), and modified (20% contrast enhancement) in graphic software Canvas X (ACD Systems, Saanichton, BC, Canada)
and saved as 8-bit TIFF files. Furthermore, the samples were examined under
confocal laser-scanning microscope TCS SP2 (Leica, Wetzlar, Germany) with
488-nm and 594-nm laser beams and 510–530-nm and 615–700-nm emission
prism windows, respectively. The confocal images were taken with the optical
slice thickness of 81 nm (pinhole corresponding to 1 Airy unit), using a 63
objective lens (HCX PL APO, NA = 1.40, Leica). The fluorescnece intensity of
confocal laser-scanning images was measuerd without deconvolution, using
software ImageJ (NIH; http://rsb.info.nih.gov/ij/). For visualization of fine
structure of spines and measurement of morphological parameters, the confocal
images were taken as a z-stack, and the z-stack was deconvolved with software
Huygens Essential (Scientific Volume Imaging, Hilversum, The Netherlands).
The parameters in the 3-dimensinal image was measured using software LSM 5
Image Examiner (Carl Zeiss).
2.6. Immunoperoxidase staining
The brain sections of lentivirus-injected rats and transgenic mice were
incubated overnight with 1 mg/ml anti-GFP rabbit antibody, and then for 2 h
with 60 mg/ml anti-rabbit IgG goat antibody (Cappel, Aurora, OH). The
incubations were carried out at room temperature in PBS-XCD, and followed
by a rinse with PBS-X. The sections were further incubated for 1 h with 50 mg/
ml rabbit peroxidase-anti-peroxidase (Jackson ImmunoResearch Laboratories,
West Grove, PA) in PBS-X. To avoid the immunodetection of endogenous
biotinylated proteins, we adopted this method instead of the avidin-biotinylated
peroxidase complex method. After a rinse with PBS-X, the sections were
reacted for 20–40 min with 0.02% (w/v) diaminobenzidine-4HCl and 0.001%
(v/v) H2O2 in 50 mM Tris–HCl (pH 7.6), mounted onto gelatinized glass slides,
dehydrated in ethanol series, cleared in xylene, and coverslipped. Digital
images were taken by digital camera QICAM through a band-pass filter around
500 nm. For quantitative evaluation of immunoreactivity, the images were taken
at the 8-bit depth under exactly the same condition including the magnification,
light intensity and condenser contraction of the microscope, and gain and offset
of the camera, and saved as TIFF files without any modification. The average
density and area in the region of interest was measured in software ImageJ. For
figure presentation, the captured images were somewhat modified (20%
contrast enhancement) in software Canvas X. Dendritic spine density of striatal
medium-sized spiny neurons was measured with Neurolucida apparatus (MBF
Bioscience, Williston, VT) attached to microscope Vanox (Olympus, Tokyo,
Japan) with a 100 objective lens (SPlan Apo, oil immersion, NA = 1.35;
Olympus). In the rat CPu region injected with the lentiviral vector, intensely
labeled spiny dendrites were randomly selected and the dendritic length was
measured along the dendritic shaft in the stereo image. The locations of
dendritic spines were then plotted along the selected dendrite, and the spine
density was calculated by dividing the number of spines by the dendritic length.
retrogradely labeled GPe neurons, which were more or less found in the adjacent GPe sections of all the injection cases. cp, cerebral peduncle; ic, internal capsule.
Bars in Gn apply to An–Gn, respectively.
84
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
2.7. Statistical analysis
For comparison of two groups of GFP-labeled and myrGFP-labeled neurons, we mainly used two-sided Student’s t-test (Excel, Microsoft Corporation,
Redmond, WA, USA). Multiple comparison between three groups, such as
GFP-, myrGFP- and palGFP-lebeled neurons, was performed by Tukey’s test
(IGOR Pro, WaveMetrics, Lake Oswego, OR). Multiple comparison against a
control data was carried out by Dunnett’s post hoc test after one-way ANOVA
(IGOR Pro).
3. Results
3.1. Plasma membrane-targeting signals
We first re-examined the palmitoylation site of N-terminal
peptide [1–20] of growth-associated protein-43 (GAP-43),
which had been reported to work as a plasma membranetargeting signal with adenovirus and Sindbis virus vectors
expressing the modified GFP (Tamamaki et al., 2000; Furuta
et al., 2001). However, when lentivirus with a neuron-specific
promoter (SYN; Fig. 1A) was used as an expression vector in
rat CPu or cerebral cortex, GFP immunoreactivity in palGFPlabeled neuronal dendrites was much weaker than that in
unmodified GFP-labeled dendrites (Fig. 1C, D, F, G). We did
not find any reason for this result except the fact that the
transgene is incorporated into host genome by lentivirus, but
not by adenovirus or Sindbis virus. Thus, we had to develop
another tool for targeting the protein to plasma membrane, and
found that the myristoylation/palmitoylation site of Fyn Nterminal peptide [1–15] is more effective in labeling of
dendritic plasma membranes (Fig. 1E, H, J). In order to assess
the differences in efficiency of dendritic labeling among these
three proteins, we measured GFP immunofluorescence of 15
dendrites located about 50 mm apart from the cell bodies of
medium-sized spiny striatal neurons visualized by the indirect
fluorescence method. When fluorescence intensity was normalized with that of GFP-labeled dendrites (mean
S.D. = 1.00 0.39), the intensity of myrGFP-labeled
dendrites or that of palGFP-labeled dendrites was
1.76 0.77 or 0.32 0.21, respectively ( p < 0.001 for each
comparison by Tukey’s test).
