Download PROFILES OF TETRACYCLINE RESISTANT BACTERIA IN THE

PROFILES OF TETRACYCLINE RESISTANT BACTERIA
IN THE HUMAN INFANT DIGESTIVE SYSTEM
THESIS
Presented in partial Fulfillment of the Requirements for the Degree Master’s of
Science in the Graduate School of
The Ohio State University
By
Daniel Kinkelaar, B.A., B.S.
*****
The Ohio State University
2008
Master’ Examination Committee:
Approved by
Professor Hua Wang, Advisor
Professor Jeff Culbertson
Professor Brian McSpadden-Gardener
________________________
Advisor
Food Science and Nutrition
Graduate Program
iii
ABSTRACT
The rapid emergence of antibiotic resistant (ART) pathogens poses a serious threat to
public health. A large antibiotic resistance (AR) gene pool has recently been found in
commensal bacteria associated with many retail foods. Subsequently, the question is
whether these foodborne ART bacteria through daily food consumption are responsible
for the prevalence of ART bacteria in human digestive ecosystems. To address this issue,
the ART bacteria profiles in fecal samples of infant subjects before solid food
consumption were analyzed by total plate counting of ART bacteria and real-time PCR
assessment of the tetM gene pool. Tetracycline-resistant (Tetr) bacteria were found in
fecal samples from both breast and formula-fed babies shortly after birth without being
exposed to the corresponding antibiotic. The numbers of ART bacteria within these
subjects increased rapidly within four weeks before reaching a relatively stable level.
The numbers of ART bacteria ranged from 5.5x105 to 1.9x108 CFU/g of sample and was
maintained throughout the 12 month examination period. Similar shift of the tetM gene
pool in the infant fecal samples was observed by real-time PCR. The tetM gene pool in
all infant fecal samples, with the exception of the meconium samples, ranged at least
from 9.0x105 to 9.0x108 copies per gram of sample. The data suggest that routes other
than conventional food intake may have played a role in the initial colonization of ART
ii
iv
bacteria in infants. The impact of the ART bacteria from conventional food intake on the
dynamic shift of the ART bacteria in human digestive tract at later stages through
occasional colonization and maybe horizontal gene transmission is yet to be revealed.
iii
ACKNOWLEDGMENTS
I wish to thank my advisor, Hua Wang, for intellectual support and assistance which
made this thesis possible.
This research was supported by Dr. Wang’s Ohio State University start up fund.
iv
VITA
September 11, 1972………………………………………..……Born - Parma, Ohio, USA
1995………………………………….....B.A Communications, The Ohio State University
2006………………………………………..B.S. Microbiology, The Ohio State University
PUBLICATIONS
Kinkelaar D, Wang HH. 2007. Antibiotic resistance development in human oral and gut
ecosystems. The Center for Microbial Interface Biology Retreat. Abstract #45.
Kinkelaar D, Wang HH. 2008. Profiles of tetracycline resistance bacteria in human
microflora associated with infant digestive system. IAFP annual meeting. (P5-69).
FIELDS OF STUDY
Major Field: Food Science and Nutrition
v
TABLE OF CONTENTS
Page
Abstract………………………………………………………..……………………..…..ii
Acknowledgements…………………………………………………...………………….iv
Vita…………………………………………………………………………..…………....v
List of Figures………………………………………………………………...………....viii
Chapters
1.
Introduction……………………………………………………….……………....1
1.1 Bibliography…………………………………………………………………4
2.
Literature Review………………….……………………………………………...7
2.1
2.2
2.3
2.4
2.5
2.6
2.7
2.8
2.9
2.10
3.
Introduction to antibiotics…………………………………..………………7
Application and uses for antibiotics…………………………..…………….9
Antibiotic resistant bacteria………………………………….…………….14
Exchange of genetic material……………………………...……..………..15
Vertical gene transfer...……………………………………………….….. 16
Horizontal gene transfer……………………………………………………….….17
Reservoirs for resistance genes………………...……………………….…20
Human microflora...…………………………………………………….…22
Means to assess bacterial populations...……………………………….…..29
Bibliography…………………………………………………………….…33
Profiles of tetracycline resistant bacteria in the human infant digestive
system……………………….…...........................................................................38
3.1 Objectives………………………………………………………………….38
3.2 Introduction....……………………………………………………………...38
3.3 Material and methods………………………………………………………41
vi
3.3.1
3.3.2
3.4
3.5
3.6
4.
Subjects and sampling……………………………………………41
Culturable microbial population assessment using conventional
agar plating..…………………………………………………...…42
3.3.3 DNA template preparation……………………………………….42
3.3.4 Screening for representative tetr gene and identification of AR
gene carriers……………………………………………………...44
3.3.5 Quantitative assessment of the tetM gene pool by Taqman
real-time PCR…………………………………………………….45
Results……………………………………………………………………..47
3.4.1 Assessing culturable gut microflora by conventional
plate counting………………………………………………....…47
3.4.2 Prevalence of Tetr bacteria in infant fecal samples………….…..49
3.4.3 Assessing the tetM gene pool by real-time qPCR………....…….50
3.4.4 The shift of ART bacterial population during
infant development……………………………………………….53
Discussion…………………………………………………………………56
Bibliography……………………………………………………………....60
Conclusion and future developments……………………………………………63
4.1 Summary………………………………………………………………….63
4.2 Future studies …………………………………………………………….64
Bibliography……………………………………………………………………………..65
vii
LIST OF FIGURES
Figure
Page
3.1
Variability in microbial recovery on selected bacterial media …………………48
3.2
Total and tetracycline resistant plate counts of 13 infant subjects………………49
3.3
Standard curve…………………………………………………………………...50
3.4
Extraction efficiency of tetM-specific qPCR……………………………………51
3.5
Validation of extraction by artificially spiking meconium with pure culture…...52
3.6
The distribution of tetM gene pool in 11 infant subjects…………………….......53
3.7
Total and resistant plate counts of twin over the course of a year…………….....54
3.8
The distribution of the tetM gene pool in twin subjects…………………………55
viii
CHAPTER 1
INTRODUCTION
Antibiotics are essential therapeutic tools for a wide variety of illnesses caused by
bacterial infections. The rapid emergence of antibiotic resistant (ART) pathogens negates
effective treatments and therefore is becoming a major threat to public health (2, 6, 19).
In humans, the primary application of antibiotics is in therapeutic treatments caused by
infections.
Non-human uses include both curative and prophylactic treatments of
companion and food animals, as well as applications in horticulture and aquaculture. The
usage of antimicrobial agents in any of these applications selects for resistant populations
(18). In addition to the direct propagation of the resistant bacteria, the exchange of
mobile elements between commensal and pathogenic organisms facilitates the
dissemination of the resistance genes across different bacteria, thus playing an important
role in the rapid emergence of drug resistance (12, 14).
The over prescribing of
antibiotics to human and animal patients in clinical therapy is one potential rationale for
the rapid increase in ART bacteria. The addition of antibiotics in sub-therapeutic doses
to animal feed used in food animal production as a growth promoter has also been
indicated as an important cause for this problem (5).
1
To protect the efficacy of
therapeutic antibiotics used in humans, the major health organizations such as the World
Health Organization (WHO), Centers for Disease and Prevention (CDC), and the
European Union (EU) have stressed the need to control the spread of ART bacteria (1, 7,
20). Several government entities have taken the corresponding actions. In 1999, the
European Union banned the application of certain antimicrobial agents (tylosin,
spiramycin, bacitracin, and virginiamycin) as growth promoters in chicken, swine, and
beef production (6). Denmark voluntarily stopped using all antimicrobial agents as
growth promoters in cattle, broilers, and pigs in the following year. Since 1999, no
antibiotics have been used as growth promoters in food animals in Denmark (1, 13, 21).
However, the impact of prophylactic usage of antibiotics is still a topic of debate in the
United States, and control strategies have just begun to be implemented. In 1996 the
National Antimicrobial Resistance Monitoring System (NARMS) was established as a
group effort among the CDC, United States Department of Agriculture (USDA), and
Food and Drug Administration (FDA), whose primary mission is to monitor antibiotic
resistance (AR) in foodborne enteric pathogens (2).
The antibiotic enrofloxacin, a
fluoroquinolone used for controlling bacterial infections in poultry, was banned in the
United States in 2005. This is the first new antibiotic in the United States that has been
removed from food animal production because of the potential threat to public health (3).
In the past decade, various ART pathogens have been isolated from retail food samples,
particularly meat and poultry products (10, 15, 16) suggesting the possible transmission
of AR to humans through the food chain. Nevertheless, pathogens only count for a very
2
small percentage in microbial population and they are not a significant source for
horizontal transmission of AR. However, data from recent studies illustrated that
commensal bacteria in ready-to-eat foods may be a much more important avenue in
transmitting AR to the general public through the food chain (4, 54). Many retail foods
were found carrying a large number of bacteria containing AR genes (4, 18). The AR
genes present in these foods are readily consumed by humans and can potentially be
transferred to the human residential bacteria associated with the digestive system. These
resistance genes from food may further serve as a reservoir transmitting the AR genes to
pathogens. Both commensal and beneficial bacteria were identified as AR gene carriers.
The AR genes from foodborne bacteria can be transferred to oral and gut residential
bacterium via natural transformation (9, 18). In addition, several EU groups found that
ART bacteria were prevalent in oral and gut ecosystems from healthy humans without
recent exposure to antibiotics, suggesting that colonization, propagation or transmission
can be independent from the selective pressure of the antibiotic (8, 11, 17). A
comprehensive understanding of both the major pathways is essential for the
development of targeted control strategies to combat this public health challenge.
3
BIBLIOGRAPHY
1. Anderson, A.D., J. McClellan, S. Rossiter, and F.J. Angulo. 2003. Public
health consequences of use of antimicrobial agents in agriculture. In:
Knobler, S.L., Lemon, S.M., Najafi, M., Burroughs, T. (Eds.), Forum on
Emerging Infections: The Resistance Phenomenon in Microbes and Infectious
Disease Vectors. Implications for Human Health and Strategies for
Containment—Workshop Summary. Board on Global Health, Institute of
Medicine, Appendix A, pp. 231–243.
2. Centers for Disease Control and Prevention.2007. Get smart: know when
antibiotics work. http://www.cdc.gov/narms/faq.htm#3 (viewed December
2007).
3. Davidson DJ. In the matter of enrofloxacin for poultry: withdrawal of
approval of Bayer Corporation's new animal drug application 1 (NADA) 140828 (Baytril). In: FDA Docket No. 00N-1571; 2004.
4. Durán, G. M., and D.L. Marshall. 2005. Ready-to-eat shrimp as an
international vehicle of antibiotic-resistant bacteria. J Food Prot. 68:23952401.
5. Environmental Defense Fund. 2001.
http://www.edf.org/documents/619_abr_general_factsheet_rev2.pdf
(viewed March 2008).
6. Food and Drug Administration, Center for Veterinary Medicine, April 28,
2000 HHS Response to House Report 106-157- Agriculture, Rural
Development, Food and Drug Administration, and Related Agencies,
Appropriations Bill. Executive Summary.
7. Fries, R.. 2004. Conclusions and activities of previous expert groups: the
Scientific Steering Committee of the EU. J Vet Med B Infect Dis Vet Public
Health. 51:403-7.
8. Gueimonde, M., S. Salminen, and E. Isolauri. 2006. Presence of specific
antibiotic (tet) resistance genes in infant faecal microbiota. FEMS Immunol
Med Microbiol. 48: 21-25.
4
9. Jacobsen, L., Wilcks, A., Hammer, K., Huys, G., Gevers, D., and S.
Andersen. 2007. Horizontal transfer of tet (M) and erm(B) resistance
plasmids from food strains of Lactobacillus plantarum to Enterococcus
faecalis JH2-2 in the gastrointestinal tract of gnotobiotic rats. FEMS
Microbiol Ecol 59:158–166
10. Kolar., M., Pantcek, R, Bardon. J, Vagnerova,I., Typovska, H., Doskar,
J. and I. Valka. 2002. Occurrence of antibiotic-resistant bacterial strains
isolated in poultry. Vet. Med. 47:52-59.
11. Lancaster, H., Ready, D., Mullany, P., Spratt, D., Bedi, R. and M. Wilson.
2003. Prevalence and identification of tetracycline-resistant oral bacteria in
children not receiving antibiotic therapy. FEMS Microbiol Lett. 228: 99-104.
12. Molbak, K. 2004. Spread of resistant bacteria and resistance genes from
animal to human- The public consequences. J of Vet Med. 51: 364-369.
13. Randerson, J. 2003. Ban on growth promoters has not increased bacteria.
New Scientist. 183:13-15.
14. Salyers, A.A., Gupta, A., and Y. Wang. 2004. Human intestinal bacteria as
reservoir for AR. Trends Microbiol. 12: 412-416.
15. Van,T.T.H., Moutafis,G., Tran, L.T.,and P. J. Coloe. 2007. AR in FoodBorne Bacterial Contaminants in Vietnam. Appl Environ Microbiol. 73:
7906-7911.
16. Van Looveren, M., Daube, G., De Zutter, L., Dumont, J., Lammens, C.,
Wijdooghe, M., Vandamme, P., Jouret, M., Cornelis, M. and H. Goossens.
2001. Antimicrobial susceptibilities of Campylobacter strains isolated from
food animals in Belgium. J. Anti Chemother. 48, 235-240.
17. Villedieu, A., Diaz-Torres, M.L., Hunt, N., McNab, R., Spratt, D.A.,
Wilson, M. and P. Mullany. 2003. Prevalence of tetracycline resistance gene
in oral bacteria. Antimicrob Agents Chemother. 47: 878-882.
