Download Human Prolactin Gene Expression: Positive Correlation between

Human Prolactin Gene Expression:
Positive Correlation between SiteSpecific Methylation and Gene
Activity in a Set of Human Lymphoid
Cell Lines*
Birgit Gellersen and Rita Kempf
Institute for Hormone and Fertility Research
2000 Hamburg 54, Federal Republic of Germany
(mC) (1). The vast majority of modified bases occur in
the sequence CpG resulting in 50-70% of these dinucleotides being methylated, depending on the species
and the tissue (2). The methylation pattern of a given
gene has been postulated to be involved in determining
transcriptional activity. In most reports concerning DNA
methylation and gene activity, a correlation between
hypomethylation, in particular in the 5'-flanking region
of genes, and gene activity has been demonstrated.
This interrelationship, however, cannot be generalized
since a number of genes have either been found to be
extensively methylated though at the same time efficiently transcribed or to remain silent after chemically
induced demethylation (2, 3). Methylation seems to
convey a permissive function rather than being the sole
determinant in switching a gene on or off. Cells that are
preprogrammed to activate certain genes through the
course of differentiation can be induced to do so by
treatment with demethylating agents. For example, demethylation by 5-azacytidine (5-Aza) of the globin gene
in erythroid cells, predisposed to differentiate into red
blood cells, leads to activation of the gene, but fails to
do so in non-erythroid cells (4).
A tissue-specific gene that has been thoroughly studied with respect to its methylation status is the rat PRL
(rPRL) gene. Here the common paradigm of a negative
correlation between methylation and gene expression
was confirmed in vivo as well as in vitro. rPRL-negative
variants of the GH3 rat pituitary tumor cell line, generated by exposure to the DNA-alkylating agent ethyl
methanesulfonate, could be reverted into PRL-producing cells by 5-Aza (5). In a comparison of a PRL-negative
( G H ^ d ) and a PRL-positive (GH 4 d) GH subclone,
methylation of a specific CCGG sequence in the rPRL
gene was inversely related to gene expression (6). In a
study of rPRL gene methylation under physiological
conditions, the progressively increasing rPRL mRNA
levels in the pituitaries of female rats throughout gestation and lactation were correlated with reduced methylation of two CCGG sequences (7).
From the human B-lymphoblastoid cell line IM-9-P,
we derived the IM-9-P series of clonal sublines that
differ from each other in the degree of human PRL
(hPRL) production. To elucidate the mechanisms
underlying the different levels of hPRL gene activity
in these cell lines, we investigated the methylation
status of the gene, since the methylation pattern of
cytosine-residues in CpG dinucleotides has been
implicated with the transcriptional activity of eukaryotic genes. Restriction enzyme analysis of the
hPRL gene with methylation-sensitive endonucleases disclosed no correlation between the extent
of methylation and gene activity for Thai, Aval, and
Hha\ recognition sequences. Hypermethylation of a
Msp\ site (CCGG) in the second protein-coding exon,
however, was found to coincide with hPRL gene
activity. Exposure of the cells to the nucleoside 1-/9D-arabinofuranosylcytosine, which has been reported to increase enzymatic DNA-methylation, led
to an elevation of hPRL production that persisted
after removal of the drug. However, treatment of
PRL-positive cells with the demethylating cytidine
analog, 5-azacytidine, caused a distinct and heritable reduction of hPRL secretion and hPRL mRNA
abundance, concurrent with hypomethylation of the
specific Msp\ site that is hypomethylated in PRLnegative cell lines of the IM-9-P family. Contrasting
the generally favored inverse relationship between
methylation and transcriptional activity of a gene we
describe a system in which site-specific methylation
is positively correlated with gene expression. (Molecular Endocrinology 5: 1874-1886, 1991)
INTRODUCTION
In mammalian DNA 2-7% of cytosine-residues undergo
postreplicative methylation to yield 5-methylcytosine
0888-8809/90/1874-1886$02.00/0
Molecular Endocrinology
Copyright © 1990 by The Endocrine Society
We report here our investigations on the methylation
status of the human PRL (hPRL) gene in a series of cell
1874
Methylation and hPRL Gene Expression
lines with differing capacities for PRL production. These
cell lines represent a human equivalent to the well
established GH family of rat pituitary tumor-derived cell
lines (8) in that they are derived from one parental line
and present a range of PRL expression spanning from
negative through low and medium to high producing
strains. These cell lines originate from a spontaneous
variant of the PRL-nonexpressing human B-lymphoblastoid IM-9 cell line (IM-9-P), which ectopically expresses PRL (9). The secreted product is identical to
human pituitary PRL and is encoded by an elongated
PRL transcript of the decidual type (10,11). By cloning
and subcloning of IM-9-P, PRL-nonexpressing (PRL~)
and PRL-expressing (PRL+) lines were established. In
an attempt to elucidate the mechanism underlying hPRL
gene activation, this series of cell lines was used to
study the basal methylation status and the effects of
methylating and demethylating treatments in relation to
hPRL production.
RESULTS
Stability in Long-Term Culture of IM-9-P Derived
Clones and Subclones Producing Different
Amounts of PRL
Over the course of 7 months in continuous culture, the
IM-9-P cell line had gradually lost its ability to synthesize
PRL. When its PRL secretion had dropped to almost
undetectable levels the cell line was cloned to give rise
to the PRL" IM-9-P6 and the PRL+ IM-9-P3 clone (9).
After 1 yr in continuous culture, IM-9-P3 was subcloned,
resulting in exclusively PRL+ populations which however differed in their secretory capacities. Three representative subclones, IM-9-P31, IM-9-P32, and IM-9P33, were used for further analysis. The pedigree of
the seven cell lines used in this study is depicted in
Table 1. All cell lines were maintained in continuous
culture for 12 months, and every 6 weeks their PRL
secretion rates were monitored as described in Materials and Methods. The mean secretory rates obtained
from this observation period are shown in Table 1. It
should be noted that at the onset of this experiment
IM-9-P had ceased to produce detectable amounts of
PRL. All clonal lines proved to be stable with respect
to their PRL secretion rates. The different secretion
rates are not due to the maintenance of considerable
intracellular PRL pools (IM-9-P31 and IM-9-P33 cells
contain approximately 0.7 and 2 ng hPRL/106 cells,
respectively) but to the degree of hPRL gene expression as shown by Northern blot analysis (Fig. 1). The
cell lines can be divided into four groups: the PRLnegative lines IM-9, IM-9-P, and IM-9-P6, the low producer IM-9-P31, the moderate producer IM-9-P32, and
the high producers IM-9-P3 and IM-9-P33.