Furthermore, myrGFP was distributed along the dendritic
membrane; arrowheads in Fig. 1J indicate the two membranes
of a dendritic shaft which was optically sectioned by confocal
laser-scanning microscopy. The two peaks of myrGFP
immunofluorescence intensity were visualized along line cd
that traversed a dendritic spine (Fig. 1J), also indicating
membranous association of myrGFP. In contrast, immunofluorescence intensity for unmodified GFP showed only one
peak at a dendritic spine (line ab in Fig. 1I), reflecting the lack
of association with the membrane. The spines with two peaks of
GFP immunofluorescence intensity were frequently observed
in myrGFP-labeled neurons (5 of 10 spines; Fig. 1N–P), but not
in GFP-labeled ones (0 of 10 spines; Fig. 1 K–M). These results
indicate that myrGFP is more suitable for dendritic membrane
labeling than GFP or palGFP.
In order to examine the effect of myrGFP expression on
dendritic morphology, we measured and compared morpholo-
gical parameters of myrGFP-labeled medium-sized spiny
striatal neurons and those of GFP-labeled ones visualized by
the avidin-biotin immunofluorescence method under the
confocal laser-scanning microscope. The length of spine
necks, the size of spines and the width of dendrites
of randomly selected spines or dendrites (n = 20) for
myrGFP-labeled neurons were 0.93 0.27, 0.54 0.23 and
0.97 0.30 mm, respectively, whereas those of GFP-labeled
ones were 0.94 0.39, 0.53 0.25 and 0.95 0.24 mm,
respectively. No significant difference was found between
the two groups ( p = 0.94, 0.91 and 0.82, respectively, two-sided
Student’s t-test). We also compared the spine density on
dendrites visualized by the immunoperoxidase method between
myrGFP-labeled and GFP-labeled medium-sized spiny neurons
in the CPu. The density was 15.9 2.3 spines /10 mm dendritic
length (mean S.D.) on 20 randomly selected dendrites (13.2–
34.9 mm) for myrGFP-labeled dendrites. This density was not
significantly different ( p = 0.40, two-sided Student’s t-test)
from that of strongly GFP-labeled dendrites (15.3 2.0 /
10 mm, n = 20). Spine density for GFP-labeled neurons was
studied only on strongly labeled dendrites, since it might be
underestimated on weakly labeled dendrites (see Fig. 1C’).
Because no statistically significant difference in several
morphological parameters was detected between myrGFPand GFP-labeled neurons, it was unlikely that myrGFP
expression produced explicit change in dendritic morphology.
3.2. Dendrite-targeting signals
Next we developed six lines of lentiviral vectors, which
expressed myrGFP fused at its C-terminus with LDLRCT,
FcRCT, pIgRCT, TLCCT, NK1RCT or DNERCT (Fig. 1B). The
former three signals for basolateral sorting in polarized
epithelial cells (for review, see Craig and Banker, 1994;
Mellman, 1996; Keller and Simons, 1997; Marks et al., 1997)
were selected because the basolateral membrane of polarized
epithelial cells was reportedly analogous to the neuronal
dendritic membrane (Dotti and Simons, 1990; Jareb and
Banker, 1998). The latter three putative dendrite-targeting
signals were nominated from the neuronal proteins that were
distributed on dendritic membranes in a rather diffuse
manner (Nakaya et al., 1994; Eiraku et al., 2002; Mitsui
et al., 2005). When the six lines of viruses were injected into
the CPu (Fig. 2), myrGFP-LDLRCT was most effective in
dendrite targeting (Fig. 2B1–B4). In the injection site
(Fig. 2B2), many spiny dendrites of striatal neurons were
clearly observed, but few axon collateral fibers were
detected. In contrast, axon collateral fibers were often found
in the injection site of myrGFP lentivirus (arrowheads in
Fig. 2A2). Furthermore, although very weak anterograde
labeling with myrGFP-LDLRCT was noticed in the external
segment of the globus pallidus (GPe; arrowheads in
Fig. 2B3), almost no GFP immunoreactivity was detected
in the substantia nigra (SN; Fig. 2B4), where intense GFP
immunoreactivity was observed with myrGFP lentivirus
injection (Fig. 2A4). Since the GPe and SN were the major
targets of striatal projection neurons, it was concluded that
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
the axonal transport of myrGFP-LDLRCT was much less than
that of myrGFP.
When lentiviral vectors expressing myrGFP-FcRCT,
myrGFP-pIgRCT, myrGFP-TLCCT and myrGFP-NK1RCT were
injected into the CPu, clear GFP immunoreactivity was found
in the SN (Fig. 2C4–F4), and axon collateral fibers were
observed in the injection sites (arrowheads in C2–F2). After
injection of myrGFP-DNERCT lentiviral vector into the CPu,
GFP immunoreactivity in the injection site was weaker than any
other lentiviral vectors (Fig. 2G1) and the dendrites of striatal
neurons were not well labeled (G2). Thus, the addition of
DNERCT was considered to interfere with the production or
intracellular distribution of the protein.