18. Wang, H., Manuzon, M., Lehman, M., Wan, K., Luo, H., Wittum, T.,
Yousef, A., and L. Bakaletz. 2006. Food commensal microbes as a
potentially important avenue in transmitting AR genes. FEMS Microbiol
Lett. 254:226-231.
19. Wassenaar, T. 2005. Use of antimicrobial agents in veterinary medicine and
implications for human health. Crit Views Microbiol. 31: 1555-169.
5
20. WHO. 2000. WHO Global Principless for the Containment of Antimicrobial
Resistance in Animals Treated for Food: Report of a WHO Consultation,
Geneva, Switzerland, June 5-9, 2000.
21. WHO. 2003. World Health Organization, Impacts of antimicrobial growth
promoter termination in Denmark, The WHO international review panel’s
evaluation of the termination of the use of antimicrobial growth promoters in
Denmark. http://www.who.int/salmsurv/en/Expertsreportgrowthpromoterdenmark.pdf
6
CHAPTER 2
LITERATURE REVIEW
2.1
Introduction to antibiotics
In 1887, Ernest Duchensne noted that bacteria growth was inhibited by the presence of
Penicillium, a soil mold (24). Further studies were carried out by the British scientist, Sir
Alexander Fleming in 1928, confirming that the presence of the mold disrupted the
growth of the bacteria. It was later determined that a β-lactam moiety was the inhibitory
compound disrupting the cell membranes of Gram-positive bacteria. It was determined
that β-lactam antibiotics work by binding to the enzyme D,D- transpeptidase, which the
cell uses to create cross-links the peptidoglycan in the cell wall. By preventing the crosslinks the membrane is compromised and cytolysis occurs due to osmotic pressure (15).
Initially the mass production of penicillin was challenging. In 1942 there was only
enough penicillin to treat 10 people and the first patient to successfully be treated by
penicillin for streptococcal septicemia used half of the total supply at that time. In 1943,
after a worldwide search found that a cantaloupe in the Peoria, Illinois market contained
the highest and best quality penicillin, and the results from fermentation research on corn
steep liquid at the Northern Regional Research Laboratory at Peoria, Illinois, led to large
7
scale production of the compound. These discoveries enabled the large scale application
of antibiotics for the first time in World War II. Approximately 2.3 million doses were
produced for the invasion of Normandy in 1944 (28). The successful application of
penicillin in reducing war related infections drew great attention from the scientific
community and triggered a new wave of scientific studies on the functionality of
penicillin and searches for new antibiotics. By 1946 it became a standard treatment for
bacterial infections caused by streptococci and staphylococci.
Penicillin was effective
on all sorts of infections caused by these two Gram positive bacteria such as strep throat,
pneumonia, scarlet fever, septicemia and wound infections, reducing a significant amount
of mortality. The introduction of new antibiotics, including tetracycline, streptomycin
and chloramphenicol in the early 1950’s began the age of antibiotic chemotherapy, which
provided a means to prevent a large number of bacterial infections from both Gram
positive and Gram negative bacteria as well as intercellular parasites. The success of
these antibiotics inspired scientists to develop synthetic antimicrobial agents such as
sulfonamides or “sulfa drugs” and aminosalicylic acid or PAS to treat tuberculosis. The
usages of antibiotics became widely accepted in the early 1950’s and were regularly
administered as therapeutic agents to the general population (39).
Soon after the use of penicillin on a large scale, microbial resistance to penicillin was
detected. It was recently estimated that as many as 80% of the strains of Staphylococcus
aureus today are resistant to penicillin, limiting its effectiveness to prevent infection (24).
8
Similar results were found in regard to resistance to tetracycline, streptomycin and
chloramphenicol, with mounting evidence showing that multiple resistant genes could be
passed between strains and species (50). In the event that a bacterial pathogen acquires
resistance to an antibiotic, treatment becomes less- or non-effective. Therefore there is a
great need for the development of new antibiotics. Effective treatment of infections
requires a proactive approach in understanding how the antimicrobial agents work; as
well as, why treatments fail, in order to stay ahead of microbial pathogens.
2.2
Application and uses for antibiotics
Antibiotics can be classified in a number of ways, the broadest being its mode of action,
such as, bactericidal or bacteriostatic. Bactericidal antibiotics kill the organism where as
bacteriostatic antibiotic prevent the growth and reproduction of the bacterium by
interrupting protein synthesis, cellular metabolism or DNA replication. Antibiotics can
also be classified by the type and range of its target organisms. Broad spectrum
antibiotics such as amoxicillin and levofloxacin can target a wide variety of diseasecausing bacteria including both Gram-positive and Gram-negative bacteria.
Narrow
spectrum antibiotics target a particular type of bacteria such as either Gram-positive or
Gram-negative. Methicillin is an example of a narrow spectrum beta-lactam antibiotic
derived from the penicillin used to treat beta-lactamase producing Gram-positive bacteria
such as Staphylococcus aureus. Another common classification of antibiotics is based on
the chemical structure of the antibiotic, such as tetracycline, macrolide or
9
aminoglycosides. Antibiotics can also be classified by their mode of administration such
as topically, orally, intravenously or parentally (3, 32).
Tetracycline,
β-Lactam
sulfonamides,
penicillins,
macrolides,
fluoroquinolones,
cephalosporins, aminoglycosides, streptogramins and chloramphenicols are common
antibiotics that are used as prophylactic measures in the propagation of food animals as
well as therapeutics to treat human illness. Therefore the bacteria that become resistant
in animals to these drugs can also become resistant in humans (4, 9). Antimicrobial
agents are often used for three primary reasons: to treat an identified bacterial infection,
to treat those at risk of a bacterial infection, or as a growth promoter used as a food
additive for animals meant for consumption (52). Antibiotics are administered orally,
parentally or topically and are used in both human and veterinary medicine to treat and
prevent disease (13). Antibiotics are also used to treat aquaculture and farm fields
against pathogens. When used on farm fields in this manner they are referred to as
pesticides.
The drug resistance issue is very serious today. The emergence of ART bacteria in
hospitals seems to be correlated to the overuse of antibiotics in the clinical setting. In the
1940’s, penicillin was very effective in treating Staphylococcus aureus infections.
Currently, most strains of S. aureus are resistant to penicillin, limiting their use in
therapeutic applications. Today, vancomycin, a powerful antibiotic, is readily used in
treating S. aureus as well as Enterococcus infections. Resistant strains have already
10
emerged making treatment difficult (34). The Center for Disease Control and Protection
(CDC) reports that in the United States nearly 2 million patients a year contract infections
while staying in the hospital, of which around 90,000 patients die from these infections.
More than 70% of these hospital acquired infections are resistant to at least one
commonly used antibiotic causing longer hospital stays and higher health care costs (51).
Hospitals provide a good environment for the emergence of ART bacteria. The close
proximity of sick patients to one another, along with extensive use of antibiotics likely
contributed to an environment rich in ART bacteria.
The use of antibiotics in veterinary medicine has also been implicated in the rapid
increase of ART organisms, which includes the use on pets, farm animals, and animals
rose in aquaculture. Tetracycline resistant genes have been detected in pathogens,
opportunistic pathogens as well as the normal microflora or commensal bacteria. The
non-pathogenic (commensal) bacteria are believed to play an important role in creating
reservoirs in each ecosystem (23, 37, 38, 47). The main diseases treated by veterinarians
using antibiotics include enteric and pulmonary infections, skin and organ abscesses, and
mastitis. Over the last 50 years an estimated one million tons of antibiotics have been
released into the environment, of which approximately half were from veterinary and
agricultural channels. Surveillance studies have indicated that there have been increased
occurrences of resistance development in both pathogenic and commensal bacteria from
farm animals (48). A recent study used tetracycline resistance probes to monitor swine
11
effluents into the environment from two swine production facilities. They looked at the
impact of the swine fecal material on nearby lagoons and ground water. This study
linked the tetracycline resistance genes as far as 250 meters from the source, suggesting
the farm as the direct source of resistance genes into the environment. This study
identified that ground water can serve as a potential vehicle transferring resistant genes
from the farm to the food chain (11).
Antibiotics are not limited to therapeutic or preventative applications. In agriculture,
antibiotics are often supplemented in animal feed or water as a performance enhancer or
as antibiotic growth promoters. Antibiotic growth promoters increase the growth rate of
the animals as well as improve the feed efficiency in healthy well fed animals. Antibiotic
growth promoters are commonly given to pigs, poultry and non-ruminating veal calves.
Under optimal growth conditions the growth rate of the animal is increased by 2-4% (52).
The mechanism of increased growth is not clear, but studies have shown that the use of
antibiotics as growth promoters is most effective in young animals under good hygienic
conditions. The mode of action for growth promoting antibiotics is unknown (35). It is
assumed that the antibiotics cause multiple beneficial effects to the host, including: lethal
or sub-lethal damage to pathogens; a reduction of toxins produced by these pathogens; a
reduction in bacterial utilization of available essential nutrients; improved absorption of
nutrients by reducing the thickness of the intestinal epithelium; reducing the intestinal
mucosa epithelial cell turnover; and reducing intestinal motility (36). The addition of
12
antibiotics to animal feed alters the intestinal characteristics to resemble those seen in
germ free animals (13).
Tetracyclines are broad spectrum antibiotics comprised of four hydrophobically fused 6
member rings which create the general structure. The various derivatives are different at
one or more of four sites on the ring structure which provide activity against a wide range
of bacteria. They have been used extensively in therapy in humans as well as companion
animals. Tetracycline and its analogues have also been extensively used as feed additives
in sub-therapeutic levels for growth promotion in food animals in addition to treating
diseases that effect field crops and fruit trees (42). A number of recent reports
documented the detection of ART bacteria and AR gene dissemination beyond the range
of selective pressure in the human ecosystems. One recent study examined the
prevalence of tetracycline resistant bacteria in children that were never administered
tetracycline and found that 100% of the subjects carried ART bacteria of which 11% on
average of the cultivatable microflora was resistant to tetracycline (53). While another
recent study examined the presence of the tetracycline resistance genes tetW, tetM, tetO,
tetS, tetT, and tetB, in breastfed infants that were never administered antibiotics and
found that every subject tested had ART bacteria in their fecal samples (20).
Several main resistant strategies have been found in bacteria to interfere with the
tetracycline action. There are currently 38 different tet and Otr genes identified, of which
23 genes encoded for energy dependant efflux pumps, 11 genes for ribosomal protection
13
proteins, 3 gene for an inactivation enzyme, and there is 1 gene with an unknown
mechanism. Efflux pumps lower the concentration of the antibiotic concentration in
cytoplasm of the cell, were as, ribosomal protection genes create peptides that protect the
ribosome from the tetracycline binding while the degradation enzyme of tetracycline into
non-toxic compounds (38). Of the genes coding for the ribosomal protection protein,
tetM is the most prevalent. One of the reasons for the large distribution of this gene is
that it is commonly located within a conjugative transposon which has a broad range of
hosts (12).
2.3
Antibiotic resistant bacteria
Four years after the mass production and distribution of antibiotics the first report of
penicillin resistant Staphylococcus. aureus was documented (24). Fleming warned that
overuse of antibiotics would reduce the antimicrobial potency, but it wasn’t until the
1970’s when multi-drug resistant strains were published that public attention became
focused on the spread on AR (52).
There are three common ways that organisms can be protected from antibiotics: the
organism can be intrinsically resistant where the mode of action of the antibiotic does not
have an effect on the microbe; the microbe can have genetic material that encodes for
protection; or a random mutation in the DNA of the microbe can occur providing
14
protection from the action of the antibiotics (38, 42, 50). Antibiotics target specific sites
in bacterial cells, such as the cell wall or the ribosome. Cells may be inherently resistant
by lacking the specific target site, or it may acquire resistance by genetic mutation or
obtain genetic material from another bacterium, which provides protection to the target
site.
2.4
Exchange of genetic material
Exchanging genetic materials among bacteria enabled them to evolve quicker than by
independent mutation alone.
Examples of its medical impact include the rapid
emergence and dissemination of AR-encoding plasmids, switching between two
alternative antigenic forms of flagellin filament protein (flagellar phase variation) in
Salmonella, and the antigenic variation of surface antigens in Neisseria and Borrelia, etc.
(21).
Different mechanisms are implemented to introduce donor DNA into recipient bacteria
through processes such as transformation, transduction or conjugation. DNA is usually
unstable in the recipient. The transferred data can be retained in the recipient cells either
as part of an independent replicon (plasmid) maintained under certain selective pressure
or stabilization mechanisms, or by integrated into the genome of the recipient through
recombination (21). Transmission between organisms generally occurs at a rate of 10-6
to 10-8 transconjugants/donor CFU. The frequency is correlated to the compatibility
15
between the organisms and the availability of the AR genes. Transfer events further
enable these organisms to disseminate genetic attributes effectively within the community
to enhance the ecosystem development and are more often between same or similar
species (45).
Overall the transfer of the genetic material is often beneficial to the
recipient organism. Genetic transfer between organisms plays a crucial role in microbial
evolution in shaping the structure of microbial communities.
2.5
Vertical gene transfer
AR evolves naturally by random mutations including point mutations, deletions,
insertions or rearrangements in the DNA that confers protection to the organism by
blocking the targets of the antibiotic. These mutations are passed down to daughter cells
and are known as vertical gene transfer. The increase in the prevalence of AR is a
product of natural selection. The antibiotic does not technically cause the resistance, but
it creates a situation in which a resistant variant can withstand the action of the antibiotic,
while killing the defenseless bacteria. This process selects for resistant bacteria allowing
them to multiply and become the predominant microorganism (24, 50).
Most antibiotics are derived from natural origin, which is usually produced by either
bacteria or fungi. Mutations occur naturally at a frequency of around 10-8 to 10-10. Even
though the frequency of mutation is low, the presence of antibiotics can accelerate the
16
domination of resistant bacteria by acting as a selective agent. Genetic mutants are often
stable and can vertically disseminate to daughter cells.
