Download Maize DELLA Proteins dwarf plant8 and dwarf plant9 as Modulators

Maize DELLA Proteins dwarf plant8 and dwarf plant9 as
Modulators of Plant Development
Shai J. Lawit1,*, Heidi M. Wych1, Deping Xu1, Suman Kundu1,2 and Dwight T. Tomes1
1Pioneer
Hi-Bred International, Inc., a DuPont Business, PO Box 1004, Johnston, IA 50131-1004, USA
Regular Paper
2Present address: Department of Biochemistry, University of Delhi South Campus, Benito Juarez Road, Dhaula Kuan, New Delhi-110021, India
*Corresponding author: E-mail, [email protected]; Fax, +1-515-254-2608
(Received July 28, 2010; Accepted September 30, 2010)
DELLA proteins are nuclear-localized negative regulators of
gibberellin signaling found ubiquitously throughout higher
plants. Dominant dwarfing mutations of DELLA proteins
have been primarily responsible for the dramatic increases
in harvest index of the ‘green revolution’. Maize contains two
genetic loci encoding DELLA proteins, dwarf plant8 (d8) and
dwarf plant 9 (d9). The d8 gene and three of its dominant
dwarfing alleles have been previously characterized at the
molecular level. Almost 20 years after the initial description
of the mutant, this investigation represents the first molecular
characterization of d9 and its gibberellin-insensitive mutant,
D9-1. We have molecularly, subcellularly and phenotypically
characterized the gene products of five maize DELLA alleles
in transgenic Arabidopsis. In dissecting the molecular
differences in D9-1, a critical residue for normal DELLA
function has been uncovered, corresponding to E600 of
the D9 protein. The gibberellin-insensitive D9-1 was found
to produce dwarfing and, notably, earlier flowering in
Arabidopsis. Conversely, overexpression of the D9-1 allele
delayed flowering in transgenic maize, while overexpression
of the d9 allele led to earlier flowering. These results
corroborate findings that DELLA proteins are at the crux of
many plant developmental pathways and suggest differing
mechanisms of flowering time control by DELLAs in maize
and Arabidopsis.
Keywords: Arabidopsis thaliana • DELLA • Gibberellin •
Maize • Semi-dwarf • Zea mays.
Abbreviations: AcGFP1, Aequorea coerulescens green
fluorescent protein; BAC, bacterial artificial chromosome;
Brrga1, Brassica rapa repressor of GA1-3; DAG, days after
germination; d8, maize dwarf plant8; D8-Mpl, maize dwarf
plant8 miniplant allele; d9, maize dwarf plant9; DsRED,
Discosoma sp. red fluorescent protein; EST, expressed sequence
tag; GAI, gibberellin insensitive; GFP, green fluorescent
protein; GID1, gibberellin-insensitive dwarf1; GID2, gibberellininsensitive dwarf2; GRAS, GAI, RGA and Scarecrow; GUS,
β-glucuronidase; indel, insertion/deletion; MPSS, massively
parallel signature sequencing; MS-S2A, Medicago sativa
S-adenosyl-homocysteine hydrolase; RT–PCR, reverse
transcription–PCR; SCF, Skp, Cullin, F-box-containing complex;
SLY1, sleepy1; UTR, untranslated region.
The nucleotide sequence reported in this paper has been submitted to EMBL/GenBank under accession numbers DQ903073
and DQ903074.
Introduction
Recent advances have contributed greatly to the elucidation
of the signaling pathways of several plant hormones
(reviewed in Ferreira and Kieber 2005, Finkelstein 2006, Huq
2006, Lorenzo and Solano 2005) including reports of new
receptors and analogs. Included in these was the discovery of
the gibberellin receptor in rice, gibberellin-insensitive dwarf1
(OsGID1), by Ueguchi-Tanaka et al. (2005) and three
Arabidopsis (Arabidopsis thaliana) orthologs (Nakajima et al.
2006). The GID1-family proteins bind to both bioactive
gibberellin and the intrinsically unstructured N-terminal motifs
of DELLA proteins (the DELLA, VHYNP and LExLE amino acid
motifs) in an apparently co-operative fashion (for reviews of
GID1–DELLA interactions, see Harberd et al. 2009, Hirano
et al. 2008, Itoh et al. 2008). The GID1–DELLA protein interaction appears to de-repress the gibberellin signaling pathway
(Ueguchi-Tanaka et al. 2008), and perhaps redundantly
potentiates the DELLA proteins for polyubiquitylation by a
SCFGID2/SLY (Skp, Cullin, gibberellin-insensitive dwarf 2/SLEEPY1
F-box-containing) complex (Sasaki et al. 2003, Griffiths et al.
2006), leading to subsequent degradation by the 26S proteasome (Dill et al. 2004, Gomi et al. 2004, Strader et al. 2004).
Removal of the DELLA proteins from the system, by way of
the GID2/SLY F-box interaction, releases their sequestered
transcription factor targets, such as the phytochromeinteracting factor family of proteins, and potentiates their
responses such as cell elongation (de Lucas et al. 2008, Feng
et al. 2008).
DELLA domain proteins are of particular interest because
of the gibberellin-insensitive dwarf phenotype of their
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153, available online at www.pcp.oxfordjournals.org
© The Author 2010. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
All rights reserved. For permissions, please email: [email protected]
1854
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
Maize DELLA protein dwarf plant9
gain-of-function mutants, which were partially responsible
for the ‘green revolution’ by way of their increase in wheat harvest index (Peng et al. 1999). Proving their continued relevance,
new semi-dwarf DELLA alleles are pursued (Asano et al. 2009)
in order to produce varieties that contribute to agricultural
gains (Feiffer and Koch 2007). The DELLA proteins are keystones
of the gibberellin signal transduction cascade, acting as negative regulators of the gibberellin response (Ikeda et al. 2001,
Silverstone et al. 2001). Mutations in the highly conserved
N-terminal regions I (DELLA region) and II (VHYNP region)
often cause a dominant gibberellin-insensitive phenotype by
greatly increasing the stability of this negative regulator of
gibberellin signal transduction (Silverstone et al. 2001, Gubler
et al. 2002, Itoh et al. 2002, Cassani et al. 2009). Griffiths et al.
(2006) and Ueguchi-Tanaka (2007) demonstrated that both
N-terminal regions I and II are required for DELLA protein
interaction with GID1 in Arabidopsis and rice, respectively.
C-terminal mutations in the conserved GRAS domain typically
lead to a loss-of-function, constitutive gibberellin growth
response phenotype (Ikeda et al. 2001, Gubler et al. 2002,
Itoh et al. 2002, Dill et al. 2004) with the notable exception of
a Brassica rapa mutant Brrga1-d (Muangprom et al. 2005).
In addition to their role in the downstream portion of the
gibberellin signal transduction pathway, DELLA proteins also
integrate signals from other pathways (for a review see Alvey
and Harberd 2005), making them critical for shoot (Peng et al.
1997, Silverstone et al. 1997, Achard et al. 2007) and root
(Achard et al. 2003, Fu and Harberd 2003) architecture and in
floral and reproductive development (Thornsberry et al. 2001,
Cheng et al. 2004, Tyler et al. 2004). Auxin has been shown
to mediate root growth by potentiating the degradation of
Arabidopsis DELLA proteins in response to gibberellin (Fu and
Harberd 2003). Ethylene was found to inhibit root (Achard et al.
2003) and hypocotyl (Vriezen et al. 2004) elongation through
DELLA protein stabilization.
The Zea mays (maize) DELLA gene dwarf plant8 (d8) was
isolated and reported to be similar to the ‘green revolution’
gene Reduced height (Rht1d) from wheat (Peng et al. 1999),
barley Slender1 (Chandler et al. 2002) and Slender rice1 (Ikeda
et al. 2001). Several gibberellin-insensitive dominant mutant
alleles of d8 and dwarf plant9 (d9) have been genetically and
phenotypically characterized (Winkler and Freeling 1994,
Cassani et al. 2009). Peng et al. (1999) found that the most
severely dwarfing allele, D8-1, has a deletion resulting in four
missing amino acids in the DELLA domain, and two codon
changes that result in amino acid substitutions (one in the
DELLA domain and another in the C-terminal GRAS domain).
Surprisingly, one of the least severely dwarfing alleles of d8,
D8-Miniplant (D8-Mpl) (Harberd and Freeling 1989), encodes a
protein lacking the N-terminal 105 amino acids encompassing
the entirety of regions I and II (Peng et al. 1999).
Although maize d9 has been described genetically and phenotypically as a likely paralog to d8 (Winkler and Freeling 1994),
this report is the first to molecularly characterize d9 and confirm it as a DELLA gene. Two d9 alleles have been isolated and
are described herein. These D9-coding sequences were expressed
in transgenic Arabidopsis and maize to characterize their phenotypic effects (as compared with D8 proteins) without expression bias. Transgenic Arabidopsis carrying the D9-1 mutant
allele displayed dwarfing comparable with or less severe than
the mild dwarfing D8-Mpl isoform and transitioned to flowering significantly earlier than controls. The gibberellin-sensitive
d9 allele had little to no effect on the transgenic Arabidopsis
phenotype, although it hastened the maturity transition in
maize. The gibberellin-insensitive D9-1 allele displays six lesions,
five of which result in single amino acid changes. These changes
are dispersed throughout the protein. Although it was hypothesized that the dwarfing lesion of D9-1 would be in the
N-terminal DELLA domain, it was found that a single amino
acid change near the C-terminus was necessary and sufficient
for the dwarfing and maturity transition alterations. The data
presented here demonstrate that the maize d9 gene encodes
a second DELLA protein, which plays a role in determining
both plant architecture and development. This adds to the
growing knowledge of the gibberellin class of phytohormones
and provides yet another tool to manipulate agronomic
properties in plants.
