Download Increased activity of 16-membered lactone ring macrolides against

JAC
Journal of Antimicrobial Chemotherapy (1998) 42, 729–734
Increased activity of 16-membered lactone ring macrolides against
erythromycin-resistant Streptococcus pyogenes and Streptococcus
pneumoniae: characterization of South African isolates
K. P. Klugmana*, T. Cappera, C. A. Widdowsona, H. J. Koornhofa and W. Moserb
a
MRC/SAIMR/WITS Pneumococcal Diseases Research Unit, South African Institute for Medical Research,
Johannesburg 2000, South Africa; bBiochemie GmbH, A6250 Kundl, Austria
The susceptibility of 40 erythromycin-resistant isolates of Streptococcus pyogenes and
40 multiply-resistant isolates of Streptococcus pneumoniae to six macrolide antibiotics,
representing 14-, 15- and 16-membered lactone ring structures, was tested. The genetic basis
for macrolide resistance in the strains was also determined. Both erm and mef determinants
were encountered in the 36 S. pneumoniae isolates tested, but only mef in the five
S. pyogenes isolates tested. All isolates showed cross-resistance among the 14-membered
macrolides erythromycin, clarithromycin and roxithromycin and the 15-membered macrolide,
azithromycin. However, the erythromycin-resistant S. pyogenes isolates retained full susceptibility to spiramycin and josamycin (16-membered agents). These latter two antibiotics were
also more active than the other macrolides against erythromycin-resistant S. pneumoniae
isolates, especially josamycin which was 8–64 times more active than erythromycin;
spiramycin was only two to eight times more active than erythromycin.
Introduction
Materials and methods
Erythromycin and other macrolide antibiotics show
considerable bactericidal activity against Streptococcus
pyogenes and Streptococcus pneumoniae, two important
respiratory pathogens.1–3 Clarithromycin is marginally
more active, with MICs of approximately 0.015 mg/L
against most susceptible strains of S. pyogenes and
S. pneumoniae. Other chemically modified 14-membered
lactone ring macrolides and the 15- and 16-membered
agents exhibit MICs ranging from 0.03 to 0.12 mg/L
against these organisms.2,4,5 Resistance to macrolides has,
however, appeared in both S. pyogenes6 and S. pneu moniae.7,8 In the case of the 14- and 15-membered macrolides this resistance has escalated considerably in some
countries.6,7 The mechanisms of macrolide resistance have
been elucidated and involve target modification mediated
by a methylase (encoded by erm genes) which modifies an
adenine in 23S rRNA9 and an efflux mechanism encoded
by mef genes.10
The present study was performed to investigate the
macrolide susceptibility profiles and mechanisms of resistance among isolates of S. pyogenes and S. pneumoniae
isolates from South Africa.
Antibiotics
Erythromycin ethyl succinate (Sigma Chemical Co., St
Louis, MO, USA), clarithromycin (Abbott Laboratories,
Abbott Park, IL, USA), roxithromycin (Roussel Uclaf,
Paris, France), azithromycin (Pfizer Inc., Groton, CT,
USA), spiramycin (May-Baker, Dagenham, UK, currently
available from Rhône Poulenc, Alfortville, France) and
josamycin (Biochemie GmbH, Kundl, Austria) were used
for MIC determinations.
The activity of all pure antibiotic powders was confirmed using susceptible Staphylococcus aureus ATCC
29213 and S. pneumoniae ATCC 49619 control strains.
Clinical isolates
Forty erythromycin-resistant isolates of S. pyogenes and 40
multiply resistant isolates of S. pneumoniae, recovered
from clinical specimens by the microbiology laboratories
of the South African Institute for Medical Research
(SAIMR), Gauteng, South Africa, were evaluated for
susceptibility to the six macrolide antibiotics. The
*Corresponding address: South African Institute for Medical Research, PO Box 1038, Johannesburg 2000, South Africa.