2.6
Horizontal gene transfer
On the other hand, certain genetic materials that encode for resistance of antibiotics are
carried on a plasmids or transposons and can easily be acquired and spread to other
microbes, transmitting the gene horizontally through the population. The resistance genes
encode for cellular machinery that offers protection to the organism by either creating a
peptide to block the action of the antibiotic, by generating an efflux pump to remove the
antibiotic from the cytoplasm, or by encoding an enzyme that degrades the antibiotic,
rendering it harmless (12, 38, 42).
Horizontal gene transfer is a means for spreading AR genes from organism to organism,
and pathogens are more likely to obtain ART genes from non-pathogenic commensal
organisms rather than from another pathogen (40, 54). Horizontal gene transfer is the
transmission of genetic material from one organism to another.
Naturally, genetic
material can be transferred by one of three methods: conjugation, transformation, or
transduction. Conjugation is the exchange of genetic material in the form of a plasmid by
cells touching. Transformation is the absorption of naked DNA from the environment
17
and integrating it into a plasmid or the genomic DNA. Transduction is the mis-packing
of the virus head with the genetic material of the host bacteria and then is released during
the lytic cycle. Conjugation and transformation are the most common means in which
ART genes are transferred (19, 38).
Horizontal gene transfer has been indirectly
observed among Bacteroides spp. and other genera in the human colon. The colon
provides a suitable environment for the potential of antibiotic resistanceAR genes to
disseminate between commensal organisms and potentially to pathogens (43). Horizontal
gene transfer of tetQ occurred between bacterial genera that normally colonize different
hosts and used a comparative approach to examine the extent of gene dissemination
between species of Bacteroides spp. This study displayed that it is possible for different
genera of Bacteroides spp. to transfer genes even though they are known to colonize
different hosts (33). Horizontal gene transfer has also been observed in vitro between
commensal and pathogenic members of the Enterobacteriaceae.
Genetic material
conferring resistance was readily transmitted suggesting that transmission is
commonplace among members of Enterobacteriaceae, a dominant member of the human
microflora maintaining a genetic reservoir for antimicrobial resistance (7). Lactococcus
lactis, a commensal bacterium that is widely distributed in nature, as well as, foodprocessing environments, is also susceptible to various gene transmissions. (17). Luo et
al (2005) found that a clumping lactococcal strain, previously known for the high
frequency transmission of important fermentation traits such as lactose utilization and
casein-hydrolyzing proteinase, is also able to acquire the AR genes effectively.
Furthermore, this inherited high frequency conjugation mechanism can further
18
disseminate the broad-host-range drug resistance-encoding plasmid pAMβ1 at a
frequency 10,000 times more than strains without the mechanism.
This suggests
commensal bacteria as such may not only serve as the AR gene pool, but potentially as
facilitator significantly enhanced the spread of the AR genes in microbial ecosystems
(25).
Recently a number of reports documented the detection of ART bacteria and AR gene
dissemination beyond the range of selective pressure in both animal and human
ecosystems. Villedieu et al. (2003) examined the prevalence of tetracycline resistant
bacteria in children that were never administered tetracycline and found that 100% of the
subjects carried ART bacteria of which 11% on average of the cultivatable microflora
was resistant to tetracycline. Gueimonde et al (2006) examined the presence of a number
of tetracycline resistance genes including tetW, tetM, tetO, tetS, tetT, and tetB, in
breastfed infants that were never administered antibiotics and found that every subject
tested had ART bacteria in their fecal samples. A recent study used germ free rats and
spiked them with a strain of tetracycline resistant Lactobacillus planterium and a nonresistant Enterococcus faecalis to examine genetic transfer in vivo. Initially no selective
pressure was administered to the rats, until several weeks into the study.
Prior to
administering the tetracycline some of the rats digestive tracts were examined to find that
genetic transfer occurred prior to selective pressure.
They also found that once
antibiotics were administered that there was only a slight increase in transmission (22).
These studies suggest that selective pressure may not be required for the colonization of
ART bacteria and transmission of AR genes if the growth environment is ideal.
19
2.7 Reservoirs for resistance genes
The emergence of AR in pathogens in the hospital environment has generally been the
focus of study. For a long time it was believed that the wide application of antibiotics in
such environment is responsible for the spread of AR genes. This view is currently
believed to be too narrow.
First, in terms of dissemination pathways, globally, an estimated 50% of all
antimicrobials used serve veterinary and agricultural purposes. The use of antibiotics in
veterinary medicine has contributed to the spread of AR and includes the use on pets,
farm animals and animals raised in aquaculture (48). In addition to human therapy, the
prophylactic use of antibiotics in agriculture affects the food animals, the environment,
and the water ways. Food animals consume antibiotics through applications to their feed
and water sources and shed antibiotic residues, as well as viable bacteria with functioning
resistance genes throughout the fields and waterways. The human body has also been
implicated as a potential reservoir for AR genes with food as a significant link between
the antibiotic genes found in the farm as well as in the human digestive tract. It has been
well documented that ART pathogens found in chicken, beef and pigs can be detected in
the meats sold in supermarkets (41). Campylobacter and Salmonella are examples of
food-borne pathogens becoming resistant in both human and veterinary medicine (55).
First reported in the Netherlands the use of fluoroquinolones, in poultry farming
(enrofloxacin) and in human medicine (ciprofloxacin) caused the increase in
20
fluoroquinolone resistant Campylobacter illness (1). A temporal increase in resistance
was observed between the administration of fluoroquinolones and the increase in resistant
populations (44). Horizontal transfer of the AR genes in the human body between
commensal bacteria and transient bacteria may be responsible for the phenomenon.
Second, pathogens only account for a very small percentage in the human microbial
community, majorities are commensal bacteria. The chance of a pathogen acquiring AR
genes directly from another pathogen is very small. Therefore improved understanding of
the size of the AR gene pool in commensal bacteria and the roles of commensal bacteria
in the spread of antimicrobial resistance are pivotal in assessing the emergence of
resistance in pathogens. The bacteria in the human gut are mostly benign and were
believed to only transfer genes between themselves. Bacteria that are transient through
the gut can also acquire resistance genes through conjugation. In 2004, 7 sprouts samples
were screened for various ART enterobacteria (8). The sprouts were determined to carry
between 107-109 CFU/g of coliform bacteria, of which remarkably 107 CFU/g were
resistant to various antibiotics. Many of the isolates maintained multiple drug resistance.
Upon examination of the seed no resistant bacteria were obtained suggesting that the
growing environment provided these bacteria (8). Another recent study examined ART
bacteria in many ready to eat foods, which illustrates the prevalence of resistant
commensal bacteria and resistance genes in many retail foods. The extent at which ART
food-borne commensal bacteria has been recently examined and the presence of 102-107
CFU of ART bacteria per gram of food has been detected.
21
Many of these foods are
consumed without further cooking or processing, and through daily intake, humans are
regularly inoculated with ART bacteria, including opportunistic pathogens as well as
commensal bacteria. Some of these bacteria include Pseudomonas spp. Streptococcus
spp., Enterococcus spp., and Staphylococcus spp.. The high concentration of resistant
bacteria suggests that food can be a potential avenue for transmitting the resistance genes
(30, 54). Many of these organisms that have been isolated from ready-to-eat foods can
survive in low pH environments, such as that of the human stomach and gastrointestinal
tract. Many of these AR genes are maintained on conjugative plasmids or transposon
which can readily be transmitted to potential pathogens creating a potential reservoir for
pathogens to acquire AR genes through gene transfer and dissemination (40).
2.8 Human microflora
The gastrointestinal (GI) tract is a specialized tube divided into various well-defined
anatomical regions which extends from the lips to the anus. The indigenous bacteria of
the human GI tract are not randomly distributed throughout the gastrointestinal tract but
instead are found at population levels and in species distributions that are characteristic of
specific regions of the tract (oral, stomach, small intestine and large intestine). The oral
cavity provides a favorable habitat for many bacteria both beneficial and disease causing.
The bacteria benefit from the high availability of nutrients and epithelial debris as well as
the continual moisture provided by the salivary glands (50).
The GI tract has an
increasing pH from stomach to large intestine, which creates an increasing gradient of
22
indigenous microbes. There are characteristic spatial distributions of organisms within
each gut compartment and at least 4 microhabitats: the intestinal lumen, the unstirred
mucus or gel layer that covers the epithelium of the entire tract, the deep mucus layer
found in intestinal crypts, and the surface of the epithelial cells (5).
The human body
hosts a complex microflora that contains more than 400 species of bacteria as well as
eukaryotic fungi, protists, virus and methanogenic archaea, of which most are
uncultivatable. The cultivatable bacteria are mostly anaerobes and are represented by 3040 species. The human gut has been estimated to contain 1011 bacteria cells/gram feces
(26).
The distinction between indigenous and exogenous microbes is critical to an ecological
understanding of colonization, succession, and mechanisms of interaction between
intestinal microbes and their host. In general the term indigenous implies these microbes
colonize part of GI tract and occupy all niches and habitats available. Where as the
exogenous species are not established and are detected in passage through the GI tract via
food, water or environment. Cleary there is some gray area between the indigenous and
exogenous, since there are some pathogens that are indigenous and can coexist in their
host without illness unless the ecosystem is disrupted. Also, some microbial species may
be indigenous to one habitat but non-indigenous to another, through which it normally
passes after it is shed from its native habitat (26). Therefore the make up of the normal
flora is continually changing and is affected by various factors including genetics, age,
stress, nutrition and diet of the individual.
23
The gastrointestinal tract of normal human fetus is sterile at birth. During the birthing
process and rapidly after, the microbes from the mother and environment quickly
colonize the gut of the newborn. After the first week of life the establishment of a stable
bacterial flora is developed (16). Infants born by cesarean delivery can also be exposed
to the microbiota of their mother, but initial exposure is most likely due to environmental
isolates from equipment, air, and other infants, with the nursing staff serving as vectors
for transfer (26). The establishment of the human microflora is not a simple process of
succession, rather it is a complex process influenced by microbial interactions with the
host, as well as the internal and external factors. Regardless of the mode of birthing or
environment of the infant, the development of the microbial flora is connected to the
anatomical development of the intestinal tract, peristalsis, bile acids, intestinal pH,
immune response, mucosal receptors, and microbial interactions (16). The diet of the
infant directly affects the bacterial composition of the gut. These commensal bacteria
originate from the nipple and surrounding skin as well as the milk ducts in the breast.
The breast fed infants are initially colonized with more Bifidobacteria spp. than formula
fed infants, but also contain more staphylococci, streptococci, corynebacteria, lactobacilli,
micrococci, and propionibacteria.
Formula fed infants also contain these bacteria;
however, studies have found these infants to host higher amounts of other anaerobes such
as Clostridium spp., Bacteroides spp., Enterobacter Spp. and Enterococcus spp. (26).
Cooperstock and Zedd used the 4 phase model to describe the development of the infant
intestinal microflora. Phase 1 is the initial acquisition phase which occurs over the first
24
few weeks of life. Phase 2 is the period of solely consuming milk. Phase 3 is the time
between the beginning of supplementation and the cessation of breast feeding and phase
4 is the conversion to adult biota patterns upon the completion of weaning. Interestingly,
during phases 3 and 4, after introduction of solid food and weaning, the differences
between breast-fed and formula-fed infants are lost and the fecal microbiota resembles
that of adults by about the second year of life (14). The succession of bacteria varies
from the individual, the mode of birth, the mode of feeding and environment, however
after the initial acquisition, developmental succession occurs during weaning, when
feeding modes shift from a liquid to a solid diet.
The human body is a complex ecosystem and is composed of many organisms that can
thrive in multiple regions and are not limited to only one. The human gastrointestinal
tract is a complex bioreactor that hosts hundreds of species of organisms. The human
intestinal microflora is essentially an “organ” that regulates epithelial development,
provides nutrition and instructs innate immunity yet it is poorly understood.
Characterization of this immense ecosystem is only the beginning step in understanding
its role in the health and disease of the host (15). This optimal environment makes the
entire system susceptible to genetic transfer event of resistance genes from region to
region or organism to organism. The major regions of the body hosting bacteria include
the skin, respiratory tract, oral cavity, stomach, small and large intestine and the
urogenital tract.
25
The skin, respiratory tract and urogenital tract are not regions that are of primary concern
in the genetic transfer of AR genes from farm to human through the food chain.
Nevertheless, the human body works as a system and each region influences the other
regions. The skin is the largest organ of the human body that comes in direct contact
with the environment. However the skin is a dry region of the body and most of the
commensal bacteria are located near the warm moist areas such as armpits, perineum,
palms of the hands and toe webs. Drier areas such as the face, arms, trunk and legs are
less colonized.
These regions are inhabited by bacteria such as Staphylococcus
epidermidis, Micrococcus species, and Corynebacterium species (2). The respiratory
tract is colonized in the upper region, inhaled organisms attach to the mucous membranes
of the nose throat and pharynx. Examples of some of the bacteria found in the upper
respiratory tract include Streptococcus salivarius, Staphylococcus aureus, and Neisseria
species (10). Unlike the upper respiratory tract, the lower tract including the trachea and
lungs does not contain bacteria in healthy individuals. Microbes are trapped and pushed
to the upper respiratory tract by tiny hairs called cilia.
The urogenital tract is free of
bacteria with the exception of the urethra and the vagina. The urethra can harbor such as
S. epidermidis, E. coli, and Proteus mirabilis and adult women tend to have Lactobacillus
acidophilius. Prepubescent girls and women that have experienced menopause tend to
have more species of bacteria such as Staphylococcus, Streptococcus, and
Corynebacterium present than Lactobacillus acidophilius (27).