Results
d9 and D9-1 are highly similar to d8
An expressed sequence tag (EST) contig of a second maize
DELLA gene, other than d8, was identified in a Basic Local
Alignment Search Tool Protein (BLASTP) search of a Pioneer
Hi-Bred International Inc. proprietary database (UniCorn 5.0
6-Frame) using the d8 amino acid sequence as the query. The
identified contig, PCO554925, encodes a hypothetical protein
with 95.1% similarity and 92.6% identity to the d8 amino acid
sequence. Given the data in support of d9 as a second maize
DELLA gene (Winkler and Freeling 1994), it was hypothesized
that this novel DELLA sequence represented a wild-type d9
allele. The nucleotide sequence of the contig was used to
design PCR primers to a region upstream of a stop codon in
the predicted 5′ untranslated region (5′ UTR) and in the predicted 3′ UTR. The partial cDNA that resulted from reverse
transcription–PCR (RT–PCR) amplification from maize inbred
line B73 RNA confirmed the coding sequence predicted by
PCO554925. A comparison of the sequences resulting from
genomic DNA PCR and RT–PCR showed identical sequences,
indicating that the putative d9 gene (including the apparent
D9-1 allele) lacks introns as do other reported DELLA genes.
Two putative d9 alleles were isolated from GA3-insensitive
D*-2319xB73 (D9-1xB73) plants (Fig. 1). One of the forms isolated was the wild-type d9 allele that was identical to that found
from the B73 inbred genomic DNA. The second encoded a protein with a number of amino acid changes: N11S, R15M, A108T,
G427D, E600K and an insertion/deletion (indel) in the amino
acid 511–526 region relative to the d9 B73 allele (Fig. 2). This
D9-1 protein has 95.4 and 98.4% similarity to and 92.9 and
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
1855
S. J. Lawit et al.
97.6% identity with d8 and d9, respectively, indicating that the
D*-2319xB73 plants were heterozygous for these polymorphisms, making this allele a candidate for D9-1.
Chromosome 5 location of d9
Fig. 1 GA3-non-responsive plants (left) and responsive plants (right)
segregating for the D*-2319 (D9-1) allele. Background pixels were
blacked out for clarity using Adobe Photoshop.
Chromosomal mapping was initiated to provide evidence for
the identity of the new sequences. The d8 gene is located on
chromosome 1L (BIN 1.09), while d9 is located in a syntenous
region on chromosome 5S (BIN 5.00) (Neuffer 1990, Winkler
and Freeling 1994, Lawrence et al. 2005). To verify that the new
alleles are forms of d9, two bacterial artificial chromosome
(BAC) libraries derived from the maize B73 inbred line were
screened using PCR. One B73 BAC, bacb.pk425.i4, was found
to contain the putative d9. However, this BAC could not be
fixed to the genetic or physical maps, although it did link to
markers found on both chromosomes 1 and 5. To show that
Fig. 2 Multiple amino acid sequence alignment of maize DELLA proteins encoded by wild-type and dwarfing alleles.
1856
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
Maize DELLA protein dwarf plant9
Marker
Maize
Oat
Chromosome 10
Chromosome 9
Chromosome 8
Chromosome 7
Chromosome 6
Chromosome 5
Chromosome 4
Chromosome 3
Chromosome 2
Marker
Chromosome 1
A
B
Fig. 3 Chromosomal location of d8 (A) and d9 (B). Analytical PCR from
oat addition lines demonstrated that the putative d9 gene is indeed
located on maize chromosome 5 as expected from genetic mapping of
the D9 mutation. This gene was found to be in a location distinct from
that of the positive control d8 PCR product, which is known to be on
chromosome 1.
the putative d9 was distinct from d8 and to determine its rough
chromosomal location, PCR analysis of oat addition lines
(Ananiev et al. 1997, Kynast et al. 2001, Okagaki et al. 2001)
was performed and confirmed by sequencing of the reaction
products (Fig. 3). The d8 amplicon was only produced from the
maize chromosome 1-containing genomic DNA preparation.
Conversely, the putative d9 amplicon was only produced from
the maize chromosome 5-containing preparation, providing
support for the identities of the new sequences.
d8 and d9 are expressed throughout maize plants
To determine the expression profiles of the DELLA mRNAs,
a large proprietary massively parallel signature sequencing
(MPSS; Brenner et al. 2000a) database at DuPont (Wilmington,
DE, USA) was queried with the d8 and d9 cDNA sequences.
The abundance of the d8 and d9 transcripts was compiled
from 385 different RNA samples representing a wide variety
of tissues and developmental stages. The quantitative nature
of the MPSS sampling, as well as the depth of signature
sequencing, make possible the expression level comparisons
between multiple independent experiments. The DELLA
genes were expressed at appreciable levels in all surveyed
tissues and developmental stages, with the exception of pollen
(Fig. 4).
Nuclear localization of d8 and d9
The d8 and d9 proteins with C-terminal Aequorea coerulescens
green fluorescent protein (AcGFP1) tags localized to a cellular
region consistent in size and shape with the nucleus (Fig. 5)
when transiently expressed in etiolated maize coleoptile cells.
In these experiments, etiolated seedlings were used to reduce
Chl accumulation and autofluorescence which would interfere
with DsRED (Discosoma sp. red fluorescent protein) EXPRESS
internal control observations. The subcellular localizations
were indistinguishable in multiple transient transformation
experiments. Additionally, particle-bombarded onion epidermal cells (Varagona et al. 1992), maize Black Mexican Sweet
(BMS) cell cultures (Klein et al. 1988) and maize in vitro
endosperm cultures (Gruis et al. 2006) all showed an identical
subcellular localization pattern. This was further replicated in
similar experiments with C-terminal DsRED EXPRESS fusions
and N-terminal AcGFP1 fusions (data not shown). The D8-MPL,
D8-1 and D9-1 fusion proteins all were localized similarly to the
wild-type proteins (data not shown).
In a related experiment, the AcGFP1/DsRED EXPRESS
fluorescence ratio was tracked with and without exogenous
gibberellin in an attempt to determine the kinetics of degradation for the maize DELLA isoforms. The N46 coleoptiles were
pre-treated with 1 µM paclobutrazol to prevent gibberellin biosynthesis. Seedlings transiently transformed with d8, D8-MPL
and D8-1 proteins with N-terminal AcGFP1 tags were treated
with 10 µM GA3. The AcGFP1:DsRED EXPRESS fluorescence
intensity was monitored for 6 h in these conditions with halflives of 210, 248 and 198 min for d8, D8-MPL and D8-1, respectively (Supplementary Fig. 1). These data suggest that the
d8 proteins are not degraded by the 26S proteasome upon
exogenous addition of GA3, or if they are it is a very slow process
in comparison with the Arabidopsis and rice orthologs which
were undetectable within 2 h and 6 h of gibberellin treatment,
respectively (Silverstone et al. 2001, Itoh et al. 2002). While this
is in contrast to some observations of DELLA proteins, it is
similar to the results obtained with the first DELLA protein to
be isolated, GAI (Fleck and Harberd 2002). GAI was later shown
to be stabilized by the fusion of GFP (Fu et al. 2004), as is RGL2
(Hussain et al. 2005). However, unlike the increase in dwarfing
observed with GFP fusions (Fleck and Harberd 2002, Fu et al.
2004) a lack of dwarfing in 25 events each of maize transgenics
carrying N- or C-terminal AcGFP1 tags on d8, D8-Mpl or D8-1
expressed from the Medicago sativa S-adenosyl-homocysteine
hydrolase promoter (MS-S2A promoter) strongly suggests that
the fusion proteins are not fully functional in planta. In our
experience, ∼90% of S2A PRO:D8-Mpl transgenic maize events
without GFP fusions display dwarfing of 30–40%. Therefore,
fluorescent protein tagging is probably not a viable system for
tracking DELLA protein degradation in maize.
D9-1 causes dwarfing and flowering time shifts
in transgenic Arabidopsis and maize
A transgenic approach was chosen so that a direct phenotypic
comparison of the maize alleles could be performed that
would not be skewed by endogenous promoter-dependent
effects. The endogenous promoters for each allele were not
used because the differences in their temporal and spatial
expression patterns in Arabidopsis are unknown and potentially too subtle to detect readily. Furthermore, maize promoters tend to be expressed poorly in Arabidopsis (Xiaomu Niu,
personal communication). Therefore, initially, the constitutive
rice Actin1 promoter was used to drive expression of these
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
1857
S. J. Lawit et al.
1000
900
Normalized Expression (ppm)
800
700
600
500
400
300
200
100
BMS
Pollen
Tassel
Anther
Seedling
Scutellum
Seed/Kemel
Silk
Pedicel
Pericarp
Embryo
Endosperm
Ear
Pulvinus
Organ/ Tissue
Vascular Bundles
Nodal Plate
Inner Tissue
Rind
Mature
Transition Zone
Elongation
Stalk
Division
Root
Meristem
Husk
Whorl
Leaf Mature
Leaf Transition
Leaf Elongation
Leaf
Leaf Division
0
d8
d9
Fig. 4 Relative expression levels (in p.p.m.) of the d8 and d9 genes in 32 different tissues and developmental stages of maize obtained via the Solexa, Inc.
MPSS system (Brenner et al. 2000a, Brenner et al. 2000b). Vertical lines divide the chart by the organ from which the samples were derived.
Fig. 5 Subcellular localization of maize DELLA proteins fused to AcGFP1. (A) MOPAT-DsRED EXPRESS control; (B) d8:AcGFP1; (C) merge of
(A) and (B); (D) MOPAT-DsRED EXPRESS control; (E) d9:AcGFP1; (F) merge of (D) and (E). The green scale bars represent 10 µm.
