Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
JAC Journal of Antimicrobial Chemotherapy (1998) 42, 729–734 Increased activity of 16-membered lactone ring macrolides against erythromycin-resistant Streptococcus pyogenes and Streptococcus pneumoniae: characterization of South African isolates K. P. Klugmana*, T. Cappera, C. A. Widdowsona, H. J. Koornhofa and W. Moserb a MRC/SAIMR/WITS Pneumococcal Diseases Research Unit, South African Institute for Medical Research, Johannesburg 2000, South Africa; bBiochemie GmbH, A6250 Kundl, Austria The susceptibility of 40 erythromycin-resistant isolates of Streptococcus pyogenes and 40 multiply-resistant isolates of Streptococcus pneumoniae to six macrolide antibiotics, representing 14-, 15- and 16-membered lactone ring structures, was tested. The genetic basis for macrolide resistance in the strains was also determined. Both erm and mef determinants were encountered in the 36 S. pneumoniae isolates tested, but only mef in the five S. pyogenes isolates tested. All isolates showed cross-resistance among the 14-membered macrolides erythromycin, clarithromycin and roxithromycin and the 15-membered macrolide, azithromycin. However, the erythromycin-resistant S. pyogenes isolates retained full susceptibility to spiramycin and josamycin (16-membered agents). These latter two antibiotics were also more active than the other macrolides against erythromycin-resistant S. pneumoniae isolates, especially josamycin which was 8–64 times more active than erythromycin; spiramycin was only two to eight times more active than erythromycin. Introduction Materials and methods Erythromycin and other macrolide antibiotics show considerable bactericidal activity against Streptococcus pyogenes and Streptococcus pneumoniae, two important respiratory pathogens.1–3 Clarithromycin is marginally more active, with MICs of approximately 0.015 mg/L against most susceptible strains of S. pyogenes and S. pneumoniae. Other chemically modified 14-membered lactone ring macrolides and the 15- and 16-membered agents exhibit MICs ranging from 0.03 to 0.12 mg/L against these organisms.2,4,5 Resistance to macrolides has, however, appeared in both S. pyogenes6 and S. pneu moniae.7,8 In the case of the 14- and 15-membered macrolides this resistance has escalated considerably in some countries.6,7 The mechanisms of macrolide resistance have been elucidated and involve target modification mediated by a methylase (encoded by erm genes) which modifies an adenine in 23S rRNA9 and an efflux mechanism encoded by mef genes.10 The present study was performed to investigate the macrolide susceptibility profiles and mechanisms of resistance among isolates of S. pyogenes and S. pneumoniae isolates from South Africa. Antibiotics Erythromycin ethyl succinate (Sigma Chemical Co., St Louis, MO, USA), clarithromycin (Abbott Laboratories, Abbott Park, IL, USA), roxithromycin (Roussel Uclaf, Paris, France), azithromycin (Pfizer Inc., Groton, CT, USA), spiramycin (May-Baker, Dagenham, UK, currently available from Rhône Poulenc, Alfortville, France) and josamycin (Biochemie GmbH, Kundl, Austria) were used for MIC determinations. The activity of all pure antibiotic powders was confirmed using susceptible Staphylococcus aureus ATCC 29213 and S. pneumoniae ATCC 49619 control strains. Clinical isolates Forty erythromycin-resistant isolates of S. pyogenes and 40 multiply resistant isolates of S. pneumoniae, recovered from clinical specimens by the microbiology laboratories of the South African Institute for Medical Research (SAIMR), Gauteng, South Africa, were evaluated for susceptibility to the six macrolide antibiotics. The *Corresponding address: South African Institute for Medical Research, PO Box 1038, Johannesburg 2000, South Africa. 