26
The indigenous bacteria of the mouth, stomach, small and large intestine are beneficial to
body by synthesizing vitamins, preventing pathogens from colonizing, inhibiting the
growth of exogenous bacteria, stimulating tissue growth and cross-reactive antibody
production (50). Although beneficial to the body they can carry genes that encode for
AR.
When these commensal bacteria come in contact with bacteria from animals,
environment, food, soil or pathogens they may transfer these genes. If pathogens obtain
AR genes, it becomes more difficult to treat the infections they cause.
The oral cavity is a favorable environment for bacteria to thrive on the constant supply of
food and epithelial tissue. The mouth provides a low oxygen environment and harbors
organisms such as Streptococcus mitis, Proteus species, and Veillonellae species (10).
The stomach has the least amount of colonized bacteria due to the highly acidic
environment and host organisms such as, acid-tolerant Lactobacillus and Streptococcus
species (27).
The intestines are the part of the GI tract that descends between the stomach and the
rectum. The intestines are split into two major components the small and large intestines.
The lining of the small intestine is coated by a simple columnar epithelial tissue, which is
the portion of the GI tract where most of the nutrients from digested food are absorbed
through folds in the intestinal wall called plicae circulares. Plicae circulares have fingerlike tissues called villi that protrude from the folds that are covered further with finer
27
hairs called micovilli which together increase the surface area of the small intestine. The
increase in surface area makes the small intestine an efficient organ for the secretion of
enzymes and the absorption of nutrients (49).
The small intestine is comprised of 3
major parts: the duodenum, jejunum and ileum and the pH gradually increase from 4-5 at
the duodenum to 7-8 in the ileum (18). The duodenum regulates the emptying of the
stomach and is responsible for most of the chemical breakdown of food in the small
intestine. Most of the nutrients are absorbed in the jejunum and the ileum, which include
the passive transport of fructose and the active transport of amino acids, small peptides,
vitamins and glucose. The ileum functions to absorb the remaining products that were
not absorbed in the jejunum as well as vitamin B12 and bile salts (31). The constant
movement through the small intestine makes it difficult for bacteria to colonize because
they get washed out very quickly. As a result the concentration of bacteria in the small
intestine remains relatively low with a concentration of approximately106 bacteria per ml.
The predominant organisms colonizing the small intestine are comprised mostly of
lactobacilli, streptococci, staphylococci and yeasts although there are the presence of
some coliforms and anaerobes are present in low concentration (50).
The large intestine extends from the ileocecal valve to the anus and has the largest
concentration and diversity of commensal bacteria ranging in the billions. The pH of the
large intestine is relatively neutral roughly around 7.0 and hosts over 700 species of
bacteria existing which perform a variety of functions. These functions include the
absorption of short-chain fatty acids metabolized by bacteria from undigested
28
polysaccharides. These bacteria also produce vitamins such as vitamin K and Biotin.
There is also a production of cross reactive antibodies produced by the immune system
against the normal flora which are effective against pathogens thereby preventing
infection or invasion. The large intestine is coated by a mucus layer which also protects
the intestine from attacks by the colonic commensal bacterial (46). Examples of the
major commensal bacteria species living in the large intestine are Bacteroides spp.,
Lactobacillus spp., Clostridium spp., Bifidobacterium spp., Staphylococcus spp.,
Enterococcus spp., Salmonella spp., Klebsiella spp., Enterobacter spp. and Escherichia
spp. (50).
2.9
Means to assess bacterial populations
Bacterial detection and population measurements are traditionally achieved by cultivation
the samples in liquid media or plating on bacterial agar plate with proper dilutions
followed by incubation under optimal conditions. However, examining the bacteria from
human digestive tract is problematic because most of the microflora is not cultivatable in
vitro. Also, many of these microbes inhabit the gut in lower concentrations or are slow
growers that have specific nutritional requirements and go undetected by standard plating
methods.
Selective enrichment is a means of cultivating organisms that have low
population concentrations or bacterium that are slow growing by providing specific
nutritional requirements and environmental conditions that are optimal for their growth.
29
Although selective enrichment is a powerful tool for detecting target organisms, it creates
a detection bias due to its selectivity and is only valuable for detection not assaying
populations (27).
Culture-independent methods, particularly, nucleic acid-based analysis is becoming one
of the most useful tools for detection and population analysis in recent years. It can
provide quantitative and qualitative analysis on organisms that were previously not
examined by extracting the DNA of the entire population regardless of the ability to
cultivate.
Many molecular tests have been developed to assay DNA and rRNA,
revolutionizing the way the human gut is examined. NCBI databases have been applied
to analyze results from cloning and sequencing of rDNA, fluorescence in situ
hybridization and dot blot hybridization using oligonucleotide probes and species or
group specific PCR. These applications have developed an accumulation of sequence
data, which have been used to identify the un-cultivatable bacteria. The 16S rDNA is a
conserved region and has been used to reconstruct phylogenetic trees. PCR allows
experimenters the ability to amplify genes to a detectable concentrations and real time
PCR technology provides a means to continually monitor quantitative changes especially
for sub-dominant species. A recent study compared the sensitivity of quantification
studies between two 5’nuclease assays and dot-blot hybridization using rDNA probes.
They concluded that both real-time assays achieved similar results and both were faster,
less expensive and had superior sensitivity in comparison to dot-blot hybridization (29).
30
This study suggests that real time PCR has a great potential in the analysis of human
microbiota.
Conventional PCR can be viewed as a quantitative amplification of DNA of limited
precision that is analyzed by an endpoint analysis. There are three basic steps in the
amplification process, the melting step which separates the double stranded DNA into
single strands, the annealing step which binds Taq polymerase and primers to the single
stranded DNA, and the elongation step which adds the complementary nucleotides to the
single stranded DNA rendering a double stranded copy at a rate of 2n per reaction where
n is the number of cycles. Essentially, real time PCR is the same as conventional PCR;
with the addition of a fluorescent molecule to the PCR reaction and an optical module to
the thermocycler to detect the increase in fluorescent signal.
The main difference
between the two methods is that conventional PCR analyzes the end product where as
real-time detects amplification during the reaction. The fluorescent chemistries used in
real-time PCR are either DNA binding dyes or fluorescently labeled sequence primers or
probes, which are detected during the amplification cycle. The advantage of using real
time PCR over other molecular tools is the ability to determine the starting template copy
number with a high degree of accuracy with an error rate of about 1 in 9000 nucleotides.
Real-time PCR that is quantitative is known as qPCR. Initially the sample fluorescence
remains at background levels until enough amplified product is produced to yield a
detectable signal in the optical module. The cycle at which this occurs is called the
threshold cycle or CT. The CT is determined by the amount of template present at the
31
beginning of the reaction. Therefore qPCR should be optimized to ensure accurate
reproducible quantification to the sample.
The quality of a qPCR is assayed by
developing a linear curve, and calculating the amplification efficiency as well as
observing the consistency across replicate reactions. (6)
32
BIBLIOGRAPHY
1. Aarestrup, F.M., Jensen, N.E., Jorsal, S.E. and T.K. Nielsen. 2000. Emergence
of resistance to fluoroquinolones among bacteria causing infections in food animals
in Denmark. Vet Rec. 146: 76-78.
2. Albrecht T, et al. 1996. “Bacteriology: Normal Flora.” Medical Microbiology,
4th Edition. University of Texas.
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mmed.section.508.
3. Antibiotic FAQ. McGill University, Canada. Antibiotics and student health.
http://www.mcgill.ca/studenthealth/information/generalhealth/antibiotics/ Viewed
on 4-13-2008.
4. Barton, M. 2000. Antibiotic use in animal feed and its impact on human health.
Nutr Res Rev. 13:279-299.
5. Berg R.D. 1996. The indigenous gastrointestinal microflora. Trends Microbiol.
4:430–5.
6. Bio-Rad Laoratories, Inc. 1999. BIORAD Hand book Bio-Rad Laoratories, Inc.
Hercules, CA.
7. Blake, D.P., Hillman, K., Fenlon, D.R. and J.C. Low. 2003. Transfer of
antibiotic resistance between commensal and pathogenic members of the
Enterobacteriaceae under ileal conditions. J Appl Microbiol. 95: 428-436.
8. Boehme, S., Werner, G., Klare, I., Reissbrodt, R., and W. Witte. 2004.
Occurrence of antibiotic-resistant enterobacteria in agricultural foodstuffs. Mol.
Nutr. Food Res. 48: 522-531.
9. Center for Disease Control and Prevention. 2007. Get smart: know when
antibiotics work. http://www.cdc.gov/narms/faq_pages/11.htm (Viewed
September 2007).
10. Champonux JJ, Drew WL, Falkow S, Neidhardt FC, Plorde JJ, and C.G.Ray.
1994 Sherris Medical Microbiology: An Introduction to Infectious
Diseases. Connecticut: Appleton & Lange.
33
11. Chee-Sanford J.C., Aminov R.I., Krapac I.J. Garrigures-Jeanjean N., and R.I.
Mackie. 2001. Occurrence and diversity of tetracycline resistance gene in lagoons
and groundwater underlying two swine production facilities. Appl Environ
Microbiol. 67:22-32.
12. Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action,
applications, molecular biology, and epidemiology of bacterial resistance.
Microbiol. Mol. Biol. Rev. 65:232–260.
13. Commission on Antimicrobial Feed Additives. 1997. Antimicrobial Feed
Additives. Stockholm: Ministry of Agriculture. Chapter 1-4: 1-140.
14. Cooperstock MS, and A.J. Zedd. 1983. Intestinal flora of infants. In: Hentges DJ,
ed. Human intestinal microflora in health and disease. New York: Academic Press,
p.79–99.
15. Eckurg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M.,
Gill, S.R., Nelson, K.E. and D.A. Relman. 2005. Diversity of the human intestinal
microbial flora. Science. 10:1635-1638.
16. Fanaro, S., Chierici, R., Guerrini, P. and V. Vigi. 2003. Intestinal microflora in
early infancy: composition and development. Acta Paediatr Suppl. 441:48-55.
17. Gasson, M. J. 1990. In vivo genetic systems in lactic acid bacteria. FEMS
Microbiol. Rev. 87:43–60.
18. Geus, Eddes, Gielkens, Gan, Lamers, and Masclee. 1999. Post-prandial
intragastric and duodenal acidity are increased in patients with chronic pancreatitis
Aliment Pharmacol Ther. 13:937–943.
19. Gilliver, M. A., Bennett, M., Begon, M., Hazel, S. M. and C.A. Hart. 1999.
Antibiotic resistance found in wild rodents. Nature 401: 233-234.
20. Gueimonde, M., Salminen, S., and E. Isolauri. 2006. Presence of specific
antibiotic (tet) resistance genes in infant faecal microbiota. FEMS. 48: 21-25.
21. Holmes RK, and M.G. Jobling. 1996. Genetics: Exchange of Genetic Information
in: Baron’s Medical Microbiology 4th ed., Chapter 5. Univ of Texas Medical
Branch.
34
22. Jacobsen, L., Wilcks, A., Hammer, K., Huys, G., Gevers, D., and S. Andersen.
2007. Horizontal transfer of tet (M) and erm(B) resistance plasmids from food
strains of Lactobacillus plantarum to Enterococcus faecalis JH2-2 in the
gastrointestinal tract of gnotobiotic rats. FEMS Microbiol Ecol. 59:158–166.
23. Levy, S.B., McMurry, V., Burdett, P., Courvalin, P., Hillem, W., Roberts, M.C.,
and D.E. Taylor. 1989. Nomenclature for tetracycline resistance determinants.
Antimicrob Agents Chemother. 33:1373-1374.
24. Lewis, R. 1995. The rise of antibiotic- resistant infections. FDA consumer
magazine. September issue. http://www.fda.gov/fdac/features/795_antibio.html
25. Luo, H., Wan, K., H.H. Wang. 2005. High-Frequency Conjugation System
Facilitates Biofilm Formation and pAM_1 Transmission by Lactococcus lactis.
Appl Environ Microbiol. 71: 2970–2978.
26. Mackie, R.I., Sghir, A. and H.R. Gaskins. 1999. Developmental microbial
ecology of the neonatal gastrointestinal tract. Am J Clin Nutr. 69:1035-1045.
27. Madigan, M.T., Martinko J.M., and J. Parker. Brock Biology of
Microorganisms, 8th Edition. New Jersey: Prentice Hall, 1997.
28. Mailer, J.S., and B. Mason. Penicillin: Medicine’s wartime wonder drug and its
production at Peoria, Illinois. lib.niu.edu. (viewed 4-13-2008).
29. Malinen E., Kassinen A., Rinttila T, and A. Palva. 2003. Comparison of realtime PCR with SYBR Green I or 5’ nuclease assays and dot-blot hybridization with
rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria.
Microbiology 149: 269-277.
30. Manuzon.M.Y., Hanna, S.E, Luo, H. Yu. Z., Harper W.J. and H.H. Wang.
2007. Quantitative assessment of the tetracycline resistance gene pool in cheese
samples by real-time TaqMan PCR. Appl Environ Microbiol. 73:1676-1677.
31. Maton, A, Hopkins, J., McLaughlin, C.W., Johnson, S., Warner, M.Q., LaHart,
D., and J.D. Wright. 1993. Human Biology and Health. Englewood Cliffs, New
Jersey, USA: Prentice Hall.
32. Marquez, B. 2005. Bacterial efflux systems and efflux pumps inhibitors. Biochimie.
87 1137–1147.
35
33. Nikolich, M.P., Hong, G., Shoemaker, N.B. and A.A. Salyers. 1994. Evidence
for natural horizontal transfer of tet Q between bacteria that normally colonize
humans and bacteria that normally colonize livestock. Appl Environ Microbiol.
60:3255-3260.