Methylation Status of -CCGG- Sequences in the
hPRL Gene
We used the Msp\/Hpa\\ pair of isoschizomeric restriction endonucleases to analyze the methylation status
1875
Table 1. Pedigree and hPRL Secretory Rates of IM-9
Derived Lymphoid Cell Lines
Cell line
Clone
Sutxlone
Human PRL Secretion
Rate
(nghPRL/106 cells • 24 h)
IM-9
ND*
IM-9-P
ND*
IM-9-P6
NO
IM-9-P3
63.2 ± 3.2
IM-9-P31
12.3 ± 1 . 3
IM-9-P32
44.9 ± 3.6
IM-9-P33
61.4 ± 1 . 9
IM-9-P6 and IM-9-P3 arose from cloning of IM-9-P; IM-9-P31,
IM-9-P32, and IM-9-P33 from subcloning of IM-9-P3. Human
PRL secretion rates were determined in 2-day incubations as
described in Material and Methods and represent the means
± SEM of eight consecutive experiments over the course of 1
yr in continuous culture.
a
ND, Not detectable, i.e. less than 1.6 ng hPRL/106 cells-24
h (based on the lower limit of detection of the RIA of 1 ng
hPRL/ml and an average generation time of the cells of 17.1
h).
6
IM-9-P cells originally secreted 30 ng hPRL/106 cells-24 h,
but had ceased to produce detectable amounts at the onset
of this long-term culture period.
Fig. 1. Human PRL mRNA Levels in IM-9 Derived Lymphoid
Cell Lines
The Northern blot of 50 ^g total RNA per lane, isolated from
seven cell lines, was hybridized with hPRL cDNA under high
stringency conditions as described in Materials and Methods.
Simultaneous hybridization with a /3-actin probe was performed to confirm even loading of the lanes.
of CpG dinucleotides in CCGG sequences in the hPRL
gene. Msp\ restricts CCGG irrespective of methylation
at the internal C-residue, whereas HpaII only cleaves
when this residue is unmethylated (12). Within the
published map of the hPRL gene [represented by the
11.3 kilobase (kb) EcoRI fragment in Fig. 2A] (13) five
Msp\ sites are listed. The positions of these sites are
indicated in Fig. 2A [(M), M 2 -M 5 ]. Restriction analysis
MOL ENDO-1990
1876
Vol4No. 12
A.
11.3
:
kb
Probe A
i
~i Probe B
E4
E3
(M)
M2
X3
M4M5
M,
6.0
~ " 0.7
1.9
2.5
"D.3
6.7
8.6
11.4
B.
C.
239.46.54.3-
2.3
2.0
1.35
1.07
0.87
Fig. 2. Methylation State of -CCGG- Sequences in the hPRL Gene
A, A physical map of the hPRL gene with the location of Xbal (X), Msp\ (M), and EcoRI (E) restriction sites is shown. The 11.3
kb EcoRI fragment represents the published structure of the gene (13). Exons are identified as tall black boxes. Black areas
represent sequenced; shaded areas represent unsequenced regions of the gene. Positions of X, and M, were derived from genomic
restriction analysis. Sizes of expected fragments resulting from Msp\ and tfpall digestion are given in kilobases. The presence of
the Msp\ site in intron A, indicated by brackets, could not be confirmed by us (see Fig. 3). B, Southern blot analysis of Hpall
restricted DNA from seven lymphoid cell lines and human pituitary. The blot was hybridized with probe A, a 1132 bp genomic
fragment as shown in A. Sizes of molecular weight markers (left) and restriction fragments (right) are given in kilobases. C,
Southern blot analysis of the same DNA samples as in B, but digested with Mspl. Hybridization was with probe A.
Methylation and hPRL Gene Expression
of genomic DNA revealed an additional Msp\ site (M,)
approximately 3.3 kb upstream of the 5'-£coRI site.
When genomic DNA from all seven lymphoid cell lines
and from a normal human pituitary was digested with
Hpall and subjected to Southern Blot analysis, using a
genomic fragment including the first exon of the hPRL
gene as a probe (probe A, see Fig. 2A), differences in
the methylation status of the hPRL gene between the
cell lines became apparent (Fig. 2B). The lowest degree
of methylation was seen with DNA from the PRLnegative parental IM-9 line, which displayed a predominant hPRL gene fragment of 6.7 kb, consistent with
cleavage at Mi and M2) and a trace of a 8.6 kb fragment.
DNA from IM-9-P cells and its clonal derivatives displayed, in addition to the 6.7 kb fragment, two larger
fragments of 8.6 and 11.4 kb. The proportion of the
smallest fragment was highest in the PRL~ lines IM-9P and IM-9-P6. In all PRL+ clones, the extent of methylation was distinctly higher, the 6.7 kb fragment being
undetectable in the high PRL-producing IM-9-P33 cell
line. The hPRL gene in human pituitary appears to be
hypermethylated since Hpall digestion resulted in a
smear of large fragments and released only a small
amount of the 6.7 kb component.
When the same samples were digested with Msp\,
only one fragment of 6.7 kb in length was detected in
all cases, excluding the presence of a restriction site
polymorphism at the Msp\ sites M, and M2 (Fig. 2C).
However, no 6.0 kb fragment, which would result from
cleavage at the second Msp\ site [(M) in Fig. 2A], could
be detected. To test whether the failure of Msp\ to
cleave at this site was due to RFLP between the DNAs
tested here and the human fetal liver DNA from which
the sequence of the hPRL gene and the genomic
probes had been derived (13), the genomic Xbal-EcoRI
fragment which includes this site (probe B; Fig. 2A) was
subjected to Msp\ digestion. Cleavage should generate
2 fragments of 1590 and 115 base pairs (bp), respectively. However, Mspl failed to cleave probe B. To
definitively confirm the lack of a CCGG sequence in this
area of the hPRL gene, the genomic fragment (probe
B) was sequenced from its 3'-end to yield the sequence
from the EcoRI site in intron A (E2) upstream through
the Msp\ site in question. Our sequence data reveal a
deviation from the published sequence of 22 bp beginning 97 bp 5' of E2 and extend a further 79 bp upstream
into a previously unsequenced intronic region. No Mspl
site is present in this sequence (Fig. 3).
Localization of the Hypermethylated -CCGGSequences
The size of the larger Hpall fragments (8.6 and 11.4 kb)
coincides with the predicted size of fragments stretching from M, to M3 and M-, to M5 (see Fig. 2A). To verify
the origin of these fragments, three cell lines were
chosen for further analysis: IM-9 being the parental cell
line which never expressed PRL, IM-9-P6 representing
a nonexpressing, and IM-9-P33 a high PRL-expressing
clonal derivative of the variant IM-9-P cell line. Genomic
1877
new sequence
published sequence
AAATCACTTAACCTCCCTAAGCCATCTGT
TTCATCAGTATAATTTGATGATAATTACAAAGGCCCAGTGTATCTCACAA
GGTTATTATGAAGCTCAAATATAGAAAAAAAATTTAATGTTTTTGGCGAA
i ARfBHaBACCCAAGAAGGCCAAAAGAAAAAAAATTTAATGTTTTTGGCGAA
GTGTCAAACACATGCATGGGACTATTACGAGTTAGCAGATCTAAACTACA
si GTGTCAAACACATGCATGGGACTATTACGAGTTAGCAGATCTAAACTACA
GCATTA-ioi GCATTATTTTTATGTT.