1858
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
Maize DELLA protein dwarf plant9
alleles in Arabidopsis and maize. However, T1 and T0 plants,
respectively, from these transformations did not display any
visible phenotype (data not shown). This strongly suggests that
the rice Actin1 promoter does not express the DELLA proteins
in the correct tissues or at the correct stage of development.
This result together with the maize expression profiles for d8
and d9 (Fig. 4), and the work of Haywood et al. (2005) which
showed a vasculature association of DELLA proteins and mRNAs
in three species, suggested a need for a preferred vasculature
expression profile.
MS-S2A PRO:β-glucuronidase (GUS) expression patterns in
Arabidopsis (Supplementary Fig. 2) are similar to those of
the MS-S2A promoter in the native M. sativa and transgenic
expression in maize (Xiaomu Niu, personal communication).
In M. sativa and maize, the MS-S2A promoter is preferentially
expressed in vasculature-associated sclerenchyma cells. In
transgenic Arabidopsis, GUS staining was observed in developing xylem cells in vascular bundles and in vascular tissues in
the floral buds. This demonstrates that the MS-S2A promoter
is active in Arabidopsis and useful for stable, moderate-level
expression of transgenes in vascular tissue (Supplementary
Fig. 2).
The three DELLA alleles that were only found in dwarf maize
(D8-Mpl, D8-1 and D9-1) each produced dwarf phenotypes
in transgenic Arabidopsis. The MS-S2A PRO:D9-1 transgenic
Arabidopsis displayed a dwarfing phenotype less than that of
the D8-Mpl transgenic plants (Fig. 6 and Table 1) which is consistent with its previously described phenotype (Winkler and
Freeling 1994) despite being expressed at roughly twice as high
an RNA level as D8-Mpl (Table 2). The heights of the transgenic
plants were ranked in the following order: GUS > d9 ≥ d8 > D9-1
> D8-Mpl > D8-1, while expression at the RNA level was ranked
as D9-1 > d9 > D8-1 > D8-Mpl > d8. The D8-1 transgene reduced
plant height >73%, while D9-1 and D8-Mpl reduced plant
height by 55 and 71%, respectively. To a lesser degree, the
transgenes similarly affected rosette diameter, silique length,
root length, root tips and silique width (Tables 1, 2). In T0
transgenic maize (Z. mays L.) cv. HI-IIxGaspe Flint, S2A PRO:D8Mpl reduced plant height by 48 ± 10%, while S2A PRO:D9-1
reduced plant height by 58 ± 8% that of S2A PRO:GUS control
plants (Fig. 7). S2A PRO:d8 and S2A PRO:d9 had no significant
effect on plant height (data not shown). Overall, these
results are similar to what was observed with the transgenic
Arabidopsis, although the reductions are more pronounced
than those from heterozygous near isogenic lines examined
by Winkler and Freeling (1994).
The dwarfing effects extend into floral structures (Fig. 8) in
Arabidopsis. In particular, several D8-1 transgenic Arabidopsis
plants produced few seeds. This low fecundity was not due to
a paucity of flowers or pods. Rather, pollen transfer to the
stigma appears to be the cause (Fig. 8F). Although the pistil
was shorter on average in the transgenics carrying the dwarf
alleles, the filaments were dramatically reduced in length in the
D8-1 transgenics. Severe reduction of filament length was
reported in some cauliflower mosaic virus 35S::rgl1∆17 transgenics from Arabidopsis (Wen and Chang 2002). These investigators also observed coordinated shortening of the petals
and sepals, which were not strongly affected by the S2A
PRO::D8-1 construct.
Fig. 6 Fifty-six DAG T2 Arabidopsis from representative events of six
different constructs. From left to right: MS-S2A PRO:GUS; MS-S2A
PRO:d8; MS-S2A PRO:d9; MS-S2A PRO:D9-1; MS-S2A PRO:D8-Mpl; and
MS-S2A PRO:D8-1.
Table 1 Morphometric data on T3 Arabidopsis plants at growth stage 8.00 (Boyes et al. 2001) expressing cDNAs from naturally occurring d8
and d9 alleles from the MS-S2A promoter
Construct
Rosette diameter (mm)
Stem diameter (µm)
Height (mm)
Silique length (mm)
Silique width (µm)
MS-S2a PRO:GUSINT
45.4 ± 15.0a
629 ± 167a
327.7 ± 47.4a
13.1 ± 1.3a
393 ± 95a
MS-S2a PRO:d8
42.4 ± 6.5a
632 ± 177a
284.2 ± 70.5b
13.1 ± 1.6a
354 ± 67b
MS-S2a PRO:D8-Mpl
51.7 ± 25.1a
342 ± 189b
95.0 ± 69.2c
7.8 ± 2.8b
268 ± 98c
MS-S2a PRO:D8-1
26.7 ± 15.5b
377 ± 147b
88.3 ± 67.4c
8.9 ± 2.7c
393 ± 134a
MS-S2a PRO:d9
48.5 ± 15.1a
632 ± 190a
310.9 ± 67.3ab
11.9 ± 2.1d
375 ± 109ab
MS-S2a PRO:D9-1
27.8 ± 9.5b
369 ± 122b
147.3 ± 55.2c
10.6 ± 1.3e
304 ± 99c
Lower case letters indicate groups that are not significantly different from one another by LSD analysis at the 95% confidence level. Data were collected from an average of
eight replicates of four independent transformation events.
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
1859
S. J. Lawit et al.
The maize D9-1 allele was found to hasten Arabidopsis
flowering. D9-1 transgenics flowered earlier by 2 d vs. the GUS
controls, and 2.6–5.4 d earlier than the other DELLA constructs
(Table 3). Interestingly, the D9-1 allele causes later flowering
in T0 HI-IIxGaspe Flint, while d9 led to earlier flowering (using
total aboveground nodes as a basis for maturity shift; Table 3).
The E600K region is necessary and sufficient for
dwarfing and flowering time shifts in Arabidopsis
To dissect further the nature of the D9-1 allele, domain swap
constructs were created and transformed into Arabidopsis.
Five genetic regions were exchanged between the d9 and
D9-1 Gateway entry clones (Fig. 9), and the resultant chimeric
Gateway entry clones were used to create S2A PRO::DELLA
intermediate and co-integrate vectors for transformation as
Table 2 Data on the total root lengths, number of root branches and
transgene expression levels of 10 DAG T2 Arabidopsis plants at
principal growth stage 1.03 (Boyes et al. 2001)
Construct
Average root Average no. Target:reference
length (cm) of root tips mRNA expression
MS-S2a PRO:GUSINT
6.34a
9.73a
N/A
MS-S2a PRO:d8
5.97a
9.10a
0.27 ± 0.09a
MS-S2a PRO:D8-Mpl
4.82c
4.30b
0.56 ± 0.47b
MS-S2a PRO:D8-1
4.69c
5.00b
0.67 ± 0.39b
MS-S2a PRO:d9
5.77ab
9.66a
0.72 ± 0.71b
MS-S2a PRO:D9-1
5.15bc
6.00b
1.49 ± 1.07c
Lower case letters indicate groups that are not significantly different from one
another by LSD analysis at the 95% confidence level. Data were collected from
4–15 replicates from four independent transformation events.
Fig. 7 Mature T0 HI-IIxGaspe Flint maize transgenic plants from
representative events of MS-S2A PRO:GUS (left) and MS-S2A PRO:D9-1
(right). A 1 m stick is shown for scale.
Fig. 8 Representative dissected flowers from Arabidopsis T2 plants driving the maize DELLA protein cDNAs from the MS-S2A promoter. (A) GUS
control, (B) d8, (C) d9, (D) D9-1, (E) D8-Mpl and (F) D8-1. Two petals and two sepals were removed from the above flowers.
1860
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
Maize DELLA protein dwarf plant9
Table 3 Data on transition to flowering in Arabidopsis T3 and
HI-IIxGaspe maize T0 plants
Construct
Days to flowering Rosette leaves Above
(Arabidopsis
at flowering
soil nodes
growth stage 5.10)
(maize)
MS-S2a PRO:GUSINT 23.7 ± 2.5a
13.3 ± 1.4a
8.22 ± 0.74a
MS-S2a PRO:d8
25.9 ± 2.1b
13.5 ± 1.4a
ND
MS-S2a PRO:D8-Mpl
26.9 ± 3.2b
13.2 ± 2.2a
ND
MS-S2a PRO:D8-1
25.5 ± 2.9a
12.0 ± 3.0bca
ND
MS-S2a PRO:d9
24.1 ± 2.6a
12.8 ± 1.5ab
6.90 ± 0.70b
MS-S2a PRO:D9-1
21.5 ± 2.4c
11.1 ± 1.7c
9.00 ± 0.67c
Lower case letters indicate groups that are not significantly different from one
another by LSD analysis at the 95% confidence level. Arabidopsis data were
collected from an average of 10 replicates of three independent events. Maize
data were collected from a single replicate of 25 independent transformation
events for each construct.
a D8-1 transgenic plants were very compact, confounding efforts to count leaves.
D8-1 leaf counts may be downwardly skewed.
BssHlI (1559)
A
Pstl (1333)
ATT L1
Hpal (4)
Sphl (479)
A
NR
SM
Hpal (4)
ATT L1
B
described for the native maize alleles. Morphometric analysis
of the domain swap transgenics was performed at the T1 generation by analyzing 25–30 independent events per construct
(Table 4).
The E600K mutation from D9-1 is necessary and sufficient
for the dwarfing and earlier flowering phenotypic changes.