34. Paulsen, I.T., et al. 2003. Role of mobile DNA in the evolution of vancomycinresistant Enterococcus faecalis. Science. 299:2071-2074.
35. Phillips, I., Casewell, M., Cox, T., DeGroot, B., Friis, C., Jones, R., Nightingale,
C., Preston, R. and J. Waddell. 2004. Does the use of antibiotics in food animals
pose a risk to human health? A critical review. J Antimicrob Chemother. 53: 28-52.
36. Presoctt, J.F. and J.D Baggot. Antimicrobial therapy in veterinary medicine, 2nd
edition. Ames, IA: Iowa State University Press 1997.
37. Roberts, M.C. 1994. Epidemiology of tetracycline resistance determinants. Trends
Microbiol. 2:353-357.
38. Roberts, M.C. 1996. Tetracycline resistance determinants: mechanisms of action,
regulation of expression, genetic mobility and distribution. FEMS Microbiology
Review. 19:1-24.
39. Rolinson G. N. 1998. Forty years of lactam research J Antimicrob Chemother
41:589–603.
40. Salyers, A.A., Gupta, A., and Y. Wang. 2004. Human intestinal bacteria as
reservoir for antibiotic resistance. Trends Microbiol. 12:412-416.
41. Salyers, A.A and N. Shoemaker. 2006. Reservoirs of antibiotic resistance genes.
Anim Biotechnol, 17:137–146.
42. Schnappinger, D., and W. Hillen. 1996. Tetracycline: antibiotic action, uptake,
and resistance mechanisms – A mini review. Arch Microbiol. 165: 359-369.
43. Shoemaker, N.B., Vlamakis, K., Hayes K. and A.A. Salyers. 2001. Evidence for
extensive resistance gene transfer among Bacteriodes spp. and among Bacteroides
and other genera in the human colon. Appl Environ Microbiol. 67:561-568.
44. Smith D.L., Harris A., Johnson J., Silbergeld E., G. Morris. 2002. Animal
antibiotic use has an early but important impact on the emergence of antibiotic
resistance in human commensal bacteria. PNAS. 99:6434-6439.
36
45. Snyder, L. and W. Champness. 2003. Molecular genetics of Bacteria. Pgs 197215. ASM Press, Herndon, VA.
46. Stremmel, W. 2005. Retarded release phosphatidylcholine benefits patients with
chronic active ulcerative colitis. Gut. 54: 966-971.
47. Taylor, D.E., and A. Chau. 1996. Tetracycline resistance mediated by ribosomal
protection. Antimicrob. Agents Chemother. 40: 1-5.
48. Teuber, M. 2001. Veterinary use and antibiotic resistance. Curr Opin Microbiol.
4:493-499.
49. Thomson A, Drozdowski L, Iordache C, Thomson B, Vermeire S, Clandinin M,
and G. Wild. 2003. Small bowel review: Normal physiology, part 1. Dig Dis Sci.
48:1546-64.
50. Todar, K. 2002. University of Wisconsin Department of Bacteriology Madison,
Wisconsin. www.textbookofbacteriology.net Online text book.
51. US. Department of Health and Human Services. 2007.
http://www.niaid.nih.gov/factsheets/antimicro.htm. (Viewed September 2007).
52. Van den Bogaard, A.E., and E.E. Stobberingh. 1999. Antibiotic Usage in
Animals- Impact on bacteria resistance and public health. Drugs 58:589-607.
53. Villedieu, A., Diaz-Torres, M.L., Hunt, N., McNab, R., Spratt, D.A., Wilson, M.
and P. Mullany. 2003. Prevalence of tetracycline resistance gene in oral bacteria.
Antimicrob Agents Chemother. 47: 878-882.
54. Wang H.H., Manuzon M., Lehman M., Wan K., Luo H., Wittum T.E., Yousef
A., and L.O. Bakaletz . 2005. Food commensal microbes as a potentially
important avenue in transmitting antibiotic resistance genes. FEMS Microbiol lett.
254:226-231.
55. Wassenaar, T. 2005. Use of antimicrobial agents in veterinary medicine and
implications for human health. Crit Views Microbiol. 31:1555-169.
37
CHAPTER 3
PROFILES OF TETRACYCLINE RESISTANT BACTERIA IN THE HUMAN
INFANT DIGESTIVE SYSTEM
3.1
Objectives
The objective of this study was to reveal the impact of the food chain on bacterial
antibiotic resistance (AR) profiles in the human gut by analyzing the population of
antibiotic resistant (ART) bacteria in infant fecal samples. ART bacterial population of
infant subjects at various growth stages were assessed using both conventional culturing
method and culture-independent real-time PCR. In addition, the shift of ART bacterial
profiles in infant subjects from newborn to solid food consumption was examined.
3.2
Introduction
The rapid emergence of antibiotic resistant (ART) pathogens threatens public health and
demands for a thorough understanding on the origination, maintenance and dissemination
of antibiotic resistance (AR) in the environment and the hosts, in order for the
development of targeted control strategies. Natural horizontal gene transfer mechanisms
38
such as conjugation and transformation play a key role in the spread of the AR gene
among various strains of bacteria from within the species to cross genera (5, 10). The
selective pressure due to the applications of antibiotics in human and veterinary clinical
treatments and in food animal, aquacultural and agricultural productions certainly
enriched the resistant population in bacteria. However, limiting the use of antibiotics in
clinical therapy and in food animal production does not seem to be enough to control the
spread of AR (9). Meanwhile, new evidences suggest that AR may be maintained at the
absence of the corresponding antibiotic (6, 7, 8, 16, 17).
Several recent studies examined the prevalence of ART bacteria in the oral cavity of
healthy children that were not administered antibiotics in the past 3 months and found
that 100% of the subjects carried ART bacteria, of which 11% on average of the
cultivatable microflora was resistant to tetracycline and 7% were resistant to
erythromycin (16, 17). Amoung the Tetr bacteria, many were also resistant to amoxicillin
and gentamycin (3). A number of studies have also illustrated that human fecal samples
are prevalent of ART bacteria (6, 8, 14). Although most of the ART bacteria found in
human ecosystems likely are commensal bacteria instead of pathogens, these bacteria
may serve as “immobilized” donors constantly supplying AR genes to potential recipients
via horizontal gene transfer mechanisms, including pathogens, inside the hosts. Therefore,
the internalized AR gene pool represents a potential risk to public health.
39
Recent studies have also illustrated that there is a large load of ART commensal bacteria
with AR genes in a variety of retail foods, many of which would normally be consumed
without further cooking or processing. Therefore through daily food intake, humans are
routinely inoculated with ART bacteria, including opportunistic pathogens, as well as
commensals.
Commonly identified AR gene carriers include but not limit to
Pseudomonas spp., Enterococcus spp., Streptococcus spp., Lactococcus spp., and
Staphylococcus spp. (1, 4, 18). Many of these bacteria have the ability to survive low pH
conditions comparable to those found in food matrices passing through the stomach (19).
The AR genes from the food isolates can be transmitted to human residential and
pathogenic organisms via natural gene transformation in the laboratory settings,
suggesting their mobility and functionality in the recipients (Wang et al., 2006; Lehman
et al, manuscript in preparation). A critical issue yet to be addressed is whether the ART
bacteria found in the human digestive microflora, without antibiotic exposure, are
originated from food intake. Recently, Gueimonde et al. (2006) found a number of tetr
gene pools in fecal samples from breastfed infant subjects who had not been treated with
the antibiotic treatment. While this result challenged the empirical belief that selective
pressure, being tetracycline in this case, would be essential in the establishment of the
corresponding resistant population in the ecosystems, it also suggested that ART bacteria
were established during early human development stages. Further studies to reveal the
origination, development and persistence of the gut ART bacteria are greatly needed.
40
Tetracycline and its derivatives are broad spectrum antibiotics with activity against a
wide range of Gram-positive and Gram-negative aerobic and anaerobic bacteria. Unlike
penicillin, tetracycline is still considered an effective antibiotic option in therapeutic
treatments. However, since it has been utilized extensively in the past several decades,
Tetr bacteria (both pathogens and commensals) and the corresponding tetr genes are now
found in various environmental, animal and human ecosystems (6, 7, 8, 11, 12, 16). Its
prevalence exemplified various mechanisms that contributed to the AR maintenance,
circulation and dissemination in the microbial ecosystems. Therefore, we choose to
investigate the development of tetr bacteria in infant subjects before conventional food
consumption to illustrate the contribution of food intake in the AR development in human
digestive ecosystems.
3.3
Material and methods
3.3.1
Subjects and sampling
Healthy infant subjects between the ages of newborn to 12 months that have not taken
antibiotics were recruited. Fecal samples were collected from diapers and delivered
within 12 hours of production.
Laboratory processing of the samples occurred
immediately upon receipt.
41
3.3.2
Culturable microbial population assessment using conventional agar plating
Diapers with infant fecal samples were collected by trained parents, saved at 4°C and
delivered to research staff members at their earliest convenience. One gram was taken
from each fecal sample and serially diluted in 9 mL of 0.85% NaCl solution. Samples
were plated in duplication on the following media as indicated in the study to measure the
culturable microbial population: Columbia blood agar plate, containing 5% defibrinated
sheep blood (Colorado Serum Co., Denver, CO), MRS, Columbia Broth plates
supplemented with 5% glucose, Reinforced Clostridial Agar, Enterococcus Agar, and
Brain Heart Infusion Agar. The same media containing 16 µg-mL-1 of tetracycline
(Fisher Biotech, Fair Lawn, NJ) were used to assess the tetr sub-populations. All of the
media used in this study were obtained from Becton Dickinson and Company of Franklin
Lakes, NJ. All plates contained 100 µg-mL-1 cycloheximide (Sigma-Aldrich, St. Louis,
MO) to minimize the growth of yeasts and molds, and were incubated in anaerobic
conditions using BBL Gas Pac containers and anaerobic envelopes (BD BBL, Franklin
Lakes, NJ) at 37oC for 48 hours.
3.3.3
DNA template preparation
DNA from bacterial isolates used for conventional PCR screening for tetM gene and 16S
rDNA identification were prepared using the bead beading and boiling method. Briefly,
bacterial isolates were suspended in lysate tubes (BioSpec Products, Bartlesville, OK)
42
containing 120 µL of sterile dH2O (pH 10.5) and 100 mg of 0.1 mm diameter glass beads
(Biospec Products Inc., Bartlesville, OK). The samples were homogenized twice using
the Mini-Beadbeater™ (BioSpec Products, Bartlesville, OK) for 3 minutes at maximum
speed. The lysate tubes were then placed in boiling water for 15-20 minutes followed by
an ice bath for another 10 minutes. The samples were centrifuged for 2 minutes at
16,000 x g, and 5µL of the supernatant and its diluents were used as the template in
standard 50 µL PCR reactions.
For real-time quantitative PCR analysis, the DNA templates from fecal samples were
extracted following the procedures described previously (Yu and Morrison, 2004) with
slight modification. Briefly, 0.25 gram of fecal sample was suspended in 1 ml of lysis
buffer in a 2 ml screw-cap lysate tubes, along with 0.4 g sterile glass beads (0.3g of 0.1
mm and 0.1g of 0.5 mm, Biospec Products Inc.). The sample was homogenized for 3
min using the Mini-Beadbeater™, followed by centrifugation for 5 min. The supernatant
was transferred to a 1.5 ml eppendorf tube. The extraction was repeated one more time
using 300 µL of fresh lysis buffer to the lysate tube followed by another round of
homogenization and centrifugation. The supernatant from two extracts were pooled and
proteins were removed by the addition of a 10M ammonium acetate solution. The total
DNA was precipitated with a 1:1 volume of isopropanol at –200C for 30 minutes. The
pellets were dried under a vacuum desiccator and resuspended in TE buffer. The RNA
and remaining protein contaminants were removed by incubating with 2 µL of DNase
free RNase (10mg/mL) at 37oC for 15 min, and 15 µl proteinase K with 200µL Buffer
43
AL (from the QIAamp DNA Stool Mini Kit) at 70oC for 10 min. The DNA was further
purified using the QIAamp column and centrifuged at 16,000 x g for 1 min. The samples
were washed using 500µL of Buffer AW1 and Buffer AW2 (from the QIAamp DNA
Stool Mini Kit) and the DNA was eluted in 200µL of Buffer AE (from the QIAamp DNA
Stool Mini Kit) and stored at -20°C (20).
3.3.4
Screening for representative tetr gene and identification of AR gene carriers
Tetracycline resistant isolates containing the tetM gene were screened by conventional
PCR. The pair of primers used to amplify the 974 bp tetM fragment was tetM FP 5’CGAACAAGAGGAAAGCATAAG-3’
and
tetM
RP
5’-
CAATACAATAGGAGCAAGC-3’ (Sigma-Aldrich., St. Louis, MO). The conditions for
PCR amplification of the tetM gene were: one cycle at 95°C for 5 min, followed by 35
cycles at 95°C for 30 sec, 53°C for 30 sec, and 68° C for 50 sec and 1 cycle at 68°C for 5
min. PCR products were visualized on 1% agarose gel and products of the expected
length were purified using the QIAquick kit (Qiagen, Valencia, CA) following
manufacturer’s instructions. The sequences of the PCR fragments with the proper size in
15 % of the samples were determined using a DNA analyzer (ABI PRISMs 3700,
Applied Biosystems, Foster City, CA) at the Plant Microbe Genomics Facility, The Ohio
State University. The DNA sequences were compared with published tetM resistance
gene sequences deposited in the NCBI database.
44
Representative tetM+ isolates were identified using16S rDNA sequence analysis. The
primer
pair
16S-up
5’-AGAGTTTGATCCTGGCTCCG-3’
and
16S-down
5’-TACCTTGTTACGACTT-3’(Sigma-Aldrich, St. Louis, MO) were used to amplify a
1.5 kb fragment by conventional PCR as describes previously (2). The identities of the
AR gene carriers at the genus level were determined by comparing the sequences of
the16S rRNA fragments with those deposited in the NCBI database.