A quantitative evaluation of striatonigral anterograde
labeling with the lentiviral vectors was shown in Fig. 3. Total
immunoreactivity in the SN (Fig. 3B) was divided by that in the
injection site (Fig. 3A), and the quotient was named SN/CPu
immunoreactivity ratio. In the CPu, since approximately the
same number of striatonigral and striatopallidal neurons were
distributed almost randomly and the two groups constitute the
vast majority of neurons (Lee et al., 1997), about a half of GFP
immunoreactivity in the injection sites were expected to be
derived from somatodendritic labeling of infected striatonigral
neurons. Thus SN/CPu immunoreactivity ratio was a good
indicator for axonal labeling of striatonigral neurons. It should,
however, be noted that the labeling of main axons and axon
collaterals in the injection site was included in the denominator
of the ratio, and thereby that true axonal labeling was
underestimated with this ratio when the axons were labeled.
Of the 8 lines of lentiviral vectors, the lowest SN/CPu
immunoreactivity ratio was observed in myrGFP-LDLRCT
virus infection, and the next lowest was in myrGFP-TLCCT
virus infection (Fig. 3C). The SN/CPu immunoreactivity ratio
with myrGFP-LDLRCT virus was 1/15 of that with myrGFP
virus, and the difference was statistically significant
( p = 0.0024; Dunnett’s post hoc test after one-way ANOVA).
Furthermore, SN/CPu immunoreactivity ratio with myrGFPLDLRCT virus was kept low, less than 1/8.5 of that with
myrGFP virus, at any survival time examined (Fig. 3D).
Since the striatonigral and striatopallidal projections were
GABAergic and thus inhibitory, we next tested the dendritetargeting activity of the modified GFPs in the excitatory
glutamatergic system of corticothalamic projection (Fig. 4).
When the injection sites of the viral vectors included layer VI
of the primary somatosensory area, anterograde labeling was
found in the ventrobasal complex and reticular nucleus of the
thalamus except for myrGFP-LDLRCT and myrGFP-DNERCT
(arrowheads in Fig. 4). Since the injection site was very weakly
labeled with myrGFP-DNERCT (Fig. 4G1) even by the
injection of the same titer and volume of virus solution,
suppression of protein synthesis was assumed in cortical
neurons as well as in striatal neurons. This is in contrast to the
result of myrGFP-LDLRCT virus, which labeled cortical
neurons as efficiently as myrGFP virus. In spite of the distinct
labeling of cortical neurons, almost no anterograde axonal
labeling with myrGFP-LDLRCT was detected in the ventrobasal complex or reticular nucleus of the thalamus. Thus,
85
Fig. 3. Quantitative evaluation of anterograde labeling in striatonigral projection. (A, B) Total GFP immunoreactivity in the section of the injection site (A)
or the substantia nigra (SN; B) was measured by subtracting background
density from density in the region of interest and then multiplying the area
(formula written under A and B). The most intensely labeled section and the
adjacent two sections were selected from every 5 immunostained sections, and
immunoreactivities in these sections were added for each site. (C) GFP
immunoreactivity in the SN was further divided by that in the injection site,
and the quotient (SN/CPu immunoreactivity ratio) was compared among
modified GFPs (n = 3 for each bar with S.D.) at 7 days after the injection.
SN/CPu immunoreactivity ratio of myrGFP-LDLRCT showed the lowest
value, which was significantly lower than that of control myrGFP
(**p < 0.01; Dunnett’s post hoc test after one-way ANOVA). (D) SN/CPu
immunoreactivity ratios for myrGFP and myrGFP-LDLRCT were compared 7,
14 and 28 days after the viral injection (n = 3; bars indicate S.D.). The
difference between myrGFP and myrGFP-LDLRCT was highly significant
at each survival time (***p < 0.001; two-sided Student’s t-test).
86
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
Fig. 4. The effect of addition of the basolateral sorting signals and putative dendrite-targeting signals to myrGFP in corticothalamic projection neurons in the primary
somatosensory area (area S1). When the injection sites of the lentiviruses included layer VI of the primary somatosensory area, anterogradely transported GFP
immunoreactivity was found with all the targeting signals except LDLRCT and DNERCT (arrowheads) in the thalamic ventrobasal nuclei (VB) and reticular nucleus
(Rt), which were the target regions of corticothalamic projection. In spite of the distinct labeling of cortical neurons, almost no anterograde axonal labeling with
myrGFP-LDLRCT was detected in the VB or Rt. Thus, LDLRCT worked as a dendrite-targeting signal as efficiently in the corticothalamic projection as in the
striatonigral projection (Fig. 2). Bar in H1 applies to A1–H1, and that in H2 to A2–H2.
LDLRCT worked as a dendrite-targeting signal as efficiently in
the corticothalamic projection as in the striatonigral projection. It was noteworthy that, although TLCCT was the second
best dendrite-targeting signal in striatonigral projection,
FcRCT or pIgRCT seemed to be the second best signal in
corticothalamic projection (Fig. 4E2, C2, D2).