The d9 E600K and the D9-1 K597E produced morphological
effects dissimilar to their backbone alleles (Table 4). The most
notable differences were in plant height, silique length, days to
flowering and number of rosette leaves at flowering. In all four
cases the d9 (E600K) plants showed characteristics similar to
D9-1. On average, the d9 (E600K) chimeric transgene produced
the plants with shortest stems and siliques and had the
fewest rosette leaves at flowering of any of the 10 constructs.
Conversely, D9-1 K597E ranked second or third highest for
silique length, days to flowering and number of rosette leaves
at flowering. No other polymorphism displayed a clear pattern
of stature or flowering time changes.
Sphl (479)
Bg/II (1789)
ATT L2
Pvul (2744)
Bg/lI (1780) ATT L2
BssHlI (1559)
Pvul (2735)
d9
T
D9-1
Pstl (1333)
G
INDEL
E
D
INDEL
K
d9 N11SR15M
d9 A108T
d9 G427D
d9 INDEL
d9 E600K
C
D9-1 S11N M15R
D9-1 T108A
D9-1 D427G
D9-1 INDEL
D9-1 K597E
Fig. 9 Partial d9 and D9-1 entry clone maps representing the domain-swap chimeras that were produced. Partial maps of the d9 and D9-1 entry
clones (A) with the amino acid differences encoded in each region denoted. The amino acid sequence of the d9 indel is SGSGSGQPTDASPPA.
The D9-1 indel amino acid sequence is QPTDASSPAAAG. Partial maps of the d9 allele-based (white regions) chimeras with segments of D9-1
in gray (B). Partial maps of the D9-1 allele-based (gray regions) chimeras with segments of d9 in white (C).
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
1861
S. J. Lawit et al.
Table 4 Morphometric and flowering time data on d9/D9-1 domain-swap T1 Arabidopsis
Chimeric CDS
Rosette diameter
(mm)
Height (mm)
Silique length
(mm)
Silique width (µm)
Days to flowering
Rosette leaves
at flowering
d9 N11S, R15M
68.4 ± 11.5a
403.2 ± 70.9a
10.6 ± 1.3a
576.9 ± 94.4ab
37.4 ± 3.8a
21.8 ± 3.0ab
D9-1 S11N, M15R
65.3 ± 11.9ab
287.1 ± 96.9b
9.8 ± 1.5ab
394.3 ± 157.4c
35.0 ± 5.0b
20.0 ± 4.1cd
ALT
–
ALT
–
–
–
d9 A108T
69.5 ± 11.2a
515.0 ± 106.3c
10.3 ± 1.6a
462.8 ± 118.4de
38.2 ± 3.8a
22.8 ± 2.7a
D9-1 T108A
55.5 ± 14.3b
306.0 ± 147.9b
10.4 ± 2.3a
482.9 ± 214.7de
35.5 ± 4.9bc
20.1 ± 3.3cd
–
–
ALT
ALT
–
–
d9 G427D
59.8 ± 9.1ab
440.7 ± 84.4ac
10.6 ± 1.8a
589.2 ± 106.4ab
36.9 ± 4.4ac
20.9 ± 2.7bcd
D9-1 D427G
62.7 ± 16.1ab
331.7 ± 102.7ab
9.6 ± 2.4ab
337.7 ± 122.6cf
34.9 ± 4.4b
19.7 ± 3.4cd
ALT
ALT
ALT
–
–
ALT
69.9 ± 14.3a
393.1 ± 69.5a
11.7 ± 1.9c
541.2 ± 163.3ae
38.5 ± 3.9a
20.9 ± 3.2bcd
d9 INDEL
69.1 ± 15.7a
331.8 ± 139.3ab
9.6 ± 2.0ab
311.9 ± 105.8f
34.2 ± 3.8b
21.0 ± 3.6bc
ALT
ALT
–
–
–
ALT
d9 E600K
56.3 ± 14.6b
262.2 ± 81.2b
9.4 ± 1.8b
608.1 ± 76.1b
34.5 ± 4.7b
18.3 ± 3.1e
D9-1 K597E
66.1 ± 15.8ab
393.5 ± 65.2a
11.1 ± 1.6ac
496.7 ± 122.7de
38.0 ± 3.9a
22.4 ± 3.1a
ALT
REV
REV
REV
REV
REV
D9-1 INDEL
Lower case letters indicate groups that are not significantly different from one another by LSD analysis at the 95% confidence level.
ALT, altered, i.e. the phenotypic relationships of the alleles are changed by the swapped polymorphism such that differences are no longer significant; REV, reversed, i.e. the
polymorphism produces a statistically significant reversal of the phenotypic relationship of the alleles.
The MS-S2A promoter was used to drive all the above coding sequences (CDS). Data were collected from an average of 16.3 independent transformation events per
construct. Rosette diameter, height, silique length and silique width were measured at principal growth stage 8.00. Days to flowering and rosette leaves at flowering were
measured at principal growth stage 5.10.
Discussion
Almost two decades after the initial characterization of the
mutated d9 gene, a second maize structural gene encoding
a member of the DELLA domain family of gibberellin signal
transducing proteins has been isolated and molecularly characterized. The sequence of this cDNA was first identified in
a proprietary EST contig database. Despite the presence of
two alleles of the gene in D*-2319xB73 plants, strong similarity
of the coding sequence to d8 raised the question of whether
this might be two new alleles of the d8 gene or the putative
paralog d9. Since both d8 and d9 have been mapped to separate
maize chromosomes, identification of the chromosomal location of the isolated sequences was used to clarify their identity.
The chromosome locations of d8 and d9 are known to be
duplicated regions (Winkler and Helentjaris 1993), and this
confounded our mapping attempts. Gene-specific amplification from a maize–oat chromosome addition set clearly
demonstrated that the d8 and d9 sequences are discrete and
confirmed the location of the new sequences to the known
location of d9, chromosome 5; distinct from the d8 locus on
chromosome 1. This evidence, in addition to the presence of
two alleles in the D*-2319xB73 plants, strongly suggests that the
new sequences are indeed alleles of d9. Conclusively demonstrating the isolation of the maize d9 structural gene, transgenic
1862
Arabidopsis and maize plants expressing the D9-1 allele were
found to be dwarfed.
Expression profiles illustrate that from a developmental
standpoint, d9 shows preference for mature, differentiated cells,
particularly those associated with the stalk, while d8 is associated more with the dividing or meristematic cells. The highest
expression levels for d8 and d9 were in ears and vascular bundles, respectively. In general, vascular organs/tissues had greater
expression of both genes than did non-vascular organs/tissues.
This is consistent with the presence of DELLA mRNAs and proteins in and around the vasculature in dicots (Haywood et al.
2005, Israelsson et al. 2005), suggesting that the localization has
been conserved between dicots and monocots.
Microscopy of fluorescently tagged maize DELLA proteins
suggests that the proteins are localized to the nucleus, in
agreement with reports of DELLA proteins in other species
(Ogawa et al. 2000, Silverstone et al. 2001, Fleck and Harberd
2002). This nuclear localization is consistent with the expected
functions of d8 and d9 as transcriptional regulators (Peng
et al. 1997, Silverstone et al. 1998, Ogawa et al. 2000) and
our data showing that the maize DELLA proteins are capable
of activating transcription in yeast promoter artificial recruitment assays (not shown). This transactivating activity requires
amino acids in the C-terminal 331–630 region comprising
the GRAS domain, similar to results obtained with the rice
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
Maize DELLA protein dwarf plant9
DELLA protein in spinach artificial recruitment assays (Ogawa
et al. 2000).
In silico DELLA protein structure and stability
An in silico analysis of the amino acid sequences of the d9 alleles
indicate that the proteins are very similar in their secondary
structures (helices, sheets and turns). They have an overall
similar chain flexibility, hydrophilicity and surface probability.
This suggests that the proteins might have a similar folding
pattern and thermodynamic stability. However, the N-terminal
mutations flanking the DELLA motif (N11S, R15M and A108T)
have local effects in D9-1. The first two mutations reduce the
hydrophilicity and surface probability of residues 8–18 by 50%
while maintaining an identical secondary structure. Similarly,
the third mutation increases the hydrophilicity and surface
probability for residues 105–111. The differences seem significant since all residues before and after these patches have
exactly identical properties. Such local changes can certainly
influence the function of the mutant protein by altering its
tertiary structure and/or ability to bind interacting proteins,
which in turn can influence the signal transduction cascade.
This seems to be true for mutations in the GRAS domain as
well, where the introduction of the charged residue (G427D)
increased the hydrophilicity and surface exposure of the stretch
of residues 424–431. The changes are more pronounced in the
area of the large lesion (residues 511–525). The most unique
mutation (E600K) in the C-terminal domain does not change
the hydrophilicity, surface exposure or secondary structure, but
can inherently change binding properties due to the intrinsic
differences in the properties of the two amino acid side chains.
Muangprom et al. (2005) have shown that a ‘Q’ to ‘R’ substitution in the N-terminal portion of the GRAS domain of B. rapa
DELLA protein causes a dwarf phenotype by preventing interaction with the F-box protein SLY1 required for degradation.
A similar effect may exist for the D9-1 E600K mutation which is
responsible for both the stature and flowering time changes in
transgenic Arabidopsis.
Structural alleles affect plant architecture
and development
The phenotypic and molecular attributes of transgenic plants
expressing maize DELLA protein demonstrate that the mutant
alleles are sufficient to cause dwarfing phenotypes. The d8 and
d9 alleles produced no notable morphological or developmental changes to the transgenic Arabidopsis; however, the DELLA
alleles found in dwarf plants each causes varying degrees of
dwarfing in transgenics. This confirms the inference that expression of a d8 protein lacking the first 105 amino acids (Peng et al.