729
© 1998 The British Society for Antimicrobial Chemotherapy
K. P. Klugman et al.
pneumococcal isolates were resistant not only to erythromycin but also to either chloramphenicol or tetracycline
or both. Several isolates were also resistant to cotrimoxazole. All isolates exhibited high-level penicillin
resistance with MICs 2 mg/L. Thirty-six of the S. pneu moniae isolates were available for genetic testing by PCR
for erythromycin resistance determinants. The forty
S. pyogenes isolates were not kept for genetic evaluation
but five local strains subsequently isolated were evaluated
for resistance determinants.
min, followed by 30 cycles of denaturation at 95°C for 1
min, primer annealing at 56°C for 2 min and extension at
72°C for 2 min, followed by one cycle of extension at 72°C
for 10 min. Amplification products were run through 1%
agarose gels and detected by staining with ethidium
bromide. The ermAM/B genes (ermAM in S. pneumoniae,
and ermB in S. pyogenes) were detected using the
following primers: forward primer, 5 -CGAGTGAAAA
AGTACTCAACC, reverse primer, 5 -GGCGTGTTTC
ATTGCTTGATG. The amplification reactions used for
mefE/A detection were also used for ermAM/B detection,
except that primer annealing was performed at 58°C.
Susceptibility testing
The MICs for the 80 clinical isolates were determined
according to the guidelines of the National Committee
for Clinical Laboratory Standards.11 Briefly, testing was
performed in microtitre trays (Sero-Wel, Stone, UK) using
cation-supplemented Mueller–Hinton broth (Oxoid,
Basingstoke, UK) containing 2.5% lysed horse blood. Test
and control strains were grown in serum broth (5% human
serum) at 37°C for 3 h, the cell densities adjusted to match
a MacFarland 0.5 standard and further diluted in quarterstrength Ringer’s solution to a final concentration of
approximately 5
105 cfu/mL. Macrolide antibiotics
were serially diluted in two-fold dilutions from 64 mg/L to
0.06 mg/L in microtitre trays. Inoculated trays were
incubated overnight at 37°C before determining the MICs
in the wells. Colony counts were performed as a control
procedure for the assessment of inoculum size.
Detection of the erythromycin resistance
determinants, mefE/A and ermAM/B
The genes mefE/A and ermAM/B were detected by PCR
amplification. DNA samples were prepared by resuspending swabbed plate cultures in 300 L of 10 mM
Tris–HCl (pH 8.5) and boiling the samples for 10 min.
After boiling, the samples were centrifuged for 5 min
and 1 L of the supernatant was used in each reaction
tube. Published primers for the mefE/A genes (5 AGTATCATTAATCACTAGTGC, and 5 -TTCTTCTGGTACTAAAAGTGG)12 were used to detect the mef
genes in S. pneumoniae (mefE) and S. pyogenes (mefA)
strains. Amplification reactions were performed in
volumes of 50 L containing 1
Reaction Buffer lV
(Advanced Biotechnologies Ltd, Epsom, UK) (75 mM
Tris–HCl (pH 8.8), 20 mM (NH4)2SO4, 0.01% (v/v)
Tween), 5 mM MgCl2, 200 M each of dATP, dCTP,
dGTP and dTTP (Boehringer–Mannheim; Mannheim,
Germany), 1 M of each primer, 1 L of DNA sample
prepared as described above and 1 U of Thermoprime
Plus DNA polymerase (Advanced Biotechnologies Ltd),
overlaid with mineral oil (Sigma). Amplification was
performed in a Perkin Elmer Cetus DNA Thermal Cycler
programmed for one cycle of denaturation at 95°C for 2
Resistance phenotyping based on disc susceptibility
testing
Antibiotic resistance phenotypes were observed using disc
diffusion assays (erythromycin, 15 g/disc; clindamycin,
2 g/disc) on 5% horse blood agar plates (Oxoid
Columbia base) after overnight growth at 37°C under
aerobic conditions. Blunting of clindamycin zone of
inhibition proximal to the erythromycin disc was taken to
indicate inducible resistance.6,9 Erythromycin-resistant
isolates that remained sensitive to clindamycin were
designated the ‘M phenotype’.6,10
Results
Table I shows the susceptibility of the 40 S. pneumoniae
and 40 S. pyogenes isolates to the six macrolide antibiotics
tested. The 14-membered lactone ring agents, erythromycin, roxithromycin and clarithromycin, as well as the
15-membered lactone ring agent, azithromycin, showed
diminished activity and cross-resistance among themselves against both erythromycin-resistant S. pyogenes
and S. pneumoniae strains. In contrast, the 16-membered
lactone ring agents, spiramycin and josamycin, retained
full activity against erythromycin-resistant S. pyogenes
isolates with spiramycin and josamycin MICs of 0.12
mg/L and 0.06 mg/L, respectively. These two agents
were also appreciably more active than the other macrolides against erythromycin-resistant S. pneumoniae isolates
with MICs of 0.5–16 mg/L and 0.12–4.0 mg/L for
spiramycin and josamycin respectively. The majority
(90%) of erythromycin-resistant pneumococci fell within
the susceptibility range of josamycin based on MICs
2
mg/L. Josamycin was eight to 64 times more active against
the multiply-resistant pneumococci than the other macrolides tested as opposed to two to eight times in the case of
spiramycin.