3.3. Dendrite targeting of myrGFP-LDLRCT lentivirus in
cultured neurons
The dendrite-targeting potency of LDLRCT was investigated in the primary culture of cerebral cortical neurons. In
Fig. 5, cortical neurons infected with myrGFP-expressing
lentivirus (Fig. 5A, B) were immunolabeled for MAP2
(Fig. 5A’’) or tau protein (B’’). Although MAP2 and tauprotein immunoreactivities were considered to be markers for
dendrites and axons, respectively, tau-protein immunoreactivity was also found in thick dendrite-like processes (arrows
in Fig. 5B–B’’). Arrowheads in Figs. 5A–B’’ indicate thin
axon-like processes, which were negative for MAP2
(Fig. 5A’’), but positive for tau protein (B’’). This indicates
that not only dendrite-like processes but also axon-like
processes showed GFP immunoreactivity in cultured cortical
neurons expressing myrGFP.
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
87
Fig. 5. myrGFP and myrGFP-LDLRCT expressions in cultured cortical neurons infected with the lentiviral vectors. Infected cortical neurons of 10 days in vitro (A–D)
were immunostained for MAP2 (A’’, C’’) or tau protein (B’’, D’’). Arrows and arrowheads indicate thick dendrite-like and thin axon-like processes of the infected
neurons, respectively. Thin axon-like processes showing tau-protein immunoreactivity emitted from lentivirus-infected neurons were negative for myrGFP-LDLRCT
(D–D’’), but positive for myrGFP (B–B’’). The majority of small GFP-immunoreactive speckles in the background were debris of dead neurons (D). Bar in D’’ applies
to all the figures.
In contrast, only thick dendrite-like processes were
immunoreactive for GFP in myrGFP-LDLRCT-expressing
cultured neurons (arrows in Fig. 5C–D’’). Although tauprotein-immunoreactive thin fibers were emitted from the
infected neurons, the thin fibers did not display GFP
immunoreactivity (arrowheads in Fig. 5D–D’’). This result
indicates that myrGFP-LDLRCT was not distributed in axonlike processes, but only in dendrite-like processes of the
88
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
Fig. 6. Transgenic mice expressing myrGFP-LDLRCT. (A) Thy1 expression cassette for myrGFP-LDLRCT. (B) Gad1 expression cassette for myrGFP-LDLRCT.
Pallidal (GPe) neurons in a F0 mouse with the Thy1/myrGFP-LDLRCT transgene showed clearly detectable fluorescence for GFP (C), and many processes were more
clearly visualized with GFP immunofluorescence by the avidin-biotin method with red AlexaFluor 594 (C’). Furthermore, almost all GFP-positive processes (D)
showed immunoreactivity for MAP2 (D’, D’’), indicating that they were dendritic processes. In contrast, cortical interneurons in a mouse with the Gad1/myrGFPLDLRCT transgene displayed no detectable GFP fluorescence (E), although the cell bodies and dendrites were distinctly labeled for GFP immunofluorescence (E’).
Arrows in C–E’ indicate GFP-positive neuronal cell bodies. When the cerebral cortex (F) and hippocampus (G) of the Gad1/myrGFP-LDLRCT mouse were stained for
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
infected cortical neurons. Thus, these results support the
present in vivo findings on the localization of myrGFP and
myrGFP-LDLRCT in CNS neurons.
3.4. Dendrite targeting of myrGFP-LDLRCT in transgenic
mice
We last looked at the dendrite-targeting potency of myrGFPLDLRCT in transgenic mice with the expression cassettes of
mouse Thy1 (Fig. 6A) and Gad1 genes (Fig. 6B). The Thy1
cassette was used as a strong expression system for
telencephalic neurons (Caroni, 1997; Feng et al., 2000), and
2.8 kb Gad1 cassette, which was a part of gene regulatory
elements for glutamic acid decarboxylase of 67 kDa, was an
expression system for a subgroup of cortical GABAergic
interneurons (Oliva et al., 2000). Eight and nine mouse lines
positive for GFP gene were obtained for Thy1 and Gad1
cassettes, respectively. In a F0 transgenic mouse which strongly
produced myrGFP-LDLRCT in the brain under the control of
Thy1 promoter, native GFP fluorescence was observed under a
fluorescence microscope (Fig. 6C). The GPe was one of the
brain regions showing the strongest fluorescence, and contained
many immunoreactive cell bodies and dendrite-like processes
(Fig. 6C’). Almost all GFP-positive processes were positive for
MAP2 (Fig. 6D–D’’), indicating that they were dendritic
processes. Although native GFP fluorescence was also very
strong in the cerebral cortex, the fine structure was not clearly
determined by the fluorescent microscopy because too many
pyramidal neurons expressed the protein and the cortical
neuropil was almost filled with fluorescent processes. Two F0
mice with Thy1/myrGFP-LDLRCT showed a similar expression
pattern, although their fluorescence was weaker. In contrast, the
cerebral cortex of a F0 transgenic mouse expressing myrGFPLDLRCT under the control of Gad1 promoter showed no
detectable fluorescence for GFP (Fig. 6E), but clear immunoreactivity for GFP (6E’), suggesting that the Gad1 expression
cassette used in the present study was much weaker in protein
production than the Thy1 cassette.
Most immunolabeled neurons in the cerebral neocortex of
the Gad1/myrGFP-LDLRCT transgenic mouse had a shape of
non-pyramidal neurons (Fig. 6E’, F), and most of them emitted
aspiny or sparsely spiny dendrites with intense GFP
immunoreactivity. Although very weakly labeled axon-like
processes were occasionally seen, most processes that were
intensely immunolabeled for GFP appeared to be dendrites in
the brain regions examined. For example, although a
hippocampal neuron in CA1 region emitted strongly labeled
aspiny, somewhat varicose dendrites, no local axon collaterals
were observed in the vicinity of the cell body (Fig. 6G). These
results indicate that the dendritic membrane-targeting signal of
myrGFP-LDLRCT worked in transgenic mouse lines under the
control of not only a strong promoter but also a weak promoter.