Fig. 3. Sequence Analysis of Part of Intron A of the hPRL
gene
An intronic fragment, shown as probe B in Fig. 2A, was
sequenced upstream from its 3'-5coRI end (E2 in Fig. 2A). The
derived sequence was aligned with the published sequence
(13). It extends 5' into previously unsequenced region of intron
A and reveals a deviation spanning 22 nucleotides in the
previously sequenced region. This area is underlined. The
black box emphasizes the Msp\/Hpa\\ site which is absent in
the novel sequence (bold letters). The 3'-£coRI site (E2) of the
genomic fragment is shaded. Numbering of nucleotides is
according to EMBL databank entry HUMPRL3 (accession
X00540) which lists a Hpall site in position 3.
DNA was cleaved with Xbal and further digested with
Msp\ or Hpall. Subsequent hybridization with probe B,
extending 3' of the second Xbal site, revealed truncation of the 7.1 kb Xbal fragment (X2-X3) to 2.3 kb by
Msp\ in all three DNAs (Fig. 4A). Nearly complete cleavage by Hpall, to yield the 2.3 kb component, was only
seen in IM-9 DNA. A trace of the 4.2 kb fragment (X 2 M3) points at minor methylation at M2 and corresponds
to the trace 8.6 kb fragment in Fig. 2B. IM-9-P6 DNA
displayed the 2.3 kb band, the additional 4.2 kb fragment, and very faintly a 7.1 kb fragment; in IM-9-P33
DNA the 4.2 kb and a 7.1 kb fragment were released.
This latter component is likely to result from cleavage
at X2 and M5, but cannot be resolved from the 7.1 kb
X2-X3 fragment since M5 is located only 50 nucleotides
upstream of the Xbal site. No 6.7 kb fragment representing cleavage at X2 and M4 was released. This
finding agrees with the absence of a 11.1 kb component
(MT-MA) in the Hpall digests shown in Fig. 2B.
When the same blot was hybridized with probe A
which extends 5' of the second Xbal site, the 4.6 kb
Xbal fragment appeared evenly shortened to 4.4 kb by
Msp\ and Hpall in all three cell lines (Fig. 4B). M1 is
therefore unmethylated.
Due to complete cleavage of M2 in IM-9 cell DNA by
Hpall, probes A and B were insufficient to analyze Msp\
sites 3' of M2 in this cell line. Southern blots of Msp\
and Hpall digested IM-9 DNA were therefore hybridized
with a hPRL cDNA probe extending over exon 1-4 and
part of exon 5 and containing sequence hybridizable to
every possible Msp\ fragment. Identical patterns were
obtained with Msp\ and Hpall restriction indicating absence of methylation in all sites (not shown). More
fragments than predicted were detected, obviously
originating from additional Msp\ sites in the unsequenced area of intron D (3' of M5).
Vol4No. 12
MOL ENDO-1990
1878
D Probe A
I
I Probe B
4.6
7.1
M4M5
4.4
2.3
4.2
B.
A.
P6
IM-9
P33
IM-9
P6
P33
239.4-
- * 7.1
6.5-
-
4.3-
4.6
4.4
4.2
-« 2.3
2.3-
2.0
1.35 —
x
X
'MX'H
X
X
X
x/ M x/H x x/ M x/H x x/ M x/H
'M X /H
c.
M,
o
o
6
0
©
1
1
1 1
0
©
oo
1 1
1
1
•
©
IM-9
1
1
IM-9-P6
I
]
IM-9-P33
•0
1 1
•0
Fig. 4. Southern Blot Analysis of Msp\ and Hpall Restricted Xba\ Fragments of the hPRL Gene
Twenty microgram aliquots of genomic DNA from IM-9, IM-9-P6, and IM-9-P33 cells were digested with Xba\ (X), Xba\ and Msp\
(X/M) or Xba\ and HpaII (X/H). A, The blot was hybridized with probe B. B, The blot was stripped and hybridized with probe A. The
sample in lane 2 (X/M digested IM-9 DNA) migrated more slowly than the other samples, as is obvious from the aberrant position
of the 2.3 kb band of this sample in A. The fragment detected with probe A is therefore estimated to be 4.4 kb in size rather than
4.6 kb and thus identical to the fragment in lane 3 (X/H digested IM-9 DNA). C, Analyses on the methylation state of 5 Msp\ sites
in the hPRL gene of IM-9, IM-9-P6, and IM-9-P33 cells are summarized. Open circles indicate hypomethylation, shaded circles
partial methylation, and filled circles hypermethylation of the internal C-residue in -CCGG- sequences. Numbers on top of the gene
map mark positions of triplets coding for the first and last amino acids of pre-PRL and mature PRL.
Methylation and hPRL Gene Expression
Taking these data together, the following picture
evolves (summarized in Fig. 4C): All Msp\ sites are
hypomethylated in IM-9 cells. M, is hypomethylated in
IM-9-P6 and IM-9-P33 cells. M2 is partially methylated
in IM-9-P6 cells and fully methylated in IM-9-P33 cells.
M3 is partially methylated, M4 is fully methylated, and
M5 is hypomethylated in both the IM-9-P6 and IM-9P33 DNA. The difference in methylation of -CCGGsequences between PRL-negative and PRL-positive
lines is therefore demonstrated in M2, which is located
in the second exon. Hypermethylation of this site coincides with hPRL gene expression.
Effect of 5-Aza on hPRL Gene Expression
1879
P33
P31
o
*
100
50-
0
50 500
0
50 500
5-Aza (nM)
To test whether exogenously induced hypomethylation
would affect hPRL gene expression we employed 5Aza. This pyrimidine analog is incorporated into replicating DNA, prevents methylation of the newly synthesized strand at hemimethylated sites and thus eventually leads to demethylation of previously methylated
CpG sequences (14).
Three PRL-negative and two PRL-positive cell lines
were treated with various concentrations of 5-Aza for
4 days, washed to remove the drug, and incubated for
a further 4 days in the absence of the drug. Cells were
then washed, counted, and replated for a further 2 days
to collect conditioned media and determine the growth
rates as described in Materials and Methods. 5-Aza at
a concentration of greater than or equal to 500 nM
caused a sustained growth inhibition which was still
evident 6 days after removal of the drug and increased
the doubling times of the cultures approximately 2-fold
(from 18.1 ± 0.5 h to 35.0 ± 3.4 h for IM-9-P33 cells
incubated with 500 nM 5-Aza; mean ± SEM of three
experiments). The treatment did not induce PRL secretion in the PRL" lines IM-9, IM-9-P, or IM-9-P6. PRL
secretion by the positive clones IM-9-P31 and IM-9P33, however, was reduced to 18% and 30%, respectively (Fig. 5). As an internal control, secreted immunoglobulin G (IgG) was measured in conditioned media
from untreated and treated cells. IM-9-P cells and its
clonal derivatives, as opposed to the parental B-lymphoblastoid IM-9 line (15), lack the capacity to produce
IgG (9), and treatment with 5-Aza did not induce secretion. IgG secretion from IM-9 cells, however, was stimulated 3-fold above basal levels by 500 nM 5-Aza (from
1.06 to 2.91 tig lgG/106 cells-24 h).