Of the 14- and 15-membered macrolides, erythromycin
showed marginally better activity than the others against
that of S. pyogenes isolates tested in this study while
clarithromycin was slightly more active against the
pneumococcal isolates. The MICs were, however, within
730
Macrolide activity against Streptococcus spp.
Table I. Activity of six macrolide agents against erythromycin-resistant S. pyogenes and multiply
resistant S. pneumoniae
MIC (mg/L)
Organism (n)
Macrolide
MIC50
S. pyogenes,
erythromycinresistant (40)
erythromycin
roxithromycin
clarithromycin
azithromycin
spiramycin
josamycin
erythromycin
roxithromycin
clarithromycin
azithromycin
spiramycin
josamycin
4
8
16
16
0.06
0.06
8
16
4
32
4
0.5
S. pneumoniae,
multiply resistant
(40)
MIC90
8
8
32
16
0–0.12
0.06
64
64
32
64
16
2
controla
range
2–8
4–8
16–32
4–16
0.06–0.12
0.06
4– 64
2– 64
2– 64
2– 64
0.5–16
0.12–4
0.06
0.25
1.0
0.25
0.5
1.0
0.06
0.06
0.06
0.06
0.06
0.06
a
S. aureus ATCC 29213 for the S. pyogenes group and S. pneumoniae ATCC 49619 for S. pneumoniae isolates.
Table II. Distribution of ermAM and mefE determinants in 36 erythromycin-resistant
S. pneumoniae strains
Resistance mechanism (phenotype/genotype)
No. of strains
12
13
1
5
5
MLSa/ermAMb
Erythromycin MIC (mg/L)
4
8
16
32
64
7
12
1
5
5
Mc/mefEd
5
1
0
0
0
a
MLS phenotype denotes resistance to macrolides, lincosamides and streptogramin B (only resistance to
erythromycin (15 g discs) and clindamycin (2 g discs) tested).
b
ermAM genotype strains contain ermAM gene sequences specific for MLS phenotype.
c
M phenotype strains exhibit resistance to 14- and 15-membered macrolides but remain susceptible to clindamycin
(and 16-membered macrolides).
d
mefE genotype (efflux mechanism) strains contain mefE gene sequences specific for M phenotype.
the intermediately or fully resistant ranges of these
agents.
Phenotypic and genotypic characterization of 36 S.
pneumoniae isolates is summarized in Table II. Six of the
strains were sensitive to clindamycin but resistant to
erythromycin (M phenotype). All six strains harboured
the mef gene as shown by a 348 bp amplification product
when amplified using primers specific for mefE/A. These
strains failed to show inducible resistance to clindamycin.
The remaining 30 strains were resistant to both erythromycin and clindamycin (MLS phenotype). These strains
harboured the erm gene, as shown by the production of a
616 bp amplification product during PCR amplification
using the ermAM/B-specific primers. The erythromycin
MICs for the mef isolates tended to be lower than those
of the erm strains (Table II).
All five S. pyogenes isolates examined displayed the
M phenotype and harboured the mef gene only.
Discussion
Two mechanisms account for macrolide resistance in
streptococci.9,10 The first of these results from target
modification. This modification is mediated by methylases
which either methylate or dimethylate a highly conserved
adenine residue in the peptidyl transferase centre (domain
V) of 23S rRNA. Such methylation is thought to lead to a
731
K. P. Klugman et al.
conformational change of binding sites in the ribosome,
resulting in cross-resistance among 14- and 15-membered
macrolides, lincosamides and streptogramin B antibiotics.