3.3.5
A
Quantitative assessment of the tetM gene pool by Taqman real-time PCR
pair
of
tetM-specific
GAACATCGTAGACACTCAATTG
Taqman
-3’,
PCR
primers
and
(tetMrealFP
tetMrealRP
5’5’-
CAAACAGGTTCACCGG-3’) franking a 169 bp tetM fragment and a tetM-specific
probe
(5’-FAM-CGGTGTATTCAAGAATATCGTAGTG-BHQ-3’)
were
designed
following procedures described previously (2). The primers were synthesized by SigmaAldrich (St. Louis, MO) and the probe was made by Biosearch Technology Inc. (Novato,
CA). The qPCR thermoprofiles consisted of one cycle at 95°C for 3 min, followed by 40
cycles at 95°C for 30 sec, 53°C for 30 sec, and 68°C for 20 sec and 1 cycle at 68°C for 5
min, using an iCycler (Bio-Rad Laboratories,Hercules, CA). The sequence of this169 bp
real-time PCR amplicon is within the region of a 1257 bp tetM fragment flanked by
primers tetM FP and tetM realRP.
45
The pair of primers (tetM FP 5’-CGAACAAGAGGAAAGCATAAG-3’and realRP 5’CAAACAGGTTCACCGG-3’) and the DNA extract from a tetM+ isolate Enterococcus
sp. ACF-R1-1 were used to amplify the 1257 bp tetM fragment by PCR. The DNA
concentration was quantified by a pico green assay with a nanodrop (ND 3300
flurospectrometer, Wilmington, DE) and converted to copy numbers using the formula
[DNA Mass concentration / Molecular weight] x 6.022 x 1023 copies/mol-1=copies per µL,
where MW is the molecular weight of the 1257 bp PCR product. The standard curve
used to quantify the tetM gene copy numbers was created based on the Ct values from the
real-time PCR using the primer pairs tetMrealFP and tetMrealRP, the tetM-specific probe,
as well as a tenfold serial dilutions of the sequenced 1257 bp tetM PCR product with the
concentrations between 102 and 108 gene copies as the PCR amplification template. The
standards ranged from 1.9 x 108 to 1.9 x 102 gene copies per reaction were always run in
triplicate parallel during fecal sample analyses.
The potential of the qPCR in assessing AR gene pools was validated by measuring the
tetM gene pool in a pure culture of the tetM+ Enterococcus sp. ACF-R1-1.
The cells
were grown overnight at 37° C in BHI with 16 µg-mL-1 tetracycline, serially diluted in
0.85% NaCl solution, and the DNA was extracted from 1 mL of the diluted culture. The
extracted DNA was used for real-time PCR. The bacterial cell numbers of the diluted
samples were determined by plating 100µL of diluted culture on BHI agar plates
containing 16 µg-mL-1 tetracycline and grown over night at 37°C.
46
The efficiency of the developed procedures in assessing the AR gene pool in fecal
samples was validated by artificially spiking a serially diluted pure culture of the tetM+
Enterococcus sp. ACF-R1-1 into a meconium fecal sample which had an undetectable
concentration of ART bacteria. Total DNA was extracted following the procedure as
described above. The original, 10-1, 10-2 and 10-3 dilutions of the DNA extracts were used
as templates for qPCR. The derived tetM copy numbers by real-time qPCR were used to
compare with the ART bacteria counts by the conventional plating method.
3.4
3.4.1
Results
Assessing culturable gut microflora by conventional plate counting
The human gut flora is quite complex, therefore there is no single medium that can be
used to recover all the bacteria. To choose the right medium (or media) to properly assess
the magnitude of cultivable microflora from human gut, 7 different media were used in
the pilot study for both total plate counting and tetracycline resistant bacteria counting.
The bacterial counts on Columbia Blood Agar plates with 5% sheep blood were found to
sustain the highest or near highest numbers among all types of media, while the bacterial
colonies also had the greatest diversity in morphology (Figure 3.1).
47
Log 10 CFU/g
10.00
9.00
TSA
8.00
TSA tetr
7.00
CBA
CBA tetr
6.00
MRS
5.00
MRS tetr
4.00
RCA
3.00
RCA tetr
2.00
ENT
1.00
ENT tetr
0.00
Baby A
Baby D
Baby G
Figure 3.1 Variability in microbial recovery on selected bacterial media. TSA-Tryptic Soy Agar,
CBA – Columbia Blood Agar with 5% Sheep Blood, MRS Agar – (Lactobacillus Agar) to De Man, Rogosa
and Sharpe, CBA – Columbia Blood Agar with 5% Sheep Blood, RCA – Reinforced Clostridial Agar,
ENT- Enterococcus Agar. All selective plates contain 16 µg/ml-1 tetracycline. Values represented here are
the mean result for replicate plates and the standard deviation was always less then 10%.
Therefore Columbia Blood Agar plates with 5% sheep blood at the absence (CBA) and
presence of 16 µg-mL-1 tetracycline (CBA T16) were used in further studies to measure
the magnitude of total microflora and tetr bacterial population in infant fecal samples.
48
3.4.2
Prevalence of Tetr bacteria in infant fecal samples
Tetracycline resistant bacteria were found in all subjects beyond one day of age. The
plate counts for all infant fecal samples were summarized in Figure 3.2. There were no
detectable counts for meconium samples which were produced at day 1 from two
independent infant subjects’ on any of the plates. Months 1, 2, 3, 4, 5, 7, 8, 10 and 11
were represented by one subject and month 6 was replicated by two different subjects and
the data seemed to follow a 3rd order polynomial regression curve. The total plate count
regression curve was represented by the equation y = 0.0416x3 - 0.8626x2 + 5.0547x +
0.8204, where as the Tetracycline resistant plate count regression curve equation was
y = 0.0398x3 - 0.8108x2 + 4.573x + 0.6189.
12
Log10 CFU per g
10
8
6
TPC
4
Tetr
2
0
0
2
4
6
8
10
12
14
Age in Months
Figure 3.2 Total and tetracycline resistant plate counts of 11 infant subjects. The meconium samples
had no viable colonies on either total plate counts or selective plates and are represented at the lower limits
of detection. The relationship between CFU/g and age were tested by polynomial regression TPC R2 =
0.89 (P< 0.001) and Tetr R2 = 0.92(P< 0.000). Values represented here are the mean result for replicate
plates and the standard deviation was always less then 10%.
49
The microbial population in these subjects ranged from 1.1 x 108 to 2.1 x 1010 CFU/g of
sample, with the lowest count found in the 4 and 6 month-old baby. The tetr population
ranged from 5.5 x 105 to 1.8x 108 CFU/g of sample within these subjects. Overall the
non-selective plates recovered 1 to 2 logs more bacteria than the tetracycline-containing
plates, suggesting approximately 1-10% of the cultivable gut bacteria are tetracycline
resistant.
3.4.3
Assessing the tetM gene pool by real-time qPCR
Figure 3.3 illustrates the standard curve for qPCR using the developed tetM-specific realtime PCR primer-and-probe set and with an R2 value of 0.9968. The standards ranged
from 1.9 x 108 to 1.9 x 102 gene copies per reaction were always run in triplicate parallel
during fecal sample analyses.
40
35
y = -4.1114x + 44.819
Threshold cycle (Ct)
2
R = 0.9968
30
25
20
15
10
5
1
2
3
4
5
6
7
8
Log10 tet M gene copy number
Figure 3.3 Standard curve. Serial dilution of purified tetM PCR product detected
by real-time PCR used for quantification of gene copy numbers.
50
9
The tetM copy numbers from diluted pure culture cells of Enterococcus sp. ACF-R1-1 in
Figure 3.4 were approximately 1-2 logs lower than the corresponding bacterial plate
Log 10 te t M ge ne c opie s /m l
counting numbers from the same samples
y = 1.0307x - 1.7374
R2 = 0.9086
7.00
6.00
5.00
4.00
3.00
2.00
1.00
0.00
2.00
3.00
4.00
5.00
6.00
7.00
8.00
Log10 CFU / ml
Figure 3.4 Extraction efficiency of tetM-specific qPCR. The correlation between the plate
counts and real-time PCR detection using a serially diluted pure culture of tetM+ Enterococcus sp.
ACF-R1-1.
The tetM gene copy numbers of the fecal samples inoculated with serially diluted tetM+
cells were also compared with the plate count results of the same samples, and the copy
numbers was about a log lower than the plate count number (Figure 3.5). The results
suggest that the efficiency of the described qPCR approach is no more than 10% of the
total tetM+ population.
51
Log10 tet M gene copies/g
10.00
y = 1.1209x - 1.9793
9.00
R = 0.9947
2
8.00
7.00
6.00
5.00
4.00
3.00
2.00
4.00
5.00
6.00
7.00
8.00
9.00
10.00
r
Log 10 tet resistant CFU/g
Figure 3.5 Validation of extraction by artificially spiking meconium with pure culture.
AR gene pool in fecal samples was validated by artificially spiking a serially diluted pure culture
of the tetM+ Enterococcus sp. ACF-R1-1 into a meconium fecal sample which had an undetectable
concentration of ART bacteria.
The tetM gene was found in each infant fecal sample with the exception of the meconium
samples by conventional PCR (data not shown). The tetM gene pool in all infant fecal
samples, with the exception of the meconium samples, ranged from 9.0 x 105 to 9. 0 x 108
copies per gram of sample, measured by qPCR using the tetM-specific primer-and-probe
set (Figure 3.6). The size of the gene pool varied with subject and age.
52
Log10 tet M gene copies/g
10
9
8
7
6
5
4
3
2
1
0
0
2
4
6
8
10
12
Age in M onths
Figure 3.6 The distribution of tetM gene pool in 11 infant subjects. The meconium samples
had no detectable concentrations of the tetM gene and were below the limits of detection. The
relationship between tetM gene copy/g and age were tested by 3rd order polynomial regression
with an R2= 0.72 (P= 0.007). The regression equation was y = 0.033x3 - 0.6602x2 + 3.8274x +
1.1989. Each point is the mean of 2 qPCR runs with 3 technical replicates per run.
3.4.4
The shift of ART bacterial population during infant development
The total and tetr bacterial plate counts of fecal samples at various points over the course
of a year from two identical twin subjects (Baby E and Baby F) were summarized in
Figure 4.7. The subjects were from the same family so the impact of environmental
factors on microbial population in these subjects was similar. Baby E had 103 CFU/g-1 of
sample on both the selective and nonselective plates for the meconium sample produced
within 24 hrs, and Baby F had no viable counts on either selective or non-selective plates.
The twins were further sampled on day 1, 2 weeks, and months 1, 2, 3, 4, 7, 8, 10 and 11.
At 2 weeks of age the resistant counts for both infants were approximately 1.50 x 105
53
CFU/g of sample, which was almost half of the counts of the non-selective plate counts.
By the beginning first month, the non-selective plates yielded around 7.00 x 109 CFU/g
and the tetr counts were approximately two logs less. After one month of age the nonselective bacterial counts in the twin subjects were 1 to 3 logs higher than the counts from
the tet plates. Based on the polynomial regression curves in Figure 3.7, the difference
between the two subjects throughout the examination period suggests that the Tetr
bacteria did not vary greatly. A Wilcoxon test was conducted to determine if there was a
statistical difference between the subjects which resulted in a P value of 0.002 suggesting
that there is not a statistical difference between the two subjects.
r
Total Plate Counts
Tet Plate Counts
12
9
8
8
6
4
Baby E
2
Baby F
L o g 10 C F U p e r g
L o g 10 C F U p e r g
10
7
6
5
4
Baby E
3
Baby F
2
1
0
Poly.
0
0
2
4
6
8
10
12
0
Age in Months
2
4
6
8
10
12
Age in Months
Figure 3.7 Total and resistant plate counts of twin over the course of a year. The Baby F meconium
sample had no viable colonies on either total plate counts or selective plates and is represented by the lower
limits of detection in both graphs. The relationship between CFU/g and age were tested by polynomial
regression, TPC for Baby E R2=0.48, (P= 0.008) and Baby F R2=0.54, (P=0.003), the Tetr plate counts
Baby E R2=0.62, (P< 0.000) and Baby F R2=0.66, (P=0.014). Values represented here are the mean result
for replicate plates and the standard deviation was always less then 10%.
54
The tetM gene pool in every sample was analyzed, with the exception of the day 1 and
week 2 samples from the twins. These samples had a low volume and/or excessive
mixing with the diaper matrix making them not suitable for adequate analysis. As
illustrated in Figure 3.8, the tetM gene pool for Baby E between months 1 to11 ranged
between 3.6 x 105 to 4.0 x 107 copies per gram of sample, where as Baby E tetM gene
pool ranged from 1.1 x 106 to 3.7 x 107 copies per gram of sample during the same period
of time. There were no detectable tetM gene pools found in the meconium samples
Log10 gene copies per uL
within the limits of detection.
9
8
7
6
5
4
3
2
1
0
Baby E
Baby F
0
2
4
6
8
10
12
Age in Months
Figure 3.8 The distribution of the tetM gene pool in twin subjects. Twins tetM development from
similar environmental factors detected by qPCR over the course of a year. The meconium samples had no
detectable concentrations of the tetM gene and are below the limits of detection. The relationship between
tetM gene copy/g and age were tested by polynomial regression Baby E R2= 0.68 (P=0.10) and Baby F
R2=0.75, (P =0.056). Each point is the mean of 2 qPCR runs with 3 technical replicates per run.