Northern Blot analysis revealed that the 5-Aza specific reduction of PRL secretion rates in IM-9-P31 and
IM-9-P33 cells was due to a reduction of hPRL mRNA
abundance. A dose of 500 nM, which significantly inhibited PRL secretion, effected a corresponding drop in
hPRL mRNA to 34% and 26% of control values, respectively (Fig. 6). In contrast, the expression of two
other genes was not affected in a similar manner: the
transcript levels for the cytoskeletal protein /8-actin and
for TCP1, a ubiquitous protein associated with the
cytoplasmic aspect of the trans-Golgi and like hPRL
encoded on chromosome 6 (16, 17), remained largely
Fig. 5. Effect of 5-Aza on hPRL Secretion Rates
IM-9-P31 and IM-9-P33 cells were incubated with 5-Aza for
4 days and grown for another 4 days after withdrawal of the
drug. Human PRL secretion rates were determined in a subsequent 2-day incubation and are expressed as percent of
control values. Means ± SEM of three separate experiments
are given.
unchanged in IM-9-P33 cells or were found elevated in
IM-9-P31 cells after treatment with 500 nM 5-Aza (Fig.
6). [An increase of /?-actin mRNA after application of 5Aza has been described before (18).]
We investigated next whether 5-Aza had indeed altered the methylation status of the PRL gene. DNA was
extracted from IM-9-P33 and IM-9 cells after a 4-day
treatment with the base analog, and digested with Msp\
orHpall. Southern blots were prepared and hybridized
with probe A. Msp\ released the same 6.7 kb hPRL
gene component from DNA of treated cells as seen
before for untreated cells (not shown). The fragment
profile yielded by Hpall digestion, however, demonstrated a drug-induced change in IM-9-P33 DNA (Fig.
7A). In DNA from control cells or cells treated with 50
nM 5-Aza, only the 8.6 and 11.4 kb fragments were
present. In DNA from cells treated with 500 nM 5-Aza,
however, the 6.7 kb component appeared. This was
the only fragment seen in IM-9 cell DNA exposed to
doses as high as 5 ^M. In subsequent experiments,
cells were treated with 5-Aza for 4 days and then
cultured in the absence of the drug for a further 4 days
before DNA was extracted and subjected to Hpall
restriction analysis (Fig. 7B). In the low PRL-expressing
IM-9-P31 cell line, treatment with greater than or equal
to 500 nM 5-Aza greatly increased the intensity of the
6.7 kb fragment in proportion to the larger fragments.
Correspondingly, in DNA from the high PRL-producing
IM-9-P33 cell line, occurrence of the shorter fragment
was induced by 500 nM 5-Aza, whereas this fragment
was absent in control cells. A concentration of 5-Aza
that had been shown to effectively reduce PRL secretion and PRL mRNA abundance thus indeed caused
hypomethylation of the hPRL gene in IM-9-P31 and IM9-P33 cells and created a /-/pall cleavage pattern resembling that obtained with DNA from the PRL" IM-9-P
Vol4No. 12
MOL ENDO-1990
1880
P33
P31
— B-actin
A.
— hPRL
MPft
« 0 «*»«•»
B.
50
c.
i
0
500
P33
P31
-J.
50
500
0
5-Aza (nM)
TCP1
r
^
50 500
0 50 500
5-Aza (nM)
Fig. 6. Effect of 5-Aza on hPRL mRNA Abundance
IM-9-P31 and IM-9-P33 cells were incubated with 5-Aza for
4 days and grown for another 4 days after withdrawal of the
drug. RNA was then extracted and subjected to Northern blot
analysis. A, A representative Northern blot is shown with 50
Aig (IM-9-P31) and 30 ng (IM-9-P33) total RNA per lane.
Hybridization was with a /3-actin and a hPRL cDNA probe to
yield bands of 2.2 and 1.1 kb, respectively, as estimated from
the migration of 18 S and 28 S ribosomal RNAs. B, The blot
was stripped and rehybridized with a TCP1 cDNA probe to
detect a transcript of 2.0 kb. C, Relative intensities of hPRL
mRNA signals were quantified densitometrically. Means ± SEM
from three separate experiments are given.
and IM-9-P6 cell lines (see Fig. 2B). In addition, the
hypomethylated state of the gene was inherited and
persisted in the absence of 5-Aza, since DNA extracted
from cells 4 days after a 4-day treatment period gave
identical results with DNA extracted immediately after
the treatment (compare IM-9-P33 preparations in Fig.
7, A and B).
Effect of Ara-C on hPRL Gene Expression
If in our system methylation was indeed positively correlated with PRL gene expression, hypermethylating
treatment of the cells should result in increased PRL
production. To test this hypothesis, we exposed PRL~
and PRL+ cell lines to 1-j8-D-arabinofuranosylcytosine
(Ara-C). Incorporation of its active metabolite Ara-CTP
leads to inhibition of DNA replication (19, 20). Ara-C
has also been shown to enhance enzymatic methylation
of DNA synthesized in its presence (21).
A 2-day treatment of the cell lines with Ara-C considerably inhibited proliferation of the cultures. Whereas
cell numbers of control cultures increased approximately 7-fold within 48 h, IM-9-P31 cells treated with
25 ng Ara-C/ml reached only 39 ± 6% of control
numbers (mean ± SEM of four different experiments).
Ara-C treatment did not induce PRL secretion in the
PRL" lines IM-9, IM-9-P, or IM-9-P6. However, PRL
secretion rates in the PRL+ clones IM-9-P31 and IM-9P33, calculated as the amount of PRL produced per
number of cells present during the incubation (see
Materials and Methods), was elevated to 234 ± 16%
and 185 ± 16% of control values, respectively (means
± SEM of three separate experiments). It might be
suspected that the cytotoxicity of Ara-C had been lethal
to proliferating cells and led to the release of intracellular
PRL from necrotic cells, thus increasing PRL concentrations in the medium without an actual increase in the
secretory activity of the viable population. This seemed
unlikely since the intracellular PRL pool is too small to
account for the measured increase. Nonetheless, to
exclude this possibility, we treated IM-9-P31 and IM-9P33 cells for 2 days as above, washed the cells extensively to remove the drug, and determined the PRL
secretion rates over an additional 2-day incubation
period in the absence of Ara-C. Under these conditions,
previously treated cells proliferated as rapidly as untreated cells with a doubling time of 17-18 h and still
secreted 1.73 (IM-9-P31) and 1.46 (IM-9-P33) times as
much PRL as control cells (not shown). In addition,
hPRL mRNA levels in IM-9-P31 and IM-9-P33 cells were
elevated to 155 ± 68% and 135 ± 18% of control
values, respectively, after 2-day exposure to 25 ng AraC/ml (means ± SEM of three separate experiments),
further supporting a drug-induced increase in hPRL
production. The transcript levels for /3-actin and Tcp1
were unaffected by the treatment.
However, when performing genomic Southern Blot
analysis on Msp\- and HpaIl-digested DNA extracted
from Ara-C-treated cells, we were unable to detect a
modification in the hybridization profile due to Ara-Cinduced hypermethylation of the hPRL gene when we
used probes A and B for hybridization. Yet this analysis
confirmed that inspite of its cytotoxicity the drug had
not caused DNA strand breakage in the region of
interest (not shown).