The erm genes involved may be linked to Tn1545-related
transposons in pneumococci and it has been suggested that
these transposons may be responsible for the rapid
dissemination of erythromycin resistance in S. pneumoniae
in France.9
An efflux mechanism conferring resistance to 14- and
15-membered macrolides, but not to streptogramin B
antibiotics and clindamycin, was recently described in
pneumococci and S. pyogenes and was designated the
M phenotype.10 The majority of macrolide-resistant
S. pyogenes and S. pneumoniae strains collected from
different countries in that study belonged to the M phenotype. The macrolide efflux pump mechanism proposed for
these strains differed from the multicomponent macrolide
efflux system in coagulase-negative staphylococci.10 The
M phenotype is one of three phenotypes of macrolide
resistance recorded in S. pyogenes and S. pneumoniae
isolates: it is characterized by resistance to macrolides
only; the other two types are cross-resistant to streptogramin B and lincosamides (including clindamycin), either
consitutively (cMLSB phenotype) or inducibly (iMLSB
phenotype). The above-mentioned phenotypes were
initially described in S. pyogenes isolates from Finland by
Seppälä et al.6 who found that the novel M phenotype
strains were fully susceptible to the 16-membered macrolide miocamycin (MIC50 0.25 mg/L), while the inducibly
and constitutively resistant phenotypes were less susceptible or resistant to this macrolide (MIC50s of 1.0 and
32 mg/L, respectively). Seppälä et al.13 recently described a
novel ermTR gene in S. pyogenes exhibiting an iMLSB
phenotype. Pneumococcal isolates from our study were
predominantly of the ermAM genotype (30 strains) while
six exhibited the efflux (mefE) resistance mechanism.
Erythromycin, roxithromycin, clarithromycin and azithromycin are in use in all the developed countries of the
world, as well as in many developing countries. The
16-membered lactose ring agents have a more limited
distribution. Spiramycin is available in France and some
other European countries. Josamycin is registered for use
in France, Germany, Spain, Italy, Austria, Switzerland, the
Czech Republic, Japan and several other Asian countries,
and some Latin American countries. The latter two
macrolides have been less extensively evaluated at the
clinical level than the other macrolides, but their efficacy
in respiratory infections has been documented in clinical
trials.14–16
With regard to the clinical significance of our findings, it
should be emphasized that macrolides are not recommended as first-line agents for the treatment of streptococcal pharyngitis or for otitis media or sinusitis where
pneumococci, Haemophilus influenzae and Moraxella
catarrhalis are important pathogens. 17,18 Although there is
no consensus on the use of antibiotics, including macro-
lides, and their relative merits in the treatment of acute
otitis media, there is strong evidence that appropriate
antimicrobial agents have a legitimate place in the treatment of otitis media. They serve to resolve clinical sepsis
and to prevent suppurative complications.19,20 Until the
clinical efficacy of macrolides has been convincingly
established and recorded, their use in the treatment of
acute sinusitis is not recommended, especially in view of
the real possibility of selection of macrolide-resistant
mutants.13 For the same reason, and because of their
expense, their extensive use for the empirical treatment
of acute otitis media should be discouraged. These
antimicrobial agents should also only be used selectively
for community-acquired pneumonia, when Mycoplasma
pneumoniae, Coxiella burnetii, Chlamydia spp. or
Legionella pneumophila are suspected as the likely aetiological agent. The use of macrolides for the empirical
treatment of community-acquired pneumonia in young
adults with no co-morbidity is controversial. American
and Canadian Thoracic Societies21,22 recommend macrolides for initial antimicrobial therapy in order to cover
atypical pneumonias while the British Thoracic Society23
recommends an aminopenicillin for this purpose and
macrolides or a second- or third-generation cephalosporin
only as an alternative approach. For pneumococcal
pneumonia, penicillin or amoxycillin would be preferable,
even when strains are reported as being penicillinresistant, as MIC-based criteria for penicillin resistance
(although applicable to meningitis) do not predict an
unfavourable outcome in pneumonia caused by ‘penicillinresistant’ pneumococci.24,25
The use of macrolides can be justified in respiratory
infections caused by pneumococci and S. pyogenes when
patients are known to be allergic to penicillin. In the case
of S. pyogenes infections in such patients, josamycin,
spiramycin and, presumably, other 16-membered macrolides could be considered in countries where erythromycin
resistance in this organism is common, provided
laboratory-based surveillance confirms susceptibility. The
place of these two agents in the treatment of respiratory
infections caused by erythromycin-resistant pneumococcal
strains is less clear as four (7.5%) of our 40 isolates had a
josamycin MIC of 4 mg/L (which probably falls marginally
within the resistance range) while 26 (65%) of the 40
isolates had spiramycin MICs 2 mg/L. Breakpoint MICs
for spiramycin and josamycin recommended by French
authorities are 2 mg/L for susceptibility and 8 mg/L for
resistance.26 These authorities also propose MICs of
1 mg/L and 4 mg/L for susceptibility and resistance,
respectively, for erythromycin. For comparison, the
breakpoints recommended by the NCCLS for streptococci
are
0.25 mg/L for susceptibility and 1.0 mg/L for
resistance.11 Extrapolating from the latter guidelines,
which do not directly refer to spiramycin and josamycin,
realistic breakpoints for these two antibiotics relating
to streptococci may be 0.5 mg/L for susceptibility and
732
Macrolide activity against Streptococcus spp.