1999), which includes the DELLA domain, is sufficient as well as
necessary to cause dwarfing in D8-Mpl mutant plants. Furthermore, the dwarfing of D9-1 transgenics proves the veracity of
this DELLA-encoding sequence as the D*-2319 (D9-1) allele
associated with a gibberellin-insensitive dwarf phenotype in the
work of Winkler and Freeling (1994). In transgenics carrying the
dominant alleles, reduced length was observed in rosette leaves,
siliques, inflorescence stems and root structures. This extended
into floral structures, most notably with the D8-1 allele as several D8-1 transgenic plants produced few seeds due to dramatically shortened filaments that resulted in reduced pollen
transmission to the stigma. This is consistent with D8 and D9
mutants which are known to have reduced anther exertion
causing varying degrees of male sterility in maize (Winkler and
Freeling 1994). Similarly severe dwarfing of the filament was
reported in 35S-rgl1∆17 (Wen and Chang 2002) and pTA29-gai
(Huang et al. 2003) Arabidopsis transgenics. RGL1 appears to
have an increased role in floral structures, and this may be similarly displayed by the d8 gene based on this transgenic evidence
and the strong expression of d8 in the ear.
The D9-1 transgenics display a unique combination of phenotypes. In Arabidopsis, the D9-1 allele shifted the plants
towards earlier flowering while also causing dwarfing. Although
the experimental details are not directly comparable, this is in
contrast to the results of Tyler et al. (2004) with Arabidopsis
DELLA mutants. In a gibberellin-deficient mutant background,
DELLA proteins led to later flowering, which is consistent
with gibberellin being a positive regulator of floral transition.
This effect was relieved to various extents in DELLA-knockout
mutants. In essence, Tyler et al. (2004) observed that loss-offunction DELLA mutants led to earlier flowering, which is
the same result obtained with the gain-of-function D9-1 in
Arabidopsis. Interestingly, our Arabidopsis results are more
in line with the maize d8 association genetics experiments
performed by Andersen et al. (2005) suggesting that earlier
flowering is correlated with short plants.
Transgenic Arabidopsis expressing chimeric d9/D9-1 coding
sequences from the MS-S2A promoter show that a single amino
acid polymorphism alters both stature and flowering time.
Although a non-DELLA promoter was used in these experiments, the promoter was a constant in all experiments and
expression levels were similar between events. Since it has been
shown that different, non-mutant DELLA proteins act similarly
when controlled by the same promoter (Gallego-Bartolome
et al. 2010), we believe that our results with the various maize
DELLA mutants from a constant promoter are valid. The E600K
mutation found in D9-1 is both necessary and sufficient to
cause dwarfing of stems and siliques as well as to hasten flowering in transgenic Arabidopsis. None of the other five polymorphisms in D9-1 causes statistically significant dwarfing or
flowering time changes, indicating that these positions might
not have a significant role in protein–protein interactions.
This E600K polymorphism is in a residue that is conserved
between all Arabidopsis, B. rapa, barley, rice wheat and maize
DELLA proteins, although it is not well conserved in other GRAS
domain proteins. Significantly, a recent patent discloses the
B. napus BZH dwarfing mutation as an E546K change (Renard
et al. 2002) at the corresponding residue to the D9 E600K. This
analogous BZH mutation corroborates our finding that the D9
E600K mutation is responsible for dwarfing in D9-1 plants.
C-terminal dwarfing mutations are relatively rare, and these
represent only the second and third GRAS domain mutations
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
1863
S. J. Lawit et al.
causing dwarfing after the Brassica Brrga1-d Q328R mutation
(Muangprom et al. 2005). The Brrga1-d Q328R mutation
leads to an inability of the F-box protein SLY1 to interact with
the DELLA protein, enhancing the stability of the protein in the
presence of gibberellin. Dill et al. (2004) demonstrated that the
C-terminal 64 amino acids of GAI are required for interaction
with SLY1. Thus, disruption of an interaction with a SLY1/GID2
ortholog is a possible mechanism for gibberellin insensitivity in
the D9-1 mutant and the B. napus BZH mutant. In the absence
of three-dimensional structures of DELLA domain proteins, it is
hard to predict which amino acids are important for specific
interactions, and investigations such as these can throw more
light in this direction.
The flowering time results obtained with D9-1 in maize were
the opposite of the Arabidopsis results. The maize results were
consistent with the observations of Tyler et al. (2004) and
Winkler and Freeling (1994) that dwarfing correlated with later
flowering in Arabidopsis and maize, respectively. Winkler and
Freeling (1994) observed that dominant DELLA mutations
cause a 3–6 d delay in flowering, roughly equivalent to the
approximately one-node difference observed in the MS-S2a
PRO:D9-1 maize transgenics. Thus, the delay of flowering in
maize appears to be linked to dwarfing; however, our node
count results challenge a hypothesis that this is simply a delay
of inflorescence emergence.
Compared with the D9-1 transgenics, the d9 transgenic
maize flowered earlier with no alteration of stature. The cause
of this earlier maturity is unknown; however, it is hypothesized
to be related to the d9 indel region. This d9 indel corresponds
to the location of the d8 two amino acid indel that was associated with earlier flowering (Thornsberry et al. 2001, Andersen
et al. 2005, Camus-Kulandaivelu et al. 2006). Testing of the
chimeric d9/D9-1 coding sequences in transgenic maize will be
necessary to dissect the nature of the earlier flowering observed
with the d9 allele. However, it cannot be ruled out that the
flowering time alterations may be a novel function caused by
ectopic expression of the DELLA proteins from the MS-S2A
promoter.
Summary
Our experiments support the hypothesis that the DELLA proteins are at the crux of a number of developmental control
pathways (Achard et al. 2003, Fu and Harberd 2003, Vriezen
et al. 2004). Not only is plant organ size regulated by the maize
DELLA proteins, but flowering time control is also clearly demonstrated by these structural alleles. Transgenic Arabidopsis
carrying GUS, d8, D8-Mpl, D8-1, d9 and D9-1 varied in numerous
morphological and developmental characteristics. Significantly,
the D9-1 plants had a more moderate dwarfing effect than
D8-Mpl which was the mildest dwarfing DELLA allele previously
characterized from maize. The D9-1 allele also led to earlier
flowering in transgenic Arabidopsis. Both the dwarfing and earlier flowering were shown to be caused by the E600K mutation
of D9-1, a shared amino acid change with the semi-dwarfing
B. napus BZH protein. Surprisingly, the D9-1 flowering time
1864
effect is reversed in maize, with D9-1 causing later flowering,
but maintaining the dwarf phenotype. Furthermore, the d9
allele, while not linked to Arabidopsis flowering or maize dwarfing, caused earlier flowering in maize transgenics. This finding
suggests possible differences in mechanisms between monocots and dicots in DELLA protein control of flowering time.
While these results show direct regulation of flowering time
by DELLA proteins, the implicated residues are more varied
than just the two amino acid indel suggested by previous
researchers (Thornsberry et al. 2001, Andersen et al. 2005,
Camus-Kulandaivelu et al. 2006).
Materials and Methods
Cloning of D9 and D9-1
Total RNA was extracted from roots and kernels of Z. mays
L. cv. B73 (Russell 1972) using an RNeasy Plant Mini Kit (Qiagen).
Genomic DNA and total RNA were extracted from shoots of
GA3-insensitive D9/+ xB73 plants [harboring the ethyl methanesulfonate (EMS)-induced D*-2319 allele] 17 days after germination (DAG) (Neuffer 1990) using a DNeasy Plant Mini Kit
(Qiagen, USA) and RNeasy Plant Mini Kit, respectively.
ThermoScript reverse transcriptioin (Invitrogen) was used for
first-strand cDNA synthesis with oligo(dT)20 according to the
manufacturer's instructions. The wild-type d9 allele was
isolated by RT–PCR from these B73 RNA preparations using
primers based on a proprietary EST contig (PCO554925). The
D9-1 allele was isolated by PCR from genomic DNA isolated
from gibberellin-unresponsive D9-1xB73 seedlings (Fig. 1).
To ensure that the correct coding sequence was obtained for
D9-1, the cDNA was verified by RT–PCR. All PCRs for cloning
were carried out using the GC-Rich PCR System (Roche
Diagnostics GmbH) with 1 M Resolution Solution.
The d8, D8-Mpl, D8-1, d9 and D9-1 coding sequences were
subcloned into pDONR221 by way of PCRs and BP Clonase
(Invitrogen). The coding sequences were amplified with
5′ primers with attB1 sites and a proximal sequence CA
upstream of the start codon. The 3′ primers omitted the
stop codon and contained (in the reverse complement
orientation) a T followed by the attB2 site. All entry clones were
confirmed by full insert sequencing.
Mapping of d9
In order to be sure that the newly isolated cDNAs originated
from a locus other than d8, genomic mapping of the new
sequence was performed. BAC clones from two BAC libraries
derived from maize B73 were screened using PCR. The libraries
were previously constructed by partial digestion of genomic
DNA and inserted in the BamHI and EcoRI sites of pCUGI
(Tomkins et al. 2002) and pTARBAC (pTARBAC2.1 library;
Osoegawa et al. 2001). A set of 36 four-dimensional superpools
of these maize BAC libraries was screened by PCR (superpools
made for Pioneer/DuPont by Amplicon Express, USA). Each
superpool was derived after the independent growth, isolation
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
Maize DELLA protein dwarf plant9
and pooling of 4608 clones, >165,000 arrayed BAC clones in
total. Superpools were subject to PCRs, followed by fragment
plus–minus determination in agarose gel electrophoresis. PCR
primers were designed from AZM4_59314 (forward primer
PHN84428, GCTGCTACTACTAGTTGCCTTGCTCGCTTC, and
reverse primer GTACTCGCGCTTCATGATCTCGGAGCTAC)
to amplify a 204 bp fragment. PCRs were performed with 5 ng of
template DNA in a 10 µl reaction that included 5 µl of Hotstar
Taq Polymerase Mix (Qiagen) and 5 pmol of the forward and
reverse primers. Cycle conditions were an initial denaturation
step at 95°C for 15 min, followed by 35 cycles of 95°C for 30 s,
60°C for 30 s and 72°C for 1 min. A second round of PCR was
performed in matrix plates consisting of lower complexity combinatorial pools derived from clones represented in positive
pools. This narrowed down the positives to particular clones.