Methylation of other CpG-Containing Sequences
In addition to the HpaII sites described above, the
following recognition sequences for restriction endonucleases sensitive to methylation in CpG have been
mapped in the hPRL gene (13): one Aval site
(CPymCGPuG), two Thai sites (mCGmCG), and two Hhal
sites (GmCGC). We used these restriction enzymes to
cleave fragments produced by Xba\ digestion. No difference in the degree of methylation between PRL" and
PRL+ cell lines was observed for the Aval site (Fig. 8).
The 7.1 kb Xbal fragment (X2-X3) was almost completely restricted by Aval to give rise to the predicted
Methylation and hPRL Gene Expression
1881
IM-9
P33
2311.4
8.6
6.7
9.46.54.350
500
5000
0
50
500
5-Aza (nM)
B
P31
P33
23
11.4
8.6
6.7
9.4
6 5
4 3
50
500
2000
0
50
500
5-Aza (nM)
Fig. 7. Effect of 5-Aza on Methylation of the hPRL Gene
Genomic DNAs were digested with Hpall and the resultant Southern blots hybridized with probe A (see Fig. 2A). A, Methylation
pattern of IM-9 and IM-9-P33 cells after 4-day treatment with 5-Aza. B, Methylation pattern of IM-9-P31 and IM-9-P33 cells after
4-day treatment with 5-Aza, followed by a 4-day incubation in the absence of the drug.
2.5 kb fragment in DNA from IM-9, IM-9-P6, IM-9-P31,
and IM-9-P33 cells; this site appears to be hypomethylated. Thai digestion resulted in partial cleavage of the
Xba\ fragment to generate the predicted 2.2 kb, but not
the 2.35 kb fragment in IM-9, IM-9-P31, and IM-9-P33
cells. T^ must therefore be partially methylated,
whereas T2 is fully methylated in these cell lines. Both
Thai sites appear to be hypermethylated in IM-9-P6
cells since the enzyme did not restrict (Fig. 8). The
difference in the methylation status of T, between IM9, IM-9-P31, and IM-9-P33 cells on the one hand and
IM-9-P6 cells on the other hand showed no correlation
to hPRL gene expression.
Digestion of Xbal-restricted DNA from all seven cell
lines and from human pituitary with Hha\, followed by
hybridization with probe B, resulted in the appearance
of the predicted 2.35 kb fragment (X2-H2) only in pitui-
tary DNA and faintly in IM-9 DNA, whereas H2 in DNA
from all other lymphoid cell lines appeared fully methylated (Fig. 9A). To analyze the Hha\ sites located
upstream of X2, the blot was stripped and rehybridized
with probe A. Partial cleavage of the 4.6 kb XT-X 2
fragment into a 1.03 kb Hi-X 2 fragment occurred in
DNA from human pituitary and all lymphoid cell lines
except IM-9-P. DNA from IM-9-P3, IM-9-P31, and IM9-P33, and weakly from IM-9, IM-9-P32 and pituitary,
displayed additional higher molecular weight bands of
approximately 2.85 and 3.0 kb which indicate the presence of two partially methylated Hha\ sites located 5'
in the unsequenced region between XT and H^ These
sites appear to be hypermethylated in the PRL-negative
lines IM-9-P and IM-9-P6, but also in the PRL-positive
IM-9-P32 line and in human pituitary (Fig. 9B) and
disclose no association with hPRL gene activity.
MOL ENDO-1990
1882
VoUNo. 12
3 Probe B
2.2
2.35
2.5
7.1
— 7.1
2.5
2.2
1.35-
'X
'X
Fig. 8. Methylation State of Tha\ and Ava\ Sites of the hPRL Gene
DNA from IM-9, IM-9-P6, IM-9-P31, and IM-9-P33 cells was restricted with Xba\ and further cleaved with Tha\ (T/X) or Ava\
(A/X). The Southern blot was hybridized with probe B.
DISCUSSION
We have established a series of human cell lines, the
IM-9-P family, which provide a stable cell culture system
to investigate regulatory mechanisms controlling hPRL
gene expression. Subcloning of the PRL+ IM-9-P3
clonal line gave rise to exclusively PRL+ populations
which, however, differed in their degree of PRL production. This phenomenon is not unprecedented. Subcloning of the clonal GH3 cell line resulted in populations
with differences in growth hormone production of up to
500% (22). This variability in closely related descendents of common origin might be considered indicative
of a delicate balance of factors enhancing and/or suppressing gene expression, a subtle alteration of which
leads to an altered phenotype. One putative mechanism
for modifying gene activity is DNA methylation. This
epigenetic modification is heritable, which is achieved
by the activity of an enzyme designated as "maintenance methylase." This enzyme, due to its high affinity
for hemimethylated DNA, methylates the newly synthesized strand in a postreplicative event using the parental
strand as the template (23). A change in the methylation
pattern might occur when a factor, preventing the maintenance action of the enzyme, is bound to the DNA or
when the enzyme exerts its intrinsic cfe novo methylation activity which proceeds at a 10-100 times slower
rate than the maintenance methylation reaction (24).
Transient demethylation might also be achieved by
enzymatic replacement of 5-methylcytosine by cytosine
(25).
We have shown that the lymphoid cell lines originating from the IM-9 line expressed different methylation
patterns of the hPRL gene. When analyzing the CCGG
sequences in a 14.8 kb region of the hPRL gene, we
found the PRL" IM-9 parental line largely unmethylated;
the variant IM-9-P which had lost its PRL producing
capacity was partially methylated at the Msp\ sites in
the second and third exon (M2 and M3). A similar pattern
was observed for its PRL" clonal subline IM-9-P6,
Methylation and hPRL Gene Expression
1883
Probe A
D Probe B
4.6
1.03
7.1
2.35
H
X
1
2
B
A.
23
9 4
6 5
-
7.1
-* 4.6
4 3
3.0
2.85
2.35
2 3
2 0
1 35
- • 1.03
1 07
'H
'H
Fig. 9. Methylation State ofHhal Sites of the hPRL Gene
DNA from seven lymphoid cell lines and from human pituitary was digested with Xba\ (X) or Xbal and Hha\ (X/H) and analyzed
by Southern hybridization. A, The Southern blot was hybridized with probe B. B, The blot was stripped and rehybridized with probe
A.
whereas all PRL+ sublines displayed a distinctly higher
degree of methylation in M2, the high producer IM-9P33 being fully methylated at this site. Thus, in our
system hypermethylation of a specific site coincides
with increased gene expression in contrast to the generally favored paradigm of a negative correlation between the two parameters. Several lines of evidence
suggest that the positive correlation observed by us for
the hPRL gene was not a mere random coincidence.