2 mg/L for resistance. In our study, 24 of the 26 isolates
that had josamycin or spiramycin MICs
2 mg/L were
available for genotyping and all contained ermAM. A
further note of caution relates to a single report of resistance to 16-membered macrolides in two pneumococcal
strains which were susceptible to erythromycin.8 It is
therefore suggested that if agents containing 16membered rings are considered for the treatment of pneumococcal infections in countries where pneumococcal
resistance to erythromycin is common, resistance to these
antibiotics be monitored.
Acknowledgements
The authors wish to thank Biochemie GmbH, A-6250
Kundl, Austria for their sponsorship of the study. C.
Widdowson is in receipt of bursaries from the Medical
Research Council, the South African Institute for Medical
Research and the University of the Witwatersrand.
References
1. Istre, G. R., Welch, D. F., Marks, M. I. & Moyer, N. (1981).
Susceptibility of group A -hemolytic Streptococcus isolates to
penicillin and erythromycin. Antimicrobial Agents and Chemotherapy 20, 244–6.
2. Chin, N.-X., Neu, N. M., Labthavikul, P., Saha, G. & Neu, H. C.
(1987). Activity of A-56268 compared with that of erythromycin and
other oral agents against aerobic and anaerobic bacteria. Antimicrobial Agents and Chemotherapy 31, 463–6.
3. Doern, G. V., Brueggemann, A., Holley, H. P. & Rauch, A. M.
(1996). Antimicrobial resistance of Streptococcus pneumoniae
recovered from outpatients in the United States during the winter
months of 1994 to 1995: results of a 30-center national surveillance
study. Antimicrobial Agents and Chemotherapy 40, 1208–13.
9. Leclercq, R. & Courvalin, P. (1991). Intrinsic and unusual
resistance to macrolide, lincosamide and streptogramin antibiotics
in bacteria. Antimicrobial Agents and Chemotherapy 35, 1273–6.
10. Sutcliffe, J., Tait-Kamradt, A. & Wondrack, L. (1996). Streptococcus pneumoniae and Streptococcus pyogenes resistant to
macrolides but sensitive to clindamycin: a common resistance
pattern mediated by an efflux system. Antimicrobial Agents and
Chemotherapy 40, 1817–24.
11. National Committee for Clinical Laboratory Standards. (1995).
Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria
that Grow Aerobically: Standard M7-A3. NCCLS, Villanova, PA.
12. Sutcliffe, J., Grebe, T., Tait-Kamradt, A. & Wondrack, L.
(1996). Detection of erythromycin-resistant determinants by PCR.
Antimicrobial Agents and Chemotherapy 40, 2562–6.
13. Seppälä, H., Klaukka, T., Vuopio-Varkila, J., Muotiala, A.,
Helenius, H., Lager, K. et al. (1997). The effect of changes in the
consumption of macrolide antibiotics on erythromycin resistance in
group A streptococci in Finland. Finnish Study Group for Antimicrobial Resistance. New England Journal of Medicine 337,
441–6.
14. Kernbaum, S. (1982). La spiramycine. Utilisation en thérapeutique humaine. Semaine des Hospitaux 58, 289–97.
15. Wenzel, R. P., Hendley, J. O., Dodd, W. K. & Gwaltney, J. M.
(1976). Comparison of josamycin and erythromycin in the therapy
of Mycoplasma pneumoniae pneumonia. Antimicrobial Agents and
Chemotherapy 10, 899–901.