55
The difference between the two subjects at the same growth stage throughout the study
remained within a log, suggesting a reasonably consistency of the data. A Wilcoxon test
was conducted on the twin real-time sample results supporting there was not a significant
variation between the sampling periods based on the P- value of 0.007.
3.5
Discussion
The impact of foodborne microbes, particularly non-pathogenic bacteria, on both the
development of human gastrointestinal microflora and the circulation of the AR genes
among the hosts and environment remains poorly understood. It is worth noting that this
study was conducted using limited incubation conditions and antibiotic concentrations to
screen for resistant bacteria, which likely are only optimal for a small percentage of the
microbial population. The sample collection procedures did not offer special protection
for strict anaerobes from the damaging effects of atmospheric oxygen. In addition, the
initial sample collection procedures were handled by the guardians of the infant subjects
instead of research staff members, therefore additional variability may be introduced.
Overall, it is anticipated that the detected culturable microbes only measured a very small
percentage of the total gut bacterial load in these subjects. Regardless of this fact, the
data reported here still demonstrated that the infant gut is rapidly colonized by
tetracycline resistant bacteria.
Of the tetr isolates from the CBA plates containing
56
tetracycline, 28 isolates were identified using 16S rDNA sequence analysis and most
were found to be Enterococcus spp. and Streptococcus spp.
With the exception of the newborn infant’s first bowel movement, Tetr bacteria and tetM
gene pool were detected in each subject in this study. Baby E had low counts on both the
selective and nonselective plates for the meconium sample produced within 24 hrs, while
Baby F had no viable counts on either selective or non-selective plates. However, the
presence of a sanitary napkin in the Baby E meconium sample suggested this sample
might have been contaminated. Regardless, since conventional foods have not been
introduced into the infants’ diet, the results suggest that they are not the direct cause of
the resistant bacteria in the infant gut. Other pathway(s) likely are responsible for the
transmission of the AR gene-containing bacteria. The total plate counts yielded expected
microbial counts. However the rapid emergence of Tetr bacteria in infant gut flora
without the exposure to tetracycline was a surprise. This data indicates that the spread
and maintenance of resistant populations occur regardless of corresponding antibiotic
selective pressure.
Based on results from conventional culture plating, the Tetr bacteria in infant subjects
rapidly reached 5.5 x 105 to 1.9 x 108 CFU per gram of samples shortly after birth.
Because this method only measures those recoverable under the limited experimental
conditions, the real magnitude of Tetr bacteria in these subjects is higher than these
numbers.
57
The real-time qPCR method is culture-independent, therefore it measures the total AR
gene pool in live and dead, both culturable and unculturable cells. Furthermore, it
measures the sum of AR gene copies from ART bacteria, without distinguish the situation
where certain cells may carry multiple copies of AR genes. Therefore, theoretically the
size of the gene pool as measured by qPCR should be higher than that by conventional
culture plating method. However, because of the procedures involved in the qPCR
method, especially the lack of efficiencies in extracting DNA from cells and in removing
of potential PCR inhibitory compounds from fecal samples, the results by qPCR as
performed in this study are much lower than its full potential. By comparing the size of
the tetM gene pool, one of the dominant tetr genes commonly found in natural and host
environment, with the Tetr bacterial counts from both validation studies of using pure
culture in the bacterial medium and artificial spiked fecal samples (Fig. 3.4 and Fig. 3.5),
we concluded that the efficiency of the qPCR as performed is no more than 10% of its
full potential.
It is worth noting that all numbers in this study are obtained by analyzing ART bacteria
population or AR gene pool from the fecal samples, instead of directly sampling the
microbial flora from the surface of the gut. While these numbers are a good indication of
the AR status in the microflora associated with the human digestive ecosystems, it is
important to recognize that these numbers reflect not only bacterial population attached to
the gut, but also those entered the digestive track from food or other contacts, and
survived and possible amplified before they released with the feces. Enterococcus sp. and
58
Streptococcus sp. are among the dominant groups of bacteria recovered in this study,
suggesting their outstanding capabilities in surviving the human digestive environment
and possibly colonizing the gut surface (8).
In summary, several conclusions still can be drawn from this study. Among those, the
tetM gene appears to be prevalent in infant subjects, the gene pools rapidly reach to a
relatively high level and are maintained over time, though varied by subject and age. The
colonization, amplification and maintenance of ART bacteria occur regardless of the
absence of the corresponding selective pressure.
The human gastrointestinal tract is a
dynamic environment and the data reported here may represent transient as well as gut
microflora. A larger subject size along with more frequent sampling would provide a
better understanding as to the origination, maintenance and dissemination of AR in the
environment and the hosts. Also, tetM is only one of 38 tetracycline resistant genes
known to date and this study provides quantification of only a small part of the total
picture (13). There is need to examine the other tet resistant genes, which may provide
more information on the transmission, maintenance and circulation of ART bacteria and
AR genes between the environment and the hosts.
59
BIBLOGRAPHY
1
Boehme, S., Werner, G., Klare, I., Reissbrodt, R., and W. Witte. 2004.
Occurrence of antibiotic-resistant enterobacteria in agricultural foodstuffs.
Mol. Nutr. Food Res. 48: 522-531.
2
Connor, C., Luo, H., McSpadden-Gardrener, B.B., and H.H. Wang. 2005.
Development of a second rapid detection system for Alicyclobacillus spp.
using real-time PCR. Int J. Food Microbiol. 99:229-235.
3
Diaz-Torres, M.L., Villedieu, A., Hunt, N., McNab, R., Spratt, D.A., Allan,
E., Mullany, P., and M. Wilson. 2006. Determining the antibiotic resistance
potential of the indigenous oral microbiota of humans using a metagenomic
approach. FEMS Microbiol Lett. 258(2): 257-262.
4
Durán, G. M., and D.L. Marshall. 2005. Ready-to-eat shrimp as an
international vehicle of antibiotic-resistant bacteria. J Food Prot. 68:23952401.
5
Gilliver, M.A., M. Bennett, M. Begon, S.M. Hazel, and C.A. Hart. 1999.
Antibiotic resistance found in wild rodents. Nature 401:233–234.
6
Gueimonde, M., S. Salminen, and E. Isolauri. 2006. Presence of specific
antibiotic (tet) resistance genes in infant faecal microbiota. FEMS Immunol
Med Microbiol. 48: 21-25.
7
Lancaster, H., Ready, D., Mullany, P., Spratt, D., Bedi, R. and M. Wilson.
2003. Prevalence and identification of tetracycline-resistant oral bacteria in
children not receiving antibiotic therapy. FEMS Microbiol Lett. 228:99-104.
8
Lindberg, E., Adlerberth, I., and A.E. Wold. 2004. Antibiotic resistance in
Staphyloccocus aureus colonizing the intestines of Swedish infants. Clin
Microbiol Infect 10:890-894.
9
Manson, J.M., Smith, J.M. and G. M. Cook. 2004. Persistence of
vancomycin-resistant Enterococci in New Zealand broilers after
discontinuation of avoparcin use. Appl Environ Microbiol. 70:5764–5768.
60
10 Molbak, K. 2004. Spread of resistant bacteria and resistance genes from
animals to humans- The public health consequences. J. Vet. Med. 51:364369.
11 Nikolich, M.P., Hong, G., Shoemaker, N.B. and A.A. Salyers. 1994.
Evidence for natural horizontal transfer of tet Q between bacteria that
normally colonize humans and bacteria that normally colonize livestock.
Appl Environ Microbiol. 60:3255-3260.
12 Teuber, M. 2001. Veterinary use and antibiotic resistance. Curr Opin
Microbiol. 4:493-499.
13 Roberts, M. 2005. Update on acquired tetracycline resistance genes. FEMS
Microbiol Lett. 245:195-203.
14 Salyers, A.A., Gupta, A., and Y. Wang. 2004. Human intestinal bacteria as
reservoir for antibiotic resistance. Trends in Microbiology. 12: 412-416.
15 Smith D.L., Harris, A.D., Johnson, J.A., Silbergeld, E.K. and G. Morris.
2002. Animal antibiotic use has an early but important impact on the
emergence of antibiotic resistance in human commensal bacteria. PNAS.
99:6434-6439.
16 Villedieu, A., Diaz-Torres, M.L., Hunt, N., McNab, R., Spratt, D.A.,
Wilson, M. and P. Mullany. 2003. Prevalence of tetracycline resistance gene
in oral bacteria. Antimicrob Agents Chemother. 47: 878-882.
17 Villedieu, A., Diaz-Torres, M.L., Roberts, A. P., Hunt, N., McNab, R.,
Spratt, D.A., Wilson, M. and P. Mullany. 2004. Genetic Basis of
Erythromycin Resistance in Oral Bacteria. Antimicrob Agents Chemother.
48(6): 2298–2301.
18 Wang, H., M. Manuzon, M. Lehman, K. 9. Wan, H. Luo, T. Wittum, A.
Yousef, and L. Bakaletz. 2006. Food commensal microbes as a potentially
important avenue in transmitting antibiotic resistance genes. FEMS Microbiol.
Lett. 254:226-231.
19 Waterman, S., and P. Small. 1998. Acid-sensitive enteric pathogens are
protected from killing under extremely acidic conditions of pH 2.5 when they
are inoculated onto certain solid food sources. Appl. Environ. Microbiol.
64:3882– 3886.
61
20 Yu, Z. and M. Morrison. 2004. Improved extraction of PCR-quality
community DNA from digesta and fecal samples. Biotechniques. 36:808-12.
62
CHAPTER 4
CONCLUSIONS AND FUTURE DEVELOPMENT
4.1 Summary
In summary this study illustrated that the infant gut is rapidly colonized by tetracycline
resistant bacteria after birth. Tetr bacteria and tetM gene were detected in 100% of the
infant subjects without prior exposure to tetracycline, indicating ART bacteria
colonization in the gut is independent from the corresponding selective pressure. Since
ART bacteria were detected and its development was monitored in breast-fed and
formula-fed babies way before they started conventional food consumption, the results
also suggest that pathways other than conventional food intake likely are responsible for
transmitting the ART bacteria to the subjects. For instance, in our preliminary study,
ART bacteria were detected from a mother’s hand. Therefore human and environmental
contact could play a role in transmitting ART bacteria. On the other hand, despite the fact
that we had sampled infant formula and not ART bacteria were detected, theoretically
these products are not sterile. Although mother’s milk should be fairy clean, infants can
still get exposed to ART bacteria through contacting mother’s skin during feeding.
Therefore we cannot rule out the contribution of the food chain in the establishment of
63
the ART population in infant digestive track. It is inevitable that the constant supply of
ART bacteria from conventional food consumption, coupled with occasional
colonizationand horizontal gene transmission, will likely shape the development gut flora.
But its overall impact is yet to be revealed.
4.2 Future studies
This data in this study suggests that the spread of resistant populations occurs regardless
of selective pressure from the presence of the antibiotic and that merely limiting the use
of antibiotics will not likely slow down the future developments of AR in bacteria, at
least not in the near future. Further studies are needed to be conducted to have a better
understanding to reveal the origination, development and persistence of the gut ART
bacteria. In order to determine a more comprehensive picture the adult gut ecosystem
needs to be further characterized. A larger sample size is needs to be examined as well as
other tetracycline resistance genes to better understand the contribution that foodborne
ART bacteria have on the AR development in human digestive ecosystems.
64
BIBLIOGRAPHY
1. Aarestrup, F.M., Jensen, N.E., Jorsal, S.E. and T.K. Nielsen. 2000. Emergence
of resistance to fluoroquinolones among bacteria causing infections in food animals
in Denmark. Vet Rec. 146: 76-78.
2. Albrecht T, et al. 1996. “Bacteriology: Normal Flora.” Medical Microbiology,
4th Edition. University of Texas.
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mmed.section.508.
3. Anderson, A.D., J. McClellan, S. Rossiter, and F.J. Angulo. 2003. Public health
consequences of use of antimicrobial agents in agriculture. In: Knobler, S.L.,
Lemon, S.M., Najafi, M., Burroughs, T. (Eds.), Forum on Emerging Infections: The
Resistance Phenomenon in Microbes and Infectious Disease Vectors. Implications
for Human Health and Strategies for Containment—Workshop Summary. Board on
Global Health, Institute of Medicine, Appendix A, pp. 231–243.
4. Antibiotic FAQ. McGill University, Canada. Antibiotics and student health.
http://www.mcgill.ca/studenthealth/information/generalhealth/antibiotics/ Viewed
on 4-13-2008. Barton, M. 2000. Antibiotic use in animal feed and its impact on
human health. Nutr Res Rev. 13:279-299.
5. Berg R.D. 1996. The indigenous gastrointestinal microflora. Trends Microbiol.
4:430–5.
6. Bio-Rad Laoratories, Inc. 1999. BIORAD Hand book Bio-Rad Laoratories, Inc.
Hercules, CA.
7. Blake, D.P., Hillman, K., Fenlon, D.R. and J.C. Low. 2003. Transfer of
antibiotic resistance between commensal and pathogenic members of the
Enterobacteriaceae under ileal conditions. J Appl Microbiol. 95: 428-436.
8. Boehme, S., Werner, G., Klare, I., Reissbrodt, R., and W. Witte. 2004.
Occurrence of antibiotic-resistant enterobacteria in agricultural foodstuffs. Mol.
Nutr. Food Res. 48: 522-531.
65
9. Center for Disease Control and Prevention. 2007. Get smart: know when
antibiotics work. http://www.cdc.gov/narms/faq_pages/11.htm (Viewed
September 2007).
10. Champonux JJ, Drew WL, Falkow S, Neidhardt FC, Plorde JJ, and C.G.Ray.
1994 Sherris Medical Microbiology: An Introduction to Infectious
Diseases. Connecticut: Appleton & Lange.