The hPRL gene in human pituitary, for instance, was
extensively hypermethylated. HpaU digestion released
only a very small proportion of a fragment resulting from
cleavage at M, and M2. Considering the fact that 3050% of pituitary cells represent lactotropes (26) where
the hPRL gene is transcriptionally highly active, one
would expect a much higher proportion of hPRL genes
in this organ in a hypomethylated state in order to fit
the hypothesis of a negative correlation between methylation and gene activity. Although it has to be kept in
mind that Msp\/Hpa\\ restriction analysis detects only
about one sixteenth of methylatable sites in the euka-
ryotic genome (2) and we therefore cannot conclude
from this isolated finding that methylation in CCGG is
of relevance for hPRL gene expression in the human
pituitary, we provided strongly suggestive evidence that
this is the case in the IM-9 and IM-9-P family of cell
lines.
Not only was increased transcriptional activity concurrent with increased methylation of a specific CCGG
site in the basal state of these cell lines, but treatment
with the hypomethylating agent 5-Aza clearly reduced
hPRL gene expression in PRL+ cells and was shown
to cause demethylation of that same specific site to
create a HpaW fragmentation pattern resembling that of
the PRL" IM-9-P and IM-9-P6 cell lines. The expression
of two other genes, /?-actin and TCP1, was not suppressed by 5-Aza, supporting a specific effect on hPRL
expression. Also, the decrease in hPRL secretion and
hPRL mRNA abundance brought about by the cytidine
analog could not simply be attributed to the growth
inhibitory action of the drug. Treatment of the cells with
another cytidine analog, Ara-C, which inhibited cellular
MOL ENDO-1990
1884
proliferation to a similar extent, had the opposite effect
and actually increased hPRL production on a per cell
basis. This is of particular interest since this inhibitor of
DNA synthesis (27) has been shown to increase enzymatic methylation of DNA synthesized in its presence
(21). The mechanism by which Ara-C increases DNA
methylation is not clear. Unfortunately, our attempts to
increase the extent of methylation in any of the analyzed
restriction sites by exposure of the cells to Ara-C were
unsuccessful. Irrefutable evidence for the importance
of M2 would be provided if hypermethylation of this site
in the IM-9-P cell line could be induced and would lead
to reactivation of PRL expression in these cells.
Our findings on the hPRL gene contrast to reports
on the rPRL gene. Methylation of a specific CCGG site
next to exon 4 of the rPRL gene was inversely related
to expression in the GH^C, and GhUCi subclones of
the GH line (6). The same site (in addition to a CCGG
site in the second exon) was found to be involved in
PRL expression in female rats under various physiological conditions (7). Likewise, in pituitary tumors of
Fischer 344 rats, the rPRL gene domain is hypomethylated in the coding region, whereas in PRL-nonexpressing liver tissue these sites are methylated. Msp\ and
Hha\ restriction sites in adjacent noncoding regions are
methylated irrespective of the transcriptional activity of
the gene (28). All these reports propose an inverse
relationship between methylation and expression in the
rat which is contrary to our findings. They compare with
our observations in that it is the methylation status of
loci within the coding region of the PRL gene which is
linked to transcriptional activity. We mapped the relevant Msp\ site to exon 2, in immediate proximity to the
nucleotides coding for amino acid 1 of secreted PRL.
The question arises how gene activity and methylation can be conceptually linked. The presence of negative cis-acting elements in conjunction with corresponding trans-acting DNA binding proteins can be considered. Such a system has recently been characterized
and suggested to cause the suppression of rPRL gene
activity in the PRL" G H ^ d cells (29). Methylation might
keep a suppressive trans-acting factor from binding to
the hPRL gene and thus allow transcription in the
hypermethylated, PRL+ lymphoid lines. Inversely, methylation of specific sites might actually be required to
allow interaction with DNA-binding proteins that may
act to alter chromatin structure in a manner favorable
for transcription. Mammalian proteins have recently
been isolated that specifically bind DNA containing
methylated CpGs (30, 31). Conversion between an
open and condensed chromatin structure might be
achieved and controlled by an array of proteins with
differing abilities to bind methylated DNA, as proposed
by Selker (32).
In the GH family of pituitary tumor-derived cell lines,
for both the rPRL and the rat GH gene, methylation
was reported to modulate, but not control gene activity.
In strains which expressed either hormone at a low
level, demethylation by 5-Aza elevated hormone production, whereas nonexpressing strains could not be
Vol4No. 12
induced to activate the respective gene by such treatment (33, 34). Accordingly, we observed that 5-Aza
modulated hPRL gene activity in PRL-expressing lines
but did not induce gene transcription in the PRL-negative lines.
With the exception of the IM-9 line, mixed methylation
patterns were observed after Hpall digestion rather
than the generation of solely nonoverlapping fragments.
It is not clear whether this is due to the two alleles in
one cell being in a different methylation status, or
whether each cell line comprises different subpopulations. The tendency of the 11.4 and 8.6 kb Hpall bands
to be of similar intensity points at the former possibility
in the PRL+ clones with M2 being methylated in one,
and M2 and M3 being methylated in the other allele.
Such allelic blueprints are heritable (35). The 6.7 kb
component, predominant in the PRL" lines, might be
contributed by a homozygously unmethylated subpopulation.
Our observation of a positive correlation between
gene activation and DNA methylation is a rare, but not
unique finding. The H-2K (transplantation antigen) gene
in F9 embryonal carcinoma cells is activated when these
teratocarcinoma cells are induced to differentiate with
retinoic acid (36). In undifferentiated cells, the silent H2K gene is poorly methylated, whereas throughout
differentiation increased methylation is associated with
increased expression. Treatment of differentiated cells
with 5-Aza results in suppression of H-2K production.
Our own findings on the hPRL gene are in full agreement with this report and extend further in that we 1)
verified that 5-Aza indeed exerted a hypomethylating
effect on the gene, 2) located a specific site which was
modified by this treatment, and 3) showed that this
same site carried the characteristic difference between
the various cell lines in their basal state in relation to
the extent of gene activity.
With the investigations described here, we added an
example of a positive correlation between DNA methylation and gene expression. The more data will be
accumulated on the role of methylation, especially when
the predominant restrictive focus on an inverse association of methylation and gene activity is abandoned,
the better is our chance to develop a valid picture of
the events involved in gene regulation.
MATERIALS AND METHODS
Cell Culture and Determination of hPRL Secretion Rates
The human B-lymphoblast cell line IM-9 (ATCC CCL 159;
American Type Culture Collection, Rockville, MD), the hPRL
producing variant line IM-9-P, the clonal derivatives IM-9-P6
and IM-9-P3 (9) and its subclones were maintained in RPMI1640 medium supplemented with 10% fetal calf serum, 50 U/
ml penicillin, and 50 ng/m\ streptomycin. Subcloning was carried out by limiting dilution as described previously (9).
Human PRL secretion rates were determined from 2-day
incubation periods. Cells were washed free of secreted PRL,
diluted to 1 x 105 cells/ml, and plated in six replicates in 24well-plates. After 2 days, 3 wells were used for determination
Methylation and hPRL Gene Expression
of cell numbers with a Coulter Counter (Coulter Electronics,
Krefeld, FRG). From the remaining three wells, conditioned
media were harvested after centrifugation and hPRL concentrations were measured by RIA as described previously (37).