729 © 1998 The British Society for Antimicrobial Chemotherapy K. P. Klugman et al. pneumococcal isolates were resistant not only to erythromycin but also to either chloramphenicol or tetracycline or both. Several isolates were also resistant to cotrimoxazole. All isolates exhibited high-level penicillin resistance with MICs 2 mg/L. Thirty-six of the S. pneu moniae isolates were available for genetic testing by PCR for erythromycin resistance determinants. The forty S. pyogenes isolates were not kept for genetic evaluation but five local strains subsequently isolated were evaluated for resistance determinants. min, followed by 30 cycles of denaturation at 95°C for 1 min, primer annealing at 56°C for 2 min and extension at 72°C for 2 min, followed by one cycle of extension at 72°C for 10 min. Amplification products were run through 1% agarose gels and detected by staining with ethidium bromide. The ermAM/B genes (ermAM in S. pneumoniae, and ermB in S. pyogenes) were detected using the following primers: forward primer, 5 -CGAGTGAAAA AGTACTCAACC, reverse primer, 5 -GGCGTGTTTC ATTGCTTGATG. The amplification reactions used for mefE/A detection were also used for ermAM/B detection, except that primer annealing was performed at 58°C. Susceptibility testing The MICs for the 80 clinical isolates were determined according to the guidelines of the National Committee for Clinical Laboratory Standards.11 Briefly, testing was performed in microtitre trays (Sero-Wel, Stone, UK) using cation-supplemented Mueller–Hinton broth (Oxoid, Basingstoke, UK) containing 2.5% lysed horse blood. Test and control strains were grown in serum broth (5% human serum) at 37°C for 3 h, the cell densities adjusted to match a MacFarland 0.5 standard and further diluted in quarterstrength Ringer’s solution to a final concentration of approximately 5 105 cfu/mL. Macrolide antibiotics were serially diluted in two-fold dilutions from 64 mg/L to 0.06 mg/L in microtitre trays. Inoculated trays were incubated overnight at 37°C before determining the MICs in the wells. Colony counts were performed as a control procedure for the assessment of inoculum size. Detection of the erythromycin resistance determinants, mefE/A and ermAM/B The genes mefE/A and ermAM/B were detected by PCR amplification. DNA samples were prepared by resuspending swabbed plate cultures in 300 L of 10 mM Tris–HCl (pH 8.5) and boiling the samples for 10 min. After boiling, the samples were centrifuged for 5 min and 1 L of the supernatant was used in each reaction tube. Published primers for the mefE/A genes (5 AGTATCATTAATCACTAGTGC, and 5 -TTCTTCTGGTACTAAAAGTGG)12 were used to detect the mef genes in S. pneumoniae (mefE) and S. pyogenes (mefA) strains. Amplification reactions were performed in volumes of 50 L containing 1 Reaction Buffer lV (Advanced Biotechnologies Ltd, Epsom, UK) (75 mM Tris–HCl (pH 8.8), 20 mM (NH4)2SO4, 0.01% (v/v) Tween), 5 mM MgCl2, 200 M each of dATP, dCTP, dGTP and dTTP (Boehringer–Mannheim; Mannheim, Germany), 1 M of each primer, 1 L of DNA sample prepared as described above and 1 U of Thermoprime Plus DNA polymerase (Advanced Biotechnologies Ltd), overlaid with mineral oil (Sigma). Amplification was performed in a Perkin Elmer Cetus DNA Thermal Cycler programmed for one cycle of denaturation at 95°C for 2 Resistance phenotyping based on disc susceptibility testing Antibiotic resistance phenotypes were observed using disc diffusion assays (erythromycin, 15 g/disc; clindamycin, 2 g/disc) on 5% horse blood agar plates (Oxoid Columbia base) after overnight growth at 37°C under aerobic conditions. Blunting of clindamycin zone of inhibition proximal to the erythromycin disc was taken to indicate inducible resistance.6,9 Erythromycin-resistant isolates that remained sensitive to clindamycin were designated the ‘M phenotype’.6,10 Results Table I shows the susceptibility of the 40 S. pneumoniae and 40 S. pyogenes isolates to the six macrolide antibiotics tested. The 14-membered lactone ring agents, erythromycin, roxithromycin and clarithromycin, as well as the 15-membered lactone ring agent, azithromycin, showed diminished activity and