89
Thus, the present method for visualization of neuronal dendritic
membrane is considered to be applicable to transgenic animals
which specifically express the exogenous protein under the
control of promoters with natural strength, such as a transgene
obtained from the bacterial artificial chromosome (BAC)
libraries and composed of long gene-regulatory elements of
mammals.
4. Discussion
We have developed a dendritic membrane-targeted GFP by
attaching a fatty acylation site and an epithelial basolateral
sorting signal to GFP. The dendritic membrane-targeting signal
of the modified GFP was proved to work when expressed in
CNS neurons by in vivo or in vitro infection with the lentiviral
vector, and further to function when produced in neurons of
transgenic mice. The latter finding is in contrast to the fact that,
although palGFP showed clear labeling of neuronal plasma
membrane when expressed with adenovirus and Sindbis virus
vectors (Tamamaki et al., 2000; Furuta et al., 2001), palGFP
was little distributed in dendrites when expressed in transgenic
mice (unpublished observation). Thus, the present results have
confirmed that the lentiviral vector, which incorporates
transgenes into the host genome, is a good assessment system
to examine the behavior of the exogenous protein before the
protein is introduced into animals by the transgenic technique.
4.1. Plasma membrane-targeting signals in neurons
There are several strategies to sort the protein to the plasma
membrane by the addition of sorting signals, such as the
transmembrane domain, binding domain to membrane proteins,
fatty acylation site and prenylation site (for review, see Casey,
1995; Resh, 1999). The addition of transmembrane domains
shows a tendency to suppress the expression of the modified
protein (Watanabe et al., 1998; personal communication), and
that of binding domains to plasma membrane proteins may
interfere with the physiological functions of the membrane
proteins. Thus, the addition of fatty acylation or prenylation site
seems to be a better choice for membrane targeting of the
protein, because the covalently bound lipophilic moiety is
simply inserted into the inner leaflet of the plasma membrane.
In the present study, the introduction of prenylation site was not
adopted, because the prenylation site required the C-terminal
portion of the targeted protein and we planned to use the Cterminal portion for the dendrite-targeting signal.
To our knowledge, Moriyoshi et al. (1996) first reported to
target GFP to the plasma membrane of cultured neurons by
adding the N-terminal palmitoylation site of GAP-43 or Cterminal prenylation/palmitoylation site of H-Ras to GFP. We
previously applied in vivo palGFP expression to adult CNS
neurons using adenovirus and Sindbis virus vectors, and
GFP by the immunoperoxidase method, many non-pyramidal neurons showed intense immunoreactivity, and their aspiny or sparsely spiny dendrites were well
visualized. Note that no axon collaterals were detectable in the vicinity of a strongly immunolabeled hippocampal interneuron (G). Ex, exon; IR, immunoreactivity;
O, stratum oriens; P, stratum pyramidale; pA, polyadenylation signal; R, stratum radiatum; WPRE, woodchuck hepatitis virus posttranscriptional regulatory element.
Bar in C’ applies to C–C’, that in D’’ to D–D’’, that in E’ to E, E’.
90
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
succeeded in visualizing neuronal plasma membranes of
dendritic and axonal processes (Tamamaki et al., 2000; Furuta
et al., 2001). In the present study, it was surprising to us that
palGFP expression worked worse in the visualization of
dendritic processes than the expression of unmodified GFP
when the gene was introduced to neurons with lentiviral
vectors. Thus, we searched another candidate to target GFP to
the plasma membrane, and found that the myristoylation/
palmitoylation site of Fyn was a relatively well established
signal which targeted the protein to the plasma membrane
(van’t Hof and Resh, 1997; Wolven et al., 1997; for review, see
Resh, 1999). This was confirmed in the present study, because
the dendritic processes were more clearly visualized by
myrGFP expression than by GFP or palGFP expression.
Recently, a different function from the membrane targeting
was reported on the palmitoylation signal of GAP-43, which
induced spine-related filopodia formation in the dendritic
processes of cultured neurons (Gauthier-Campbell et al., 2004).
If the myristoylation/palmitoylation site of Fyn had a similar
function, it could be a problem in the present project on the
visualization of dendrites. We thus carefully examined the
morphological differences of dendritic processes between
myrGFP-expressing and GFP-expressing neurons, but found no
obvious changes in several morphological parameters including
spine density. Thus, it is unlikely at least in neurons of adult
brain that myrGFP expression induces morphological changes
of dendritic processes.