Clone bacb.pk425.i4 was identified and confirmed by PCR
analysis.
To identify the maize chromosome harboring the putative
d9 gene, oat maize addition lines (Kynast et al. 2001, Okagaki
et al. 2001), obtained from H. W. Rines and R. L. Phillips at the
University of Minnesota, were screened for the presence of
d8 and d9 by PCR with EX-TAQ (TAKARA BIO INC/). The following primers were used: d8 screening forward (CTGCAAC
CGGAGGGCGATGACACGGATGAC); d8 screening reverse
(CGTACGTGTGCCTTGATCGGCGTCCAGAAG); d9 screening
forward PHN84428; and d9 screening reverse (CGAACCCGT
CATCAGCGGTGGGGCAG).
Expression profiles of d8 and d9
A DuPont MPSS (Brenner et al. 2000a, Brenner et al. 2000b)
gene expression database developed in collaboration with
Solexa, Inc. and comprised of 385 different samples was queried
with the d8 and d9 cDNA sequences. The MPSS technology
quantifies the number of occurrences of 17 bp sequences in
populations of 2 × 105 to 2 × 106 cDNAs. These 17 bp signature
sequences very frequently correspond to unique cDNAs
(Christensen et al. 2003); however, in the case of d8 and d9
there was some overlap. The primary tag of d8 (GATCCCGT
CAAGTATGG) appears to be unique; however, the tertiary
tag in the d8 sequence (GATCGGCCTGTGTTCGT) corresponds
to the primary tag of d9. Unless alternative splicing or alternative termination occurs (neither of which have been observed
for d8), the primary tag should be the only tag representing a
given gene since the technique is designed to select the 3′-most
tag from the cDNA. With the exception of the tertiary tag of d8,
only the primary tags of d8 and d9 were found in significant
abundance in the DuPont database. While it cannot be ruled
out that the d8 tertiary tag contributed to the d9 signature
reported herein, it is considered to be unlikely.
Subcellular localization
To determine the subcellular localization of the maize DELLA
proteins, GFP fusion proteins were produced using the monomeric AcGFP1 (Matz et al. 1999; Clontech) driven by the maize
ubiquitin promoter (UBI PRO). Tungsten particles were coated
with the following MultiSite Gateway-adapted (Invitrogen)
Japan Tobacco intermediate constructs (Hiei et al. 1994,
Ishida et al. 1996): PHP23800, attB4:UBI PRO:attB1:d8:
attB2:AC-GFP1:NOS TERM:attB3; or PHP25355, attB4:UBI
PRO:attB1:d9:attB2:AC-GFP1:NOS TERM:attB3. Degradation
data were obtained from cells bombarded with PHP24291,
attB4:UBI PRO:attB1:AC-GFP1: attB2:d8:NOS TERM:attB3;
PHP26800, attB4:UBI PRO:attB1:AC-GFP1: attB2:D8-Mpl:NOS
TERM:attB3; or PHP26801, attB4:UBI PRO:attB1:AC-GFP1:
attB2:D8-1:NOS TERM:attB3. Each of these constructs contains
a second plant transcriptional unit, ZM-UBI PRO:MOPAT:DSRED EXPRESS:PIN II TERM, as an internal control. This ubiquitin
promoter-driven DsRED (Bevis and Glick 2002; Clontech)
served as an internal control and cytoplasmic marker. At 3 DAG
in the dark at room temperature, proprietary maize inbred N46
etiolated seedlings were particle bombarded with the above
constructs using a BIOLISTIC PDS-1000/He Particle Delivering
System (BioRad) and 650 p.s.i. rupture disks. The etiolated
seedlings were returned to recover in the dark for 3 d at room
temperature. At 6 DAG, the AcGFP1-positive coleoptile cells
were visualized with a CARV spinning disk confocal microscope
(Fryer Company). Fluorescence intensity data were collected
using MetaMorph Offline v6.1 (Molecular Devices Corporation).
Transgenics
Arabidopsis thaliana ecotype Columbia plants were transformed by Agrobacterium dip using the protocol of Clough and
Bent (1998). Transgenic Z. mays L. cv. HI-IIxGaspe Flint were
produced by the method described by Zhao et al. (2002).
All coding sequences were driven by the MS-S2A promoter
(Abrahams et al. 1995). The MS-S2A promoter was chosen for
its vascular expression preference, moderate expression level in
both Arabidopsis and maize, and public source intellectual
property. Agrobacterium tumefaciens strain LBA4404 carrying
the following Japan Tobacco co-integrates (Hiei et al. 1994,
Ishida et al. 1996) was used in the transformations: PHP26881,
attB4:MS-S2A PRO:attB1:GUS:attB2:NOS TERM:attB4; PHP26882,
attB4:MS-S2A PRO:attB1:D8-1:attB26 : xHA TAG:NOS TERM:attB3;
PHP26883, attB4:MS-S2A PRO:attB1:D9-1:attB26 : xHA TAG:NOS
TERM:attB3; PHP26959, attB4:MS-S2A PRO:attB1:d9:attB26 : xHA
TAG:NOS TERM:attB3; PHP26997, attB4:MS-S2A PRO:attB1:d8:
attB26 : xHA TAG:NOS TERM:attB3; and PHP27003, attB4:MSS2A PRO:attB1:D8-Mpl:attB26 : xHA TAG:NOS TERM:attB3. T1
plants were selected at 5 DAG by 0.58 mM glufosinate spray
(Finale Herbicide; Farnam Companies) and observed for
dwarf phenotypes. T2 plants were grown from seed collected
from representative T1 plants and also selected by glufosinate
spray at 5 DAG. For T1 selection, plants were grown with 18 h
days on an ArabiSun cart lighting system (Lehle Seeds). The
T2 generation was grown in a Conviron growth chamber with
16 h days and 50% relative humidity, at 24°C. The T3 generation
was grown in a Conviron ATC60 chamber with 16 h days,
60% relative humidity, 22°C with automated subirrigation
for 700 s every fourth day. An average of 20 homozygous T3
plants representing three events from each construct were
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
1865
S. J. Lawit et al.
morphometrically evaluated at principal growth stage 8.00
(Boyes et al. 2001). Days to flowering was evaluated as days
after germination required to reach growth stage 5.10 (Boyes
et al. 2001).
For vertical plate assays, T2 seedlings were grown on 1×
Murashige and Skoog salts, 3 g l−1 sucrose, 1% phytagel with
14.5 µM glufosinate in square Petri plates (Nalgene Nunc
International). At 10 d of growth on an ArabiSun cart lighting
system with 18 h days, the plates were photographed with
transillumination. The images were analyzed for total root
length with WinRHIZO V. 2005c software (Regent Instruments).
Root branches were analyzed visually. An average of 36 plants
representing each construct were analyzed at principal growth
stage 1.03 (Boyes et al. 2001).
Total RNA was extracted using the E-Z 96 Plant RNA kit
(Omega Bio-Tek, Inc.) from plants grown in vertical plate
assays. RNA was reverse transcribed with a QuantiTect Reverse
Transcription Kit (Qiagen) according to the manufacturer's
instructions for GC-rich templates. Quantitative PCRs were
performed in triplicate with a Bio-Rad iCycler, using iQ SYBR
Green Supermix (Bio-Rad). The same primer pair was used for
all transgenes (forward CTCCGTACCCAGCTTTCTTG; reverse
CGTATGGGTAGCTGGTGGAT). Arabidopsis internal control
primers for a stably expressed reference gene, At4g33380,
identified by Czechowski et al. (2005) were utilized for normalization of gene expression data. No-template controls, negative
controls with wild-type Arabidopsis cDNA template, and
positive controls with plasmid template were included in
each PCR plate.
Chimeric d9/D9-1 transgenics
To determine the amino acid residues responsible for the
stature and flowering time changes caused by D9-1, 10 sets of
chimeric d9/D9-1 transgenic Arabidopsis were created. Double
restriction digests were performed on the d9 and D9-1 entry
clones in the pDONR221 backbone using the appropriate
restriction enzymes. DNA fragments were isolated and ligated
to the complementary recipient fragment to produce the
domain-swapped entry clones. Japan Tobacco intermediates,
co-integrates and Arabidopsis transgenics were created as
described above. An average of 16.3 plants were analyzed at the
T1 stage for each chimeric construct. Days to flowering and
rosette leaves at flowering were evaluated at principal growth
stage 5.10 (Boyes et al. 2001). Rosette diameter, height, silique
length and silique width were measured at principal growth
stage 8.00.
In silico DELLA protein analysis
DELLA protein sequences were analyzed computationally
using the Vector NTI suite (Invitrogen), PREDATOR and other
proprietary prediction algorithms.
Accession numbers
Sequence data from this article can be found in the EMBL/
GenBank data libraries under accession numbers DQ903073
1866
and DQ903074. The d9 gene and variations thereof are covered
in US Patent 7,557,266, and World Intellectual Property
Organization application WO2007124312A2.
Material transfers
Novel materials described in this publication that are completely and solely owned by Pioneer will be available for noncommercial research purposes upon acceptance and signing of
a Pioneer material transfer agreement. Some of the materials
described may contain or be derived from materials obtained
from a third party. In such cases, distribution of material will be
subject to the requisite permission from any third-party owners,
licensors or controllers of all or parts of the material. Obtaining
any permissions will be the sole responsibility of the requestor.