16. Fraschini, F. (1990). Clinical efficacy and tolerance of two new
macrolides, clarithromycin and josamycin, in the treatment of
patients with acute exacerbations of chronic bronchitis. Journal of
International Medical Research 18, 171–6.
17. Marchant, C. D. (1990). Spectrum of disease due to
Branhamella catarrhalis in children with particular reference to
acute otitis media. American Journal of Medicine 88, Suppl. 5A,
S15–9.
18. Wald, E. R., Milmoe, G. J., Bowen, A., Ledesma-Medina, J.,
Salamon, N. & Bluestone, C. D. (1981). Acute maxillary sinusitis in
children. New England Journal of Medicine 304, 749–54.
4. Hardy, D. J., Hensey, D. M., Beyer, J. M., Vojtko, C., McDonald,
E. J. & Fernandes, P. B. (1988). Comparative in vitro activities of
new 14-, 15-, and 16-membered macrolides. Antimicrobial Agents
and Chemotherapy 32, 1710–9.
19. Kaleida, P. H., Casselbrant, M. L., Rockette, H. E., Paradise, J.
L., Bluestone, C. D., Blatter, M. M. et al. (1991). Amoxicillin or
myringotomy or both for acute otitis media: results of a randomized
clinical trial. Pediatrics 87, 466–74.
5. Visalli, M. A., Jacobs, M. R. & Appelbaum, P. C. (1997).
Susceptibility of penicillin-susceptible and -resistant pneumococci
to dirithromycin compared with susceptibilities to erythromycin,
azithromycin, clarithromycin, roxithromycin and clindamycin. Antimicrobial Agents and Chemotherapy 41, 1867–70.
20. Marchant, C. D., Carlin, S. A., Johnson, C. E. & Shurin, P. A.
(1992). Measuring the comparative efficacy of antibacterial agents
for acute otitis media: the ‘Pollyanna phenomenon’. Journal of
Pediatrics 120, 72–7.
6. Seppälä, H., Nissinen, A., Yu, Q. & Huovinen, P. (1993). Three
different phenotypes of erythromycin-resistant Streptococcus pyogenes in Finland. Journal of Antimicrobial Chemotherapy 32,
885–91.
7. Lister, P. D. (1995). Multiply-resistant pneumococcus: therapeutic problems in the management of serious infections.
European Journal of Clinical Microbiology and Infectious Diseases
14, Suppl. 1, S18–25.
8. Emond, J. P., Fremaux, A., Dublanchet, A., Sissia, G., Geslin,
P., Sedalian, A. et al. (1989). Resistance of two strains of Streptococcus pneumoniae to pristinamycin associated with 16-membered
macrolides. Pathologie Biologie 37, 791–2.
21. Niederman, M. S., Bass, J. B., Campbell, G. D., Fein, A. M.,
Grossman, R. F., Mandell, L. A. et al. (1993). Guidelines for the
initial management of adults with community-acquired pneumonia:
diagnosis, assessment of severity, and initial antimicrobial therapy.
American Review of Respiratory Disease 148, 1418–26.
22. Mandell, L. A., Niederman, M. S. & The Canadian Community
Acquired Pneumonia Consensus Conference Group. (1993). Antimicrobial treatment of community acquired pneumonia in adults: a
conference report. Canadian Journal of Infectious Diseases 4,
25–8.
23. British Thoracic Society. (1993). Guidelines for the management of community-acquired pneumonia in adults admitted to
hospital. British Journal of Hospital Medicine 49, 346–50.
733
K. P. Klugman et al.
24. Klugman, K. P. (1994). Management of antibiotic-resistant
pneumococcal infections. Journal of Antimicrobial Chemotherapy
34, 191–3.
25. Sanchez, C., Armengol, R., Lite, J., Mir, I. & Garau, J. (1992).
Penicillin-resistant pneumococci and community-acquired pneumonia. Lancet 339, 988.
26. Soussy, C. J., Cluzel, R., Courvalin, P. & the Comité de
l’Antibiogramme de la Société Française de Microbiologie. (1994).
Definition and determination of in vitro antibiotic susceptibility
breakpoints for bacteria in France. European Journal of Clinical
Microbiology and Infectious Diseases 13, 238–46.
Received 26 January 1998; returned 31 March 1998; revised 5
June 1998; accepted 8 July 1998
734