4.2. Dendrite-targeting determinants of LDLRCT
The present results showed that LDLRCT was the most potent
dendrite-targeting signal of the six C-terminal cytoplasmic
domains examined with the lentiviral vectors. It is here
noticeable that LDLRCT has two basolateral sorting signals,
proximal and distal tyrosine-based determinants, and the
sorting activity is not lost or only partially affected when one of
them is inactivated (Matter et al., 1992, 1994). Interestingly,
pIgR, NK1RCT and DNERCT have only one tyrosine-based
motif, and FcRCT and DNERCT possess only one di-leucine
motif, which is also known to be a basolateral sorting signal (for
review, see Mellman, 1996; Keller and Simons, 1997; Marks
et al., 1997). TLCCT has neither tyrosine-based nor di-leucine
motif, although C-terminal 17 amino acids are essential for the
dendrite targeting (Mitsui et al., 2005). The present results are
compatible with a recent finding that LDLR expressed in
cultured hippocampal neurons with the adenovirus vector was
selectively transported to the dendrites, but against the
observation that pIgR was also selectively sorted to the
dendrites (Jareb and Banker, 1998).
Tyrosine residues in the two determinants of LDLRCT are
important in basolateral sorting, because the mutant LDLR, in
which all the tyrosine residues in the determinants were replaced
with alanines, lost the sorting activity (Matter et al., 1992; Jareb
and Banker, 1998). However, in our preliminary study on
myrGFP attached to the mutant LDLRCT with the same tyrosineto-alanine replacements, SN/CPu immunoreactivity ratio in
striatonigral projection was 0.018 0.013 (n = 4) 7 days after the
injection of myrGFP-[mutant LDLRCT]-expressing lentivirus
into the CPu. This value was 3-fold higher than that with myrGFP[wild LDLRCT] lentiviral vector (0.006 0.006, n = 3 in
Fig. 3C), but 5-fold lower than that with myrGFP vector
(0.087 0.013, n = 3) and also lower than that with the vector
expressing any other GFP-based protein examined in the present
study. This observation suggests that the importance of tyrosine
residues in the two basolateral sorting motifs of LDLR might be
different between different cell types, or probably indicates that
myrGFP-LDLRCT might acquire different sorting characteristics
from wild LDLR. In the present study, six putative dendritetargeting signals were investigated in GABAergic striatofugal
neurons and in glutamatergic corticothalamic neurons. In both the
projection neurons, myrGFP-LDLRCT showed the best dendritetargeting activity, suggesting that this engineered protein would
be targeted to the dendrites in various kinds of neurons. However,
dendrite-targeting potency of the other GFP-based proteins were
different between the two kinds of projection neurons. For
example, TLCCT was the second best dendrite-targeting signal in
the striatonigral neurons, whereas FcRCT or pIgRCT was the
second best signal in the corticothalamic neurons. These results
indicate that the potency of dendrite-targeting signals changes at
least partly in a neuron type-dependent manner.
4.3. Application to transgenic mice for the analysis of
neural circuitry
We tested the dendritic membrane-targeting potency of
myrGFP-LDLRCT in the transgenic mice with Thy1 and Gad1
expression cassettes, and proved that myrGFP-LDLRCT worked
as a dendritic mambrane-labeling tool in these mice. The Thy1
expression cassette was much stronger in protein production
than the Gad1 cassette, because native GFP fluorescence was
observed only in the Thy1/myrGFP-LDLRCT transgenic mice.
This suggests that if strong promoter was used with myrGFPLDLRCT, the fine structure of neuronal dendrites can be
observed in vivo in the brain of transgenic animals by
fluorescence microscopy.
In BAC transgenic mice or knock-in mice using unmodified
GFP, only the cell bodies and proximal dendrites of a functional
neuron group have been visualized (Meyer et al., 2002;
Tamamaki et al., 2003). However, when myrGFP-LDLRCT
expression was combined with a weak promoter like the Gad1
cassette, we could, by the immunocytochemical method,
visualize the neuronal cell bodies and dendrites of the transgenic
animals in a Golgi-stain-like fashion. Thus, even if myrGFPLDLRCT is expressed under a specific gene regulation of natural
strength in BAC transgenic or knock-in mice, the input sites of a
functional neuron group could be visualized completely. This will
promote the morphological analysis of neuronal circuit in the
CNS. For example, we have hitherto been investigating the local
connections from pyramidal neurons to a group of projection
neurons in the cerebral cortex by combining the intracellular
staining technique for pyramidal neurons and Golgi-stain-like
retrograde labeling method for projection neurons (Kaneko et al.,
2000; Cho et al., 2004). By combining the intracellular staining
technique and GFP immunocytochemistry in myrGFP-
H. Kameda et al. / Neuroscience Research 61 (2008) 79–91
LDLRCTCT-expressing transgenic animals, we will be able to
morphologically investigate the local circuit in the CNS.
Acknowledgments
This study was supported by Grants-in-Aid for Scientific
Research 16200025, 17650100, 18700341, 18700342, and
18700343, and Grants-in-Aid for Scientific Research on Priority
Areas 17022020 and 18019017 from The Ministry of Education,
Culture, Sports, Science and Technology (MEXT).
Appendix A. Supplementary data
Supplementary data associated with this article can be found,
in the online version, at doi:10.1016/j.neures.2008.01.014.
References
Bennett-Clarke, C., Romagnano, M.A., Joseph, S.A., 1980. Distribution of
somatostatin in the rat brain: telencephalon and diencephalon. Brain Res.
188, 473–486.
Caroni, P., 1997. Overexpression of growth-associated proteins in the neurons
of adult transgenic mice. J. Neurosci. Methods 71, 3–9.
Casey, P.J., 1995. Protein lipidation in cell signaling. Science 268, 221–225.