Plant germplasm and transgenic material will not be made
available except at the discretion of the owner and then only in
accordance with all applicable governmental regulations.
Supplementary data
Supplementary data are available at PCP online.
Acknowledgments
The authors are grateful to Nicholas Harberd, Guru Rao,
Jon Duvick, Tim Helentjaris, Odd-Arne Olsen, Xiaomu Niu
and April Agee for their helpful input and discussions.
We would also like to thank Justin Hazebroek, Joanie Phillips,
Nichole Schneider, Eric Caswell, Kanwarpal Dhugga, Bruce
Drummond, Jennifer Chung, Lisa Schwartz and Jessica Kaiser
for their technical assistance. Mike Muszynski, Victor Llaca
and Evgueni Ananiev kindly provided the D9 germplasm,
unpublished BAC library screening data and oat–maize
addition line DNA, respectively.
References
Abrahams, S., Hayes, C.M. and Watson, J.M. (1995) Expression patterns
of three genes in the stem of lucerne (Medicago sativa). Plant Mol.
Biol. 27: 513–528.
Achard, P., Liao, L., Jiang, C., Desnos, T., Bartlett, J., Fu, X., et al. (2007)
DELLAs contribute to plant photomorphogenesis. Plant Physiol.
143: 1163–1172.
Achard, P., Vriezen, W.H., Van Der Straeten, D. and Harberd, N.P. (2003)
Ethylene regulates arabidopsis development via the modulation
of DELLA protein growth repressor function. Plant Cell 15:
2816–2825.
Alvey, L. and Harberd, N.P. (2005) DELLA proteins: integrators
of multiple plant growth regulatory inputs? Physiol. Plant. 123:
153–160.
Ananiev, E.V., Riera-Lizarazu, O., Rines, H.W. and Phillips, R.L. (1997)
Oat–maize chromosome addition lines: a new system for mapping
the maize genome. Proc. Natl Acad. Sci. USA 94: 3524–3529.
Andersen, J.R., Schrag, T., Melchinger, A.E., Zein, I. and Lubberstedt, T.
(2005) Validation of Dwarf8 polymorphisms associated with
flowering time in elite European inbred lines of maize (Zea mays L.).
Theor. Appl. Genet. 111: 206–217.
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
Maize DELLA protein dwarf plant9
Asano, K., Hirano, K., Ueguchi-Tanaka, M., Angeles-Shim, R.B.,
Komura, T., Satoh, H., et al. (2009) Isolation and characterization of
dominant dwarf mutants, Slr1-d, in rice. Mol. Genet. Genomics 281:
223–231.
Bevis, B.J. and Glick, B.S. (2002) Rapidly maturing variants of the
Discosoma red fluorescent protein (DsRed). Nat. Biotechnol. 20:
83–87.
Boyes, D.C., Zayed, A.M., Ascenzi, R., McCaskill, A.J., Hoffman, N.E.,
Davis, K.R., et al. (2001) Growth stage-based phenotypic analysis of
Arabidopsis: a model for high throughput functional genomics in
plants. Plant Cell 13: 1499–1510.
Brenner, S., Johnson, M., Bridgham, J., Golda, G., Lloyd, D.H., Johnson, D.,
et al. (2000a) Gene expression analysis by massively parallel signature
sequencing (MPSS) on microbead arrays. Nat. Biotechnol. 18:
630–634.
Brenner, S., Williams, S.R., Vermaas, E.H., Storck, T., Moon, K.,
McCollum, C., et al. (2000b) In vitro cloning of complex mixtures of
DNA on microbeads: physical separation of differentially expressed
cDNAs. Proc. Natl Acad. Sci. USA 97: 1665–1670.
Camus-Kulandaivelu, L., Veyrieras, J.B., Madur, D., Combes, V.,
Fourmann, M., Barraud, S., et al. (2006) Maize adaptation to
temperate climate: relationship between population structure
and polymorphism in the Dwarf8 gene. Genetics 172: 2449–2463.
Cassani, E., Bertolini, E., Badone, F.C., Landoni, M., Gavina, D.,
Sirizzotti, A., et al. (2009) Characterization of the first dominant
dwarf maize mutant carrying a single amino acid insertion in the
VHYNP domain of the dwarf8 gene. Mol. Breed. 24: 375–385.
Chandler, P.M., Marion-Poll, A., Ellis, M. and Gubler, F. (2002) Mutants
at the Slender1 locus of barley cv Himalaya. Molecular and
physiological characterization. Plant Physiol. 129: 181–190.
Cheng, H., Qin, L., Lee, S., Fu, X., Richards, D.E., Cao, D., et al. (2004)
Gibberellin regulates Arabidopsis floral development via suppression
of DELLA protein function. Development 131: 1055–1064.
Christensen, T.M., Vejlupkova, Z., Sharma, Y.K., Arthur, K.M.,
Spatafora, J.W., Albright, C.A., et al. (2003) Conserved subgroups
and developmental regulation in the monocot rop gene family.
Plant Physiol. 133: 1791–1808.
Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J. 16: 735–743.
Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K. and Scheible, W.R.
(2005) Genome-wide identification and testing of superior reference
genes for transcript normalization in Arabidopsis. Plant Physiol.
139: 5–17.
de Lucas, M., Daviere, J.-M., Rodriguez-Falcon, M., Pontin, M.,
Iglesias-Pedraz, J.M., Lorrain, S., et al. (2008) A molecular framework
for light and gibberellin control of cell elongation. Nature 451:
480–484.
Dill, A., Thomas, S.G., Hu, J., Steber, C.M. and Sun, T.-p. (2004)
The Arabidopsis F-box protein SLEEPY1 targets gibberellin
signaling repressors for gibberellin-induced degradation. Plant Cell
16: 1392–1405.
Feiffer, A. and Koch, J. (2007) Winter Canola: Semi Dwarf Varieties
Coming Up. pp. 151–157. American Society of Agricultural and
Biological Engineers, St. Joseph, MI.
Feng, S., Martinez, C., Gusmaroli, G., Wang, Y., Zhou, J., Wang, F., et al.
(2008) Coordinated regulation of Arabidopsis thaliana development
by light and gibberellins. Nature 451: 475–479.
Ferreira, F.J. and Kieber, J.J. (2005) Cytokinin signaling. Curr. Opin. Plant
Biol. 8: 518.
Finkelstein, R.R. (2006) Studies of abscisic acid perception finally flower.
Plant Cell 18: 786–791.
Fleck, B. and Harberd, N.P. (2002) Evidence that the Arabidopsis
nuclear gibberellin signalling protein GAI is not destabilised by
gibberellin. Plant J. 32: 935–947.
Fu, X. and Harberd, N.P. (2003) Auxin promotes Arabidopsis root
growth by modulating gibberellin response. Nature 421: 740–743.
Fu, X., Richards, D.E., Fleck, B., Xie, D., Burton, N. and Harberd, N.P.
(2004) The Arabidopsis mutant sleepy1gar2-1 protein promotes
plant growth by increasing the affinity of the SCFSLY1 E3 ubiquitin
ligase for DELLA protein substrates. Plant Cell 16: 1406–1418.
Gallego-Bartolome, J., Minguet, E.G., Marin, J.A., Prat, S., Blazquez, M.A.
and Alabadi, D. (2010) Transcriptional diversification and functional
conservation between DELLA proteins in Arabidopsis. Mol. Biol.
Evol. 27: 1247–1256.
Gomi, K., Sasaki, A., Itoh, H., Ueguchi-Tanaka, M., Ashikari, M.,
Kitano, H., et al. (2004) GID2, an F-box subunit of the SCF E3
complex, specifically interacts with phosphorylated SLR1 protein
and regulates the gibberellin-dependent degradation of SLR1 in rice.
Plant J. 37: 626–634.
Griffiths, J., Murase, K., Rieu, I., Zentella, R., Zhang, Z.L., Powers, S.J., et al.
(2006) Genetic characterization and functional analysis of the GID1
gibberellin receptors in Arabidopsis. Plant Cell 18: 3399–3414.
Gruis, D.F., Guo, H., Selinger, D., Tian, Q. and Olsen, O.A. (2006) Surface
position, not signaling from surrounding maternal tissues, specifies
aleurone epidermal cell fate in maize. Plant Physiol. 141: 898–909.
Gubler, F., Chandler, P.M., White, R.G., Llewellyn, D.J. and Jacobsen, J.V.
(2002) Gibberellin signaling in barley aleurone cells. Control of SLN1
and GAMYB expression. Plant Physiol. 129: 191–200.
Harberd, N.P., Belfield, E. and Yasumura, Y. (2009) The angiosperm
gibberellin-GID1-DELLA growth regulatory mechanism: how an
‘inhibitor of an inhibitor’ enables flexible response to fluctuating
environments. Plant Cell 21: 1328–1339.
Harberd, N.P. and Freeling, M. (1989) Genetics of dominant gibberellininsensitive dwarfism in maize. Genetics 121: 827–838.
Haywood, V., Yu, T.S., Huang, N.C. and Lucas, W.J. (2005) Phloem longdistance trafficking of GIBBERELLIC ACID-INSENSITIVE RNA regulates
leaf development. Plant J. 42: 49–68.
Hiei, Y., Ohta, S., Komari, T. and Kumashiro, T. (1994) Efficient
transformation of rice (Oryza sativa L.) mediated by Agrobacterium
and sequence analysis of the boundaries of the T-DNA. Plant J. 6:
271–282.
Hirano, K., Ueguchi-Tanaka, M. and Matsuoka, M. (2008) GID1-mediated
gibberellin signaling in plants. Trends Plant Sci. 13: 192–199.
Huang, S., Cerny, R.E., Qi, Y., Bhat, D., Aydt, C.M., Hanson, D.D., et al.