11. Chee-Sanford J.C., Aminov R.I., Krapac I.J. Garrigures-Jeanjean N., and R.I.
Mackie. 2001. Occurrence and diversity of tetracycline resistance gene in lagoons
and groundwater underlying two swine production facilities. Appl Environ
Microbiol. 67:22-32.
12. Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action,
applications, molecular biology, and epidemiology of bacterial resistance.
Microbiol. Mol. Biol. Rev. 65:232–260.
13. Commission on Antimicrobial Feed Additives. 1997. Antimicrobial Feed
Additives. Stockholm: Ministry of Agriculture. Chapter 1-4: 1-140.
14. Connor, C., Luo, H., McSpadden-Gardrener, B.B., and H.H. Wang. 2005.
Development of a second rapid detection system for Alicyclobacillus spp. using
real-time PCR. Int J. Food Microbiol. 99:229-235.
15. Cooperstock MS, and A.J. Zedd. 1983. Intestinal flora of infants. In: Hentges DJ,
ed. Human intestinal microflora in health and disease. New York: Academic Press,
p.79–99.
16. Davidson DJ. In the matter of enrofloxacin for poultry: withdrawal of approval of
Bayer Corporation's new animal drug application 1 (NADA) 140-828 (Baytril). In:
FDA Docket No. 00N-1571; 2004.
17. Diaz-Torres, M.L., Villedieu, A., Hunt, N., McNab, R., Spratt, D.A., Allan, E.,
Mullany, P., and M. Wilson. 2006. Determining the antibiotic resistance potential
of the indigenous oral microbiota of humans using a metagenomic approach. FEMS
Microbiol Lett. 258(2): 257-262.
18. Durán, G. M., and D.L. Marshall. 2005. Ready-to-eat shrimp as an international
vehicle of antibiotic-resistant bacteria. J Food Prot. 68:2395-2401.
66
19. Eckurg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M.,
Gill, S.R., Nelson, K.E. and D.A. Relman. 2005. Diversity of the human intestinal
microbial flora. Science. 10:1635-1638.
20. Environmental Defense Fund. 2001.
http://www.edf.org/documents/619_abr_general_factsheet_rev2.pdf (viewed
March 2008).
21. Fanaro, S., Chierici, R., Guerrini, P. and V. Vigi. 2003. Intestinal microflora in
early infancy: composition and development. Acta Paediatr Suppl. 441:48-55.
22. Food and Drug Administration, Center for Veterinary Medicine, April 28, 2000
HHS Response to House Report 106-157- Agriculture, Rural Development, Food
and Drug Administration, and Related Agencies, Appropriations Bill. Executive
Summary.
23. Fries, R.. 2004. Conclusions and activities of previous expert groups: the Scientific
Steering Committee of the EU. J Vet Med B Infect Dis Vet Public Health. 51:403-7.
24. Gasson, M. J. 1990. In vivo genetic systems in lactic acid bacteria. FEMS
Microbiol. Rev. 87:43–60.
25. Geus, Eddes, Gielkens, Gan, Lamers, and Masclee. 1999. Post-prandial
intragastric and duodenal acidity are increased in patients with chronic pancreatitis
Aliment Pharmacol Ther. 13:937–943.
26. Gilliver, M. A., Bennett, M., Begon, M., Hazel, S. M. and C.A. Hart. 1999.
Antibiotic resistance found in wild rodents. Nature 401: 233-234.
27. Gueimonde, M., S. Salminen, and E. Isolauri. 2006. Presence of specific
antibiotic (tet) resistance genes in infant faecal microbiota. FEMS Immunol Med
Microbiol. 48: 21-25.
28. Holmes RK, and M.G. Jobling. 1996. Genetics: Exchange of Genetic Information
in: Baron’s Medical Microbiology 4th ed., Chapter 5. Univ of Texas Medical
Branch.
29. Jacobsen, L., Wilcks, A., Hammer, K., Huys, G., Gevers, D., and S. Andersen.
2007. Horizontal transfer of tet (M) and erm(B) resistance plasmids from food
strains of Lactobacillus plantarum to Enterococcus faecalis JH2-2 in the
gastrointestinal tract of gnotobiotic rats. FEMS Microbiol Ecol. 59:158–166.
67
30. Kolar., M., Pantcek, R, Bardon. J, Vagnerova,I., Typovska, H., Doskar, J. and
I. Valka. 2002. Occurrence of antibiotic-resistant bacterial strains isolated in
poultry. Vet. Med. 47:52-59.
31. Lancaster, H., Ready, D., Mullany, P., Spratt, D., Bedi, R. and M. Wilson.
2003. Prevalence and
identification of tetracycline-resistant oral bacteria in
children not receiving antibiotic therapy. FEMS Microbiol Lett. 228: 99-104.
32. Levy, S.B., McMurry, V., Burdett, P., Courvalin, P., Hillem, W., Roberts, M.C.,
and D.E. Taylor. 1989. Nomenclature for tetracycline resistance determinants.
Antimicrob Agents Chemother. 33:1373-1374.
33. Lewis, R. 1995. The rise of antibiotic- resistant infections. FDA consumer
magazine. September issue. http://www.fda.gov/fdac/features/795_antibio.html
34. Lindberg, E., Adlerberth, I., and A.E. Wold. 2004. Antibiotic resistance in
Staphyloccocus aureus colonizing the intestines of Swedish infants. Clin Microbiol
Infect 10:890-894.
35. Luo, H., Wan, K., H.H. Wang. 2005. High-Frequency Conjugation System
Facilitates Biofilm Formation and pAM_1 Transmission by Lactococcus lactis.
Appl Environ Microbiol. 71: 2970–2978.
36. Mackie, R.I., Sghir, A. and H.R. Gaskins. 1999. Developmental microbial
ecology of the neonatal gastrointestinal tract. Am J Clin Nutr. 69:1035-1045.
37. Madigan, M.T., Martinko J.M., and J. Parker. Brock Biology of
Microorganisms, 8th Edition. New Jersey: Prentice Hall, 1997.
38. Mailer, J.S., and B. Mason. Penicillin: Medicine’s wartime wonder drug and its
production at Peoria, Illinois. lib.niu.edu. (viewed 4-13-2008).
39. Malinen E., Kassinen A., Rinttila T, and A. Palva. 2003. Comparison of realtime PCR with SYBR Green I or 5’ nuclease assays and dot-blot hybridization with
rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria.
Microbiology 149: 269-277.
40. Manson, J.M., Smith, J.M. and G. M. Cook. 2004. Persistence of vancomycinresistant Enterococci in New Zealand broilers after discontinuation of avoparcin use.
Appl Environ Microbiol. 70:5764–5768.
68
41. Manuzon.M.Y., Hanna, S.E, Luo, H. Yu. Z., Harper W.J. and H.H. Wang.
2007. Quantitative assessment of the tetracycline resistance gene pool in cheese
samples by real-time TaqMan PCR. Appl Environ Microbiol. 73:1676-1677.
42. Marquez, B. 2005. Bacterial efflux systems and efflux pumps inhibitors. Biochimie.
87 1137–1147.
43. Maton, A, Hopkins, J., McLaughlin, C.W., Johnson, S., Warner, M.Q., LaHart,
D., and J.D. Wright. 1993. Human Biology and Health. Englewood Cliffs, New
Jersey, USA: Prentice Hall.
44. Molbak, K. 2004. Spread of resistant bacteria and resistance genes from animal to
human- The public consequences. J of Vet Med. 51: 364-369.
45. Nikolich, M.P., Hong, G., Shoemaker, N.B. and A.A. Salyers. 1994. Evidence
for natural horizontal transfer of tet Q between bacteria that normally colonize
humans and bacteria that normally colonize livestock. Appl Environ Microbiol.
60:3255-3260.
46. Paulsen, I.T., et al. 2003. Role of mobile DNA in the evolution of vancomycinresistant Enterococcus faecalis. Science. 299:2071-2074.
47. Phillips, I., Casewell, M., Cox, T., DeGroot, B., Friis, C., Jones, R., Nightingale,
C., Preston, R. and J. Waddell. 2004. Does the use of antibiotics in food animals
pose a risk to human health? A critical review. J Antimicrob Chemother. 53: 28-52.
48. Presoctt, J.F. and J.D Baggot. Antimicrobial therapy in veterinary medicine, 2nd
edition. Ames, IA: Iowa State University Press 1997.
49. Randerson, J. 2003. Ban on growth promoters has not increased bacteria. New
Scientist. 183:13-15.
50. Roberts, M.C. 1994. Epidemiology of tetracycline resistance determinants. Trends
Microbiol. 2:353-357.
51. Roberts, M.C. 1996. Tetracycline resistance determinants: mechanisms of action,
regulation of expression, genetic mobility and distribution. FEMS Microbiology
Review. 19:1-24.
52. Rolinson G. N. 1998. Forty years of lactam research J Antimicrob Chemother
41:589–603.
69
53. Salyers, A.A., Gupta, A., and Y. Wang. 2004. Human intestinal bacteria as
reservoir for antibiotic resistance. Trends Microbiol. 12:412-416.
54. Salyers, A.A and N. Shoemaker. 2006. Reservoirs of antibiotic resistance genes.
Anim Biotechnol, 17:137–146.
55. Schnappinger, D., and W. Hillen. 1996. Tetracycline: antibiotic action, uptake,
and resistance mechanisms – A mini review. Arch Microbiol. 165: 359-369.
56. Shoemaker, N.B., Vlamakis, K., Hayes K. and A.A. Salyers. 2001. Evidence for
extensive resistance gene transfer among Bacteriodes spp. and among Bacteroides
and other genera in the human colon. Appl Environ Microbiol. 67:561-568.
57. Smith D.L., Harris A., Johnson J., Silbergeld E., G. Morris. 2002. Animal
antibiotic use has an early but important impact on the emergence of antibiotic
resistance in human commensal bacteria. PNAS. 99:6434-6439.
58. Snyder, L. and W. Champness. 2003. Molecular genetics of Bacteria. Pgs 197215. ASM Press, Herndon, VA.
59. Stremmel, W. 2005. Retarded release phosphatidylcholine benefits patients with
chronic active ulcerative colitis. Gut. 54: 966-971.
60. Taylor, D.E., and A. Chau. 1996. Tetracycline resistance mediated by ribosomal
protection. Antimicrob. Agents Chemother. 40: 1-5.
61. Teuber, M. 2001. Veterinary use and antibiotic resistance. Curr Opin Microbiol.
4:493-499.
62. Thomson A, Drozdowski L, Iordache C, Thomson B, Vermeire S, Clandinin M,
and G. Wild. 2003. Small bowel review: Normal physiology, part 1. Dig Dis Sci.
48:1546-64.
63. Todar, K. 2002. University of Wisconsin Department of Bacteriology Madison,
Wisconsin. www.textbookofbacteriology.net Online text book.
64. US. Department of Health and Human Services. 2007.
http://www.niaid.nih.gov/factsheets/antimicro.htm. (Viewed September 2007).
65. Van, T.T.H., Moutafis,G., Tran, L.T.,and P. J. Coloe. 2007. AR in Food-Borne
Bacterial Contaminants in Vietnam. Appl Environ Microbiol. 73: 7906-7911.
70
66. Van den Bogaard, A.E., and E.E. Stobberingh. 1999. Antibiotic Usage in
Animals- Impact on bacteria resistance and public health. Drugs 58:589-607.
67. Van Looveren, M., Daube, G., De Zutter, L., Dumont, J., Lammens, C.,
Wijdooghe, M., Vandamme, P., Jouret, M., Cornelis, M. and H. Goossens.
2001. Antimicrobial susceptibilities of Campylobacter strains isolated from food
animals in Belgium. J. Anti Chemother. 48, 235-240.
68. Villedieu, A., Diaz-Torres, M.L., Hunt, N., McNab, R., Spratt, D.A., Wilson, M.
and P. Mullany. 2003. Prevalence of tetracycline resistance gene in oral bacteria.
Antimicrob Agents Chemother. 47: 878-882.
69. Villedieu, A., Diaz-Torres, M.L., Roberts, A. P., Hunt, N., McNab, R., Spratt,
D.A., Wilson, M. and P. Mullany. 2004. Genetic Basis of Erythromycin
Resistance in Oral Bacteria. Antimicrob Agents Chemother. 48(6): 2298–2301.
70. Wang, H., Manuzon, M., Lehman, M., Wan, K., Luo, H., Wittum, T., Yousef,
A., and L. Bakaletz. 2006. Food commensal microbes as a potentially important
avenue in transmitting antibiotic resistance genes. FEMS Microbiol Lett. 254:226231.
71. Wassenaar, T. 2005. Use of antimicrobial agents in veterinary medicine and
implications for human health. Crit Views Microbiol. 31: 1555-169.
72. Waterman, S., and P. Small. 1998. Acid-sensitive enteric pathogens are protected
from killing under extremely acidic conditions of pH 2.5 when they are inoculated
onto certain solid food sources. Appl. Environ. Microbiol. 64:3882– 3886.
73. Werner, G., Klare, I., Reissbrodt, R., and W. Witte. 2004. Occurrence of
antibiotic-resistant enterobacteria in agricultural foodstuffs. Mol. Nutr. Food Res.
48: 522-531.
74. WHO. 2000. WHO Global Principless for the Containment of Antimicrobial
Resistance in Animals Treated for Food: Report of a WHO Consultation, Geneva,
Switzerland, June 5-9, 2000.
75. WHO. 2003. World Health Organization, Impacts of antimicrobial growth
promoter termination in Denmark, The WHO international review panel’s
evaluation of the termination of the use of antimicrobial growth promoters in
Denmark. http://www.who.int/salmsurv/en/Expertsreportgrowthpromoterdenmark.pdf
76. Yu, Z. and M. Morrison. 2004. Improved extraction of PCR-quality community.
DNA from digesta and fecal samples. Biotechniques. 36:808-12.
71