Cho, R.H., Segawa, S., Okamoto, K., Mizuno, A., Kaneko, T., 2004. Intracellularly labeled pyramidal neurons in the cortical areas projecting to the
spinal cord—II. Intra- and juxta-columnar projection of pyramidal neurons
to corticospinal neurons. Neurosci. Res. 50, 395–410.
Craig, A.M., Banker, G., 1994. Neuronal polarity. Annu. Rev. Neurosci. 17,
267–310.
DeFelipe, J., Hendry, S.H.C., Jones, E.G., 1989. Visualization of chandelier cell
axons by parvalbumin immunoreactivity in monkey cerebral cortex. Proc.
Natl. Acad. Sci. U.S.A. 86, 2093–2097.
Dotti, C.G., Simons, K., 1990. Polarized sorting of viral glycoproteins to the
axon and dendrites of hippocampal neurons in culture. Cell 62, 63–72.
Eiraku, M., Hirata, Y., Takeshima, H., Hirano, T., Kengaku, M., 2002. Delta/
Notch-like epidermal growth factor (EGF)-related receptor, a novel EGFlike repeat-containing protein targeted to dendrites of developing and adult
central nervous system neurons. J. Biol. Chem. 277, 25400–25407.
Feng, G., Meller, R.H., Bernstein, M., Keller-Peck, C., Nguyen, Q.T., Wallace,
M., Nerbonne, J.M., Lichtman, J.W., Sanes, J.R., 2000. Imaging neuronal
subsets in transgenic mice expressing multiple spectral variants of GFP.
Neuron 28, 41–51.
Furuta, T., Tomioka, R., Taki, K., Nakamura, K., Tamamaki, N., Kaneko, T.,
2001. In vivo transduction of central neurons using recombinant Sindbis
virus: Golgi-like labeling of dendrites and axons with membrane-targeted
fluorescent proteins. J. Histochem. Cytochem. 49, 1497–1507.
Gauthier-Campbell, C., Bredt, D.S., Murphy, T.H., El-Husseini AE-D, 2004.
Regulation of dendritic branching and filopodia formation in hippocampal
neurons by specific acylated protein motifs. Mol. Biol. Cell 15, 2205–2217.
Hioki, H., Kameda, H., Nakamura, H., Okunomiya, T., Ohira, K., Nakamura,
K., Kuroda, M., Furuta, T., Kaneko, T., 2007. Efficient gene transduction of
neurons by lentivirus with enhanced neuron-specific promoters. Gene Ther.
14, 872–882.
Jareb, M., Banker, G., 1998. The polarized sorting of membrane proteins
expressed in cultured hippocampal neurons using viral vectors. Neuron
20, 855–867.
Kaneko, T., Cho, R.-H., Li, Y.-Q., Nomura, S., Mizuno, N., 2000. Predominant
information transfer from layer III pyramidal neurons to corticospinal
neurons. J. Comp. Neurol. 423, 52–65.
91
Keller, P., Simons, K., 1997. Post-Golgi biosynthetic trafficking. J. Cell Sci.
110, 3001–3009.
Lee, T., Kaneko, T., Taki, K., Mizuno, N., 1997. Preprodynorphin-, preproenkephalin-, and preprotachykinin-expressing neurons in the rat neostriatum:
an analysis by immunocytochemistry and retrograde tracing. J. Comp.
Neurol. 386, 229–244.
Marks, M.S., Ohno, H., Kirchhausen, T., Bonifacino, J.S., 1997. Protein sorting
by tyrosine-based signals: adapting to the Ys and wherefores. Trends Cell
Biol. 7, 124–128.
Matter, K., Hunziker, W., Mellman, I., 1992. Basolateral sorting of LDL
receptor in MDCK cells: the cytoplasmic domain contains two tyrosinedependent targeting determinants. Cell 71, 741–753.
Matter, K., Yamamoto, E.M., Mellman, I., 1994. Structural requirements and
sequence motifs for polarized sorting and endocytosis of LDL and Fc
receptors in MDCK cells. J. Cell Biol. 126, 991–1004.
Mellman, I., 1996. Endocytosis and molecular sorting. Annu. Rev. Cell Dev.
Biol. 12, 575–625.
Meyer, A.H., Katona, I., Blatow, M., Rozov, A., Monyer, H., 2002. In vivo
labeling of parvalbumin-positive interneurons and analysis of electrical
coupling in identified neurons. J. Neurosci. 22, 7055–7064.
Mitsui, S., Saito, M., Hayashi, K., Mori, K., Yoshihara, Y., 2005. A novel
phenylalanine-based targeting signal directs telencephalin to neuronal
dendrites. J. Neurosci. 25, 1122–1131.
Moriyoshi, K., Richards, L.J., Akazawa, C., O’Leary, D.D.M., Nakanishi, S.,
1996. Labeling neural cells using adenoviral gene transfer of membranetargeted GFP. Neuron 16, 255–260.
Nakaya, Y., Kaneko, T., Shigemoto, R., Nakanishi, S., Mizuno, N., 1994.
Immunohistochemical localization of substance P receptor in the central
nervous system of the adult rat. J. Comp. Neurol. 347, 249–274.
Oliva Jr., A.A., Jiang, M., Lam, T., Smith, K.L., Swann, J.W., 2000. Novel
hippocampal interneuronal subtypes identified using transgenic mice that
express green fluorescent protein in GABAergic interneurons. J. Neurosci.