The PRL secretion rate was calculated by relating the accumulated amount of PRL in the media to the integrated number
of cells present during the entire incubation period (38):
Nvl)e"dt
where SR = hPRL secretion rate [ng hPRL/106 cells • h], P =
PRL secreted from the beginning (t1) to the end (t2) of the
incubation period [ng/ml], f = time [h], NV1) = number of cells
plated, and k being derived from the growth equation
with A/(/2) = number of cells at the end of the incubation. We
applied this calculation in order to obtain a better approximation of the actual secretory capacity of the cultures on a per
cell basis than would be achieved by simply relating the
secreted PRL to the number of cells at the beginning or at the
end of the incubation. This approach seems of particular
importance to us when secretory rates of control cells are to
be compared to those of cells incubated in the presence of
agents which effect proliferation since it accounts for the
differences in growth rates. Procedures for determination of
intracellular hPRL and of IgG concentrations in the media have
been detailed elsewhere (9, 37).
To study the effect of 5-Aza (Sigma, St. Louis, MO), 10-ml
cell suspensions were plated at a density of 0.8 x 10s cells/
ml in 25 cm2-flasks and incubated in the presence of various
concentrations of the drug for 4 days. Cells were then washed
extensively, readjusted to the above density in fresh medium,
and incubated for another 4 days in the absence of 5-Aza.
Subsequently the PRL secretion rates were determined in a
2-day incubation as outlined above (without 5-Aza).
Treatments with cytosine j8-D-arabinofuranoside (Ara-C;
Sigma, Deisenhofen, FRG) were performed by plating 10-ml
cell suspensions at a density of 2 x 105 cells/ml in the presence
of the drug. After 2 days, Ara-C was washed out and PRL
secretion rates were measured in a 2-day assay in the absence
of Ara-C as described before. Alternatively, omitting the recovery phase, Ara-C was directly included in the six replicate wells
plated for the 2-day secretion assay.
RNA Analysis
RNA was extracted from approximately 2 x 107 cultured cells
by the guanidine thiocyanate-cesium chloride method (39),
denatured, fractionated on 1.3% agarose-2.2 M formaldehyde
gels, transferred to Hybond-N nylon membranes (Amersham,
Braunschweig, FRG) and prehybridized and hybridized under
aqueous conditions as described previously (40). Random
primer labeled probes were a 560-bp Pst\ fragment of the
hPRL cDNA (41) kindly provided by Dr. John Baxter, University
of California, San Francisco), a 2-kb H/ndlll insert of the chicken
/3-actin cDNA in plasmid pAI (42) and a 1.18-kb 3'-£coRI
fragment of the human 2-kb TCP1 cDNA (17) (kindly provided
by Dr. Chr. Kirchhoff, Institute for Hormone and Fertility Research, Hamburg, FRG). Relative intensities of autoradiographic signals were determined by densitometric scanning
and integration of the area under the curve (Hoefer Scientific
Instruments, San Francisco, CA).
DNA Analysis
High molecular weight (>50 kb) genomic DNA was isolated
from cultured lymphoid cells and from human pituitaries obtained at autopsy (43). Twenty micrograms of DNA were
digested with 50 U restriction endonucleases Msp\, HpaW,
1885
Hha\, Xba\, EcoRI, Tha\ (Gibco/BRL, Eggenstein, FRG) or/Aval
(New England Biolabs, Beverly, MA) under the conditions
recommended by the supplier, fractionated through 0.8% or
1.3% agarose gels and alkali-transferred to Hybond-N membranes (43). Completeness of HpaW digestions was ascertained 1) by doubling the amount of enzyme and 2) by digesting
parallel aliquots of genomic DNA preparations in the presence
of 0X174 DNA to yield the expected phage DNA fragments.
Hybridization of Southern blots was carried out under the
same conditions as used for Northern blots. The DNA probes
consisted of a 1132 bp EcoRI-Xbal hPRL genomic fragment
spanning 978 bp of 5'-flanking DNA, exon 1 and about 120
bp of intron A, and a 1705 bp Xbal-£coRI hPRL gene fragment
representing intron A sequence. These probes are subfragments of the genomic hPRL clone g2750, the most 5'-£coRI
fragment of the hPRL gene described by Truong et al. (13).
Washes were performed at high stringency conditions (65 C,
0.1 x SSC).
For sequencing, the 1705 bp Xbal/EcoRI fragment was
inserted into the polylinker of the plasmid vector pBS (Stratagene, Heidelberg, FRG) and sequenced by the dideoxy method
(44).
Acknowledgments
Prof. H. G. Bonnet and Dr. G. DiMattia are acknowledged for
invaluable support throughout the course of this work. We are
grateful to Dr. J. Martial for generously providing the hPRL
genomic probe. We wish to thank I. Habben for sequencing
and Drs. C. McArdle, N. Hunt, J. Olcese, and N. Walther for
critical comments on the manuscript.
Received July 2, 1990. Revision received September 6,
1990. Accepted September 12, 1990.
Address requests for reprints to: Birgit Gellersen, Institute
for Hormone and Fertility Research, Grandweg 64,2000 Hamburg 54, Federal Republic of Germany.
*This work was presented in part at the 72nd Annual
Meeting of The Endocrine Society, Atlanta, GA, 1990.
REFERENCES
1. Razin A, Riggs AD 1980 DNA methylation and gene
function. Science 210:604-610
2. Riggs AD, Jones PA 1983 5-methylcytosine, gene regulation, and cancer. Adv Cancer Res 40:1-30
3. Razin A, Szyf M 1984 DNA methylation patterns: Formation and function. Biochim Biophys Acta 782:331-342
4. Bird AP 1986 CpG-rich islands and the function of DNA
methylation. Nature 321:209-213
5. Ivarie RD, Morris JA 1982 Induction of prolactin-deficient
variants of GH3 rat pituitary tumor cells by ethyl methanesulfonate: Reversion by 5-azacytidine, a DNA methylation inhibitor. Proc Natl Acad Sci USA 79:2967-2970
6. Zhang Z-X, Kumar V, Rivera RT, Pasion SG, Chisholm J,
Biswas DK 1989 Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation. DNA 8:605-613
7. Kumar V, Biswas DK 1988 Dynamic state of site-specific
DNA methylation concurrent to altered prolactin and
growth hormone gene expression in the pituitary gland of
pregnant and lactating rats. J Biol Chem 263:1264512652
8. Gourdji D, Tougard C, Tixier-Vidal A 1982 Clonal prolactin
strains as a tool in neuroendocrinology. In: Ganong WF,
Martini L (eds) Frontiers in Neuroendocrinology. Raven
Press, New York, pp 317-357
9. DiMattia GE, Gellersen B, Bohnet HG, Friesen HG 1988
MOL ENDO-1990
1886
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
A human B-lymphoblastoid cell line produces prolactin.