(2003) Transgenic studies on the involvement of cytokinin and
gibberellin in male development. Plant Physiol. 131: 1270–1282.
Huq, E. (2006) Degradation of negative regulators: a common theme
in hormone and light signaling networks? Trends Plant Sci. 11: 4.
Hussain, A., Cao, D., Cheng, H., Wen, Z. and Peng, J. (2005) Identification
of the conserved serine/threonine residues important for gibberellinsensitivity of Arabidopsis RGL2 protein. Plant J. 44: 88–99.
Ikeda, A., Ueguchi-Tanaka, M., Sonoda, Y., Kitano, H., Koshioka, M.,
Futsuhara, Y., et al. (2001) slender Rice, a constitutive gibberellin
response mutant, is caused by a null mutation of the SLR1 gene, an
ortholog of the height-regulating gene GAI/RGA/RHT/D8. Plant Cell
13: 999–1010.
Ishida, Y., Saito, H., Ohta, S., Hiei, Y., Komari, T. and Kumashiro, T.
(1996) High efficiency transformation of maize (Zea mays L.)
mediated by Agrobacterium tumefaciens. Nat. Biotechnol. 14: 745–750.
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.
1867
S. J. Lawit et al.
Israelsson, M., Sundberg, B. and Moritz, T. (2005) Tissue-specific
localization of gibberellins and expression of gibberellin-biosynthetic
and signaling genes in wood-forming tissues in aspen. Plant J. 44:
494–504.
Itoh, H., Ueguchi-Tanaka, M. and Matsuoka, M. (2008) Molecular
biology of gibberellins signaling in higher plants. Int. Rev. Cell Mol.
Biol. 268: 191–221.
Itoh, H., Ueguchi-Tanaka, M., Sato, Y., Ashikari, M. and Matsuoka, M.
(2002) The gibberellin signaling pathway is regulated by the
appearance and disappearance of SLENDER RICE1 in nuclei. Plant
Cell 14: 57–70.
Klein, T.M., Fromm, M., Weissinger, A., Tomes, D., Schaaf, S., Sletten, M.,
et al. (1988) Transfer of foreign genes into intact maize cells
with high-velocity microprojectiles. Proc. Natl Acad. Sci. USA 85:
4305–4309.
Kynast, R.G., Riera-Lizarazu, O., Vales, M.I., Okagaki, R.J., Maquieira, S.B.,
Chen, G., et al. (2001) A complete set of maize individual chromosome
additions to the oat genome. Plant Physiol. 125: 1216–1227.
Lawrence, C.J., Seigfried, T.E. and Brendel, V. (2005) The Maize Genetics
and Genomics Database. The community resource for access to
diverse maize data. Plant Physiol. 138: 55–58.
Lorenzo, O. and Solano, R. (2005) Molecular players regulating the
jasmonate signalling network. Curr. Opin. Plant Biol. 8: 532.
Matz, M.V., Fradkov, A.F., Labas, Y.A., Savitsky, A.P., Zaraisky, A.G.,
Markelov, M.L., et al. (1999) Fluorescent proteins from
nonbioluminescent Anthozoa species. Nat. Biotechnol. 17: 969–973.
Muangprom, A., Thomas, S.G., Sun, T.P. and Osborn, T.C. (2005)
A novel dwarfing mutation in a green revolution gene from Brassica
rapa. Plant Physiol. 137: 931–938.
Nakajima, M., Shimada, A., Takashi, Y., Kim, Y.-C., Park, S.-H., UeguchiTanaka, M., et al. (2006) Identification and characterization of
Arabidopsis gibberellin receptors. Plant J. 46: 880–889.
Neuffer, M. (1990) Location and description of dominant dwarf
mutants. MNL 64: 51.
Ogawa, M., Kusano, T., Katsumi, M. and Sano, H. (2000) Rice gibberellininsensitive gene homolog, OsGAI, encodes a nuclear-localized
protein capable of gene activation at transcriptional level. Gene
245: 21–29.
Okagaki, R.J., Kynast, R.G., Livingston, S.M., Russell, C.D., Rines, H.W.
and Phillips, R.L. (2001) Mapping maize sequences to chromosomes
using oat–maize chromosome addition materials. Plant Physiol. 125:
1228–1235.
Osoegawa, K., Li Shu, C., Zhu, B., Gardner, J., Geary, T., Antezak, D., et al.
(2001) Construction of new maize, bovine, equine and zebrafish bac
libraries. In Plant and Animal Genome Conference IX Proceedings,
San Diego, CA.
Peng, J., Carol, P., Richards, D.E., King, K.E., Cowling, R.J., Murphy, G.P.,
et al. (1997) The Arabidopsis GAI gene defines a signaling pathway
that negatively regulates gibberellin responses. Genes Dev. 11:
3194–3205.
Peng, J., Richards, D.E., Hartley, N.M., Murphy, G.P., Devos, K.M.,
Flintham, J.E., et al. (1999) ‘Green revolution’ genes encode mutant
gibberellin response modulators. Nature 400: 256–261.
Renard, M., Delourme, R., Barret, P., Brunel, D., Froger, N. and
Tanguy, X. (2002) Mutant gene of the GRAS family and plants with
reduced development containing said mutant gene. US patent
7,645,920 B1.
1868
Russell, W.A. (1972) Registration of B70 and B73 parental lines of maize
(Reg. Nos. PL16 and PL17). Crop Sci. 12: 721.
Sasaki, A., Itoh, H., Gomi, K., Ueguchi-Tanaka, M., Ishiyama, K.,
Kobayashi, M., et al. (2003) Accumulation of phosphorylated
repressor for gibberellin signaling in an F-box mutant. Science 299:
1896–1898.
Silverstone, A.L., Ciampaglio, C.N. and Sun, T. (1998) The Arabidopsis
RGA gene encodes a transcriptional regulator repressing the
gibberellin signal transduction pathway. Plant Cell 10: 155–169.
Silverstone, A.L., Jung, H.S., Dill, A., Kawaide, H., Kamiya, Y., Sun, T.P., et al.
(2001) Repressing a repressor: gibberellin-induced rapid reduction of
the RGA protein in Arabidopsis. Plant Cell 13: 1555–1566.
Silverstone, A.L., Mak, P.Y., Martinez, E.C. and Sun, T.P. (1997) The new
RGA locus encodes a negative regulator of gibberellin response in
Arabidopsis thaliana. Genetics 146: 1087–1099.
Strader, L.C., Ritchie, S., Soule, J.D., McGinnis, K.M. and Steber, C.M.
(2004) Recessive-interfering mutations in the gibberellin signaling
gene SLEEPY1 are rescued by overexpression of its homologue,
SNEEZY. Proc. Natl Acad. Sci. USA 101: 12771–12776.
Thornsberry, J.M., Goodman, M.M., Doebley, J., Kresovich, S., Nielsen, D.
and Buckler, E.S.T. (2001) Dwarf8 polymorphisms associate with
variation in flowering time. Nat. Genet. 28: 286–289.
Tomkins, J.P., Davis, G., Main, D., Yim, Y., Duru, N., Musket, T., et al.
(2002) Construction and characterization of a deep-coverage
bacterial artificial chromosome library for maize. Crop Sci 42:
928–933.
Tyler, L., Thomas, S.G., Hu, J., Dill, A., Alonso, J.M., Ecker, J.R., et al. (2004)
DELLA proteins and gibberellin-regulated seed germination and
floral development in Arabidopsis. Plant Physiol. 135: 1008–1019.
Ueguchi-Tanaka, M., Ashikari, M., Nakajima, M., Itoh, H., Katoh, E.,
Kobayashi, M., et al. (2005) GIBBERELLIN INSENSITIVE DWARF1
encodes a soluble receptor for gibberellin. Nature 437: 693.
Ueguchi-Tanaka, M., Hirano, K., Hasegawa, Y., Kitano, H. and
Matsuoka, M. (2008) Release of the repressive activity of rice DELLA
protein SLR1 by gibberellin does not require SLR1 degradation in
the gid2 mutant. Plant Cell 20: 2437–2446.
Ueguchi-Tanaka, M., Nakajima, M., Katoh, E., Ohmiya, H., Asano, K.,
Saji, S., et al. (2007) Molecular interactions of a soluble gibberellin
receptor, GID1, with a rice DELLA protein, SLR1, and gibberellin.
Plant Cell 19: 2140–2155.
Varagona, M.J., Schmidt, R.J. and Raikhel, N.V. (1992) Nuclear
localization signal(s) required for nuclear targeting of the maize
regulatory protein Opaque-2. Plant Cell 4: 1213–1227.
Vriezen, W.H., Achard, P., Harberd, N.P. and Van Der Straeten, D. (2004)
Ethylene-mediated enhancement of apical hook formation in
etiolated Arabidopsis thaliana seedlings is gibberellin dependent.
Plant J. 37: 505–516.
Wen, C.-K. and Chang, C. (2002) Arabidopsis RGL1 encodes a negative
regulator of gibberellin responses. Plamt Cell 14: 87–100.
Winkler, R.G. and Freeling, M. (1994) Physiological genetics of the
dominant gibberellin-nonresponsive maize dwarfs, Dwarf8 and
Dwarf9. Planta 193: 341–348.
Winkler, R. and Helentjaris, T. (1993) Dominant dwarfs. MNL 67:
110–111.
Zhao, Z.Y., Gu, W.N., Cai, T.S., Tagliani, L., Hondred, D., Bond, D.,
et al. (2002) High throughput genetic transformation mediated by
Agrobacterium tumefaciens in maize. Mol. Breed. 8: 323–333.
Plant Cell Physiol. 51(11): 1854–1868 (2010) doi:10.1093/pcp/pcq153 © The Author 2010.