20, 3354–3368.
Resh, M.D., 1999. Fatty acylation of proteins: new insights into membrane
targeting of myristoylated and palmitoylated proteins. Biochim. Biophys.
Acta 1451, 1–16.
Sahara, Y., Westbrook, G.L., 1993. Modulation of calcium currents by metabotropic glutamate receptor involves fast and slow kinetic components in
cultured hippocampal neurons. J. Neurosci. 13, 3041–3050.
Tamamaki, N., Nakamura, K., Furuta, T., Asamoto, K., Kaneko, T., 2000.
Neurons in Golgi-stain-like images revealed by GFP-adenovirus infection
in vivo. Neurosci. Res. 38, 231–236.
Tamamaki, N., Yanagawa, Y., Tomioka, R., Miyazaki, J.I., Obata, K., Kaneko,
T., 2003. Green fluorescent protein expression and colocalization with
calretinin, parvalbumin, and somatostatin in the GAD67-GFP knock-in
mouse. J. Comp. Neurol. 467, 60–79.
van Brederode, J.F.M., Helliesen, M.K., Hendrickson, A.E., 1991. Distribution
of the calcium-binding proteins parvalbumin and calbindin-D28 k in the
sensorimotor cortex of the rat. Neuroscience 44, 157–171.
van’t Hof, W., Resh, M.D., 1997. Rapid plasma membrane anchoring of newly
synthesized p59fyn: selective requirement for NH2-terminal myristoylation
and palmitoylation at cysteine-3. J. Cell Biol. 136, 1023–1035.
Watanabe, D., Inokawa, H., Hashimoto, K., Suzuki, N., Kano, M., Shigemoto,
R., Hirano, T., Toyama, K., Kaneko, S., Yokoi, M., Moriyoshi, K., Suzuki,
M., Kobayashi, K., Nagatsu, T., Kreitman, R.J., Pastan, I., Nakanishi, S.,
1998. Ablation of cerebellar Golgi cells disrupts synaptic integration
involving GABA inhibition and NMDA receptor activation in motor
coordination. Cell 95, 17–27.
Wolven, A., Okumura, H., Rosenblatt, Y., Resh, M.D., 1997. Palmitoylation of
p59fyn is reversible and sufficient for plasma membrane association. Mol.
Biol. Cell 8, 1159–1173.
Zufferey, R., Donello, J.E., Trono, D., Hope, T.J., 1999. Woodchuck hepatitis
virus posttranslational regulatory element enhances expression of transgenes delivered by retroviral vectors. J. Viol. 73, 2886–2892.
Supplemental material
Table. Oligonucleotides and primers used in the present study.
Name
Forward (OF or PF)
Associated
5’ <––––––––––> 3’
site
Reverse (OR or PR)
5’ <––––––––––> 3’
protein/
——————————————————————————————————————————————————
—
OX1* GCCACCATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGG
CCCGTCAGTTTTGTTGCTTCTTTATCCTTACATTGCACACAGCCCATGGTGGC
Fyn
PX2
AATCTAGAGCCACCATGGGCTGTGTGCA
–
Fyn
PX3
GCCACCATGCTGTGCTGTAT
–
GAP-43
PX4
–
AAAACACGTGTTACTTGTACAGCTCGTCCATG
GFP
PX5
–
TTTTCACGTGCTTGTACAGCT- GFP
CGTCCATGC
PX6
CTGCAGAGGGCCCTGCGTAT
CGCCGCAGCGCAGATGGTCG
PX7
CGATAATCAACCTCTGGATT
CGATGCGGGGAGGCGGCCCA WPRE
PX8
AGGAACTGGCGGCTGAAGAA TCATGCCACATCGTCCTCCA
LDLR
PX9
AAGAAAAAACAGGTTCCAG
FcR
CTTCCTTTCTGGCTTGCTTT
SYN
PX10 AGAGTCCGACATCGGAAGAA GCAAGGGTGGGTGGTCAGCA pIgR
PX11 CAATCCACCGCTTGCAAGAA
TCAGGAAGATGTCAGCTGGA
TLC
PX12 TTCCGTCTGGGCTTCAAGCA
AAAAGCTTGGGCCCAATATG- NK1R
CCTAGGCCAGCATG
PX13 AGCCGCATCGAGTACCAGGG GATTACAAATCTTTTGTTTTAA DNER
PX14 AAAAGTCGACGCCACCATGGGCTGTGTGCA
TTTTGTCGACTCATGCCACAT- myrGFPCGTCCTCCA
LDLRCT
PX15 AAGGTACCATCCAGTTTGTTTTGCCCCTAA
TTATCGATTTGGGGTCTCTAC- Gad1
GGTTCAAGG
PX16 GTACACTAGTCAGACATGAT- TTGCGGCCGCTACCACATTTAAGATACATT
GTAGAGGTTT
SV40 late
polyA
——————————————————————————————————————————————————
—* X = F for forward oligonucleotide/primer, R for reverse oligonucleotide/primer.
Bold faces and bold italics indicate Kozak sequences and terminal codons, respectively.
Underlines point to restriction enzyme sites for PmaCI in PR4 and PR5, SalI sites in PF14 and
PR14, KpnI site in PF15, ClaI site in PR15, SpeI site in PF16, and NotI site in PR16.