Endocrinology 122:2508-2517
Gellersen B, DiMattia GE, Friesen HG, Bohnet HG 1989
Prolactin (PRL) mRNA from human decidua differs from
pituitary PRL mRNA but resembles the IM-9-P3 lymphoblast PRL transcript. Mol Cell Endocrinol 64:127-130
DiMattia GE, Gellersen B, Duckworth ML, Friesen HG
1990 Human prolactin gene expression: The use of an
alternative non-coding exon in decidua and the IM-9-P3
lymphoblast cell line. J Biol Chem 265:16412-16421
Sneider TW 1980 The 5'-cytosine is methylated in two
eukaryotic DNAs and Mspl is sensitive to methylation at
this site. Nucleic Acids Res 8:3829-3840
Truong AT, Duez C, Belayew A, Renard A, Pictet R, Bell
Gl, Martial JA 1984 Isolation and characterization of the
human prolactin gene. EMBO J 3:429-437
Jones PA, Taylor SM 1980 Cellular differentiation, cytidine
analogs and DNA methylation. Cell 20:85-93
Fahey JL, Buell DN, Sox HC 1971 Proliferation and differentiation of lymphoid cells: Studies with human lymphoid
cell lines and immunoglobulin synthesis. Ann NY Acad Sci
189-190:221-234
Willison K, Lewis V, Zuckerman KS, Cordell J, Dean C,
Miller K, Lyon MF, Marsh M 1989 The t complex polypeptide (TCP-1) is associated with the cytoplasmic aspect of
golgi membranes. Cell 57:621-632
Willison K, Kelly A, Dudley K, Goodfellow Pk, Spurr N,
Groves V, Gorman P, Sheer D, Trowsdale J 1987 The
human homologue of the mouse t-complex gene, TCP1,
is located on chromosome 6 but is not near the HLA
region. EMBO J 6:1967-1974
Andrews III DF, Nemunaitis J, Tompkins C, Singer JW
1989 Effect of 5-azacytidine on gene expression in marrow stromal cells. Mol Cell Biol 9:2748-2751
Kufe DW, Major PP, Egan EM, Beardsley GP 1980 Correlation of cytotoxicity with incorporation of ara-C into
DNA. J Biol Chem 255:8997-9000
Major PP, Egan EM, Beardsley GP, Minden MD, Kufe DW
1981 Lethality of human myeloblasts correlates with the
incorporation of arabinofuranosylcytosine into DNA. Proc
Natl Acad Sci USA 78:3235-3239
Boehm TLJ, Drahovsky D 1982 Elevated level of enzymatic DNA methylation in cells treated with 1-/3-D-arabinosylcytosine. Cancer Res 42:1537-1540
Strobl JS, Dannies PS, Thompson EB 1986 Rat growth
hormone gene expression is correlated with an unmethylated CGCG sequence near the transcription initiation site.
Biochemistry 25:3640-3648
Gruenbaum Y, Cedar H, Razin A 1982 Substrate and
sequence specificity of a eukaryotic DNA methylase. Nature 295:620-624
Strobl JS 1990 A role for DNA methylation in vertebrate
gene expression? Mol Endocrinol 4:181-183
Razin A, Szyf M, Kafri T, Roll M, Giloh H, Scarpa S,
Carotti D, Cantoni GL 1986 Replacement of 5-methylcytosine by cytosine: A possible mechanism for transient
DNA demethylation during differentiation. Proc Natl Acad
Sci USA 83:2827-2831
Lloyd RV, Anagnostou D, Cano M, Barkan AL, Chandler
WF 1988 Analysis of mammosomatotropic cells in normal
and neoplastic human pituitary tissues by the reverse
hemolytic plaque assay and immunocytochemistry. J Clin
Endocrinol Metab 66:1103-1110
VOI4NO. 12
27. Fram RJ, Kufe DW 1982 DNA strand breaks caused by
inhibitors of DNA synthesis: 1 -/3-D-arabinosylcytosine and
aphidicolin. Cancer Res 42:4050-4053
28. Durrin LK, Weber JL, Gorski J 1984 Chromatin structure,
transcription, and methylation of the prolactin gene domain in pituitary tumors of Fischer 344 rats. J Biol Chem
259:7086-7093
29. Zhang Z-X, Kumar V, Rivera RT, Chisholm J, Biswas DK
1990 c/s-Acting negative regulatory element of prolactin
gene. J Biol Chem 265:4785-4788
30. Meehan RR, Lewis JD, McKay S, Kleiner EL, Bird AP
1989 Identification of a mammalian protein that binds
specifically to DNA containing methylated CpGs. Cell
58:499-507
31. Zhang X-Y, Supakar PC, Khan R, Ehrlich KC, Ehrlich M
1989 Related sites in human and herpesvirus DNA recognized by methylated DNA-binding protein from human
placenta. Nucleic Acids Res 17:1459-1474
32. Selker EU1990 DNA methylation and chromatin structure:
a view from below. TIBS 15:103-107
33. Laverriere J-N, Muller M, Buisson N, Tougard C, TixierVidal A, Martial JA, Gourdji D 1986 Differential implication
of deoxyribonucleic acid methylation in rat prolactin and
rat growth hormone gene expressions: A comparison
between rat pituitary cell strains. Endocrinology 118:198206
34. Lan NC 1984 The effects of 5-azacytidine on the expression of the rat growth hormone gene: Methylation modulates but does not control growth hormone gene activity.
J Biol Chem 259:11601-11606
35. Silva AJ, White R 1988 Inheritance of allelic blueprints for
methylation patterns. Cell 54:145-152
36. Tanaka K, Appella E, Jay G 1983 Developmental activation of the H-2K gene is correlated with an increase in
DNA methylation. Cell 35:457-465
37. Gellersen B, DiMattia GE, Friesen HG, Bohnet HG 1989
Phorbol ester stimulates prolactin release but reduces
prolactin mRNA in the human B-lymphoblastoid cell line
IM-9-P3. Mol Cell Endocrinol 66:153-161
38. Gellersen B 1990 Ektopische Prolaktin-Produktion in einer
menschlichen lymphoiden Zellinie. PhD Thesis, University
of Hamburg, Faculty of Biology
39. Chirgwin J, Pryzbyla A, MacDonald R, Rutter W 1979
Isolation of biologically active ribonucleic acid from
sources enriched for ribonuclease. Biochemistry
18:5294-5299
40. Gellersen B, DiMattia GE, Friesen HG, Bohnet HG 1989
Regulation of prolactin secretion in the human B-lymphoblastoid cell line IM-9-P3 by dexamethasone but not other
regulators of pituitary prolactin secretion. Endocrinology
125:2853-2861
41. Cooke NE, Coit D, Shine J, Baxter JD, Martial JA 1981
Human prolactin: cDNA structural analysis and evolutionary comparisons. J Biol Chem 256:4007-4016
42. Cleveland DW, Lopata MA, MacDonald RJ, Cowan NJ,
Rutter WJ, Kirschner MW 1980 Number and evolutionary
conservation of a- and /3-tubulin and cytoplasmic /3- and
7-actin genes using specific cloned cDNA probes. Cell
20:95-105
43. Davis LG, Dibner MD, Battey JF 1986 Basic Methods in
Molecular Biology. Elsevier, New York, pp 41-46
44. Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing
with chain terminating inhibitors. Proc Natl Acad Sci USA
74:5463-5467