cross-resistance among themselves against both erythromycin-resistant S. pyogenes and S. pneumoniae strains. In contrast, the 16-membered lactone ring agents, spiramycin and josamycin, retained full activity against erythromycin-resistant S. pyogenes isolates with spiramycin and josamycin MICs of 0.12 mg/L and 0.06 mg/L, respectively. These two agents were also appreciably more active than the other macrolides against erythromycin-resistant S. pneumoniae isolates with MICs of 0.5–16 mg/L and 0.12–4.0 mg/L for spiramycin and josamycin respectively. The majority (90%) of erythromycin-resistant pneumococci fell within the susceptibility range of josamycin based on MICs 2 mg/L. Josamycin was eight to 64 times more active against the multiply-resistant pneumococci than the other macrolides tested as opposed to two to eight times in the case of spiramycin. Of the 14- and 15-membered macrolides, erythromycin showed marginally better activity than the others against that of S. pyogenes isolates tested in this study while clarithromycin was slightly more active against the pneumococcal isolates. The MICs were, however, within 730 Macrolide activity against Streptococcus spp. Table I. Activity of six macrolide agents against erythromycin-resistant S. pyogenes and multiply resistant S. pneumoniae MIC (mg/L) Organism (n) Macrolide MIC50 S. pyogenes, erythromycinresistant (40) erythromycin roxithromycin clarithromycin azithromycin spiramycin josamycin erythromycin roxithromycin clarithromycin azithromycin spiramycin josamycin 4 8 16 16 0.06 0.06 8 16 4 32 4 0.5 S. pneumoniae, multiply resistant (40) MIC90 8 8 32 16 0–0.12 0.06 64 64 32 64 16 2 controla range 2–8 4–8 16–32 4–16 0.06–0.12 0.06 4– 64 2– 64 2– 64 2– 64 0.5–16 0.12–4 0.06 0.25 1.0 0.25 0.5 1.0 0.06 0.06 0.06 0.06 0.06 0.06 a S. aureus ATCC 29213 for the S. pyogenes group and S. pneumoniae ATCC 49619 for S. pneumoniae isolates. Table II. Distribution of ermAM and mefE determinants in 36 erythromycin-resistant S. pneumoniae strains Resistance mechanism (phenotype/genotype) No. of strains 12 13 1 5 5 MLSa/ermAMb Erythromycin MIC (mg/L) 4 8 16 32 64 7 12 1 5 5 Mc/mefEd 5 1 0 0 0 a MLS phenotype denotes resistance to macrolides, lincosamides and streptogramin B (only resistance to erythromycin (15 g discs) and clindamycin (2 g discs) tested). b ermAM genotype strains contain ermAM gene sequences specific for MLS phenotype. c M phenotype strains exhibit resistance to 14- and 15-membered macrolides but remain susceptible to clindamycin (and 16-membered macrolides). d mefE genotype (efflux mechanism) strains contain mefE gene sequences specific for M phenotype. the intermediately or fully resistant ranges of these agents. Phenotypic and genotypic characterization of 36 S. pneumoniae isolates is summarized in Table II. Six of the strains were sensitive to clindamycin but resistant to erythromycin (M phenotype). All six strains harboured the mef gene as shown by a 348 bp amplification product when amplified using primers specific for mefE/A. These strains failed to show inducible resistance to clindamycin. The remaining 30 strains were resistant to both erythromycin and clindamycin (MLS phenotype). These strains harboured the erm gene, as shown by the production of a 616 bp amplification product during PCR amplification using the ermAM/B-specific primers. The erythromycin MICs for the mef isolates tended to be lower than those of the erm strains (Table II). All five S. pyogenes isolates examined displayed the M phenotype and harboured the mef gene only. Discussion Two mechanisms account for macrolide resistance in streptococci.9,10 The first of these results from target modification. This modification is mediated by methylases which either methylate or dimethylate a highly conserved adenine residue in the peptidyl transferase centre (domain V) of 23S rRNA. Such methylation is thought to lead to a 731 K. P. Klugman et al. conformational change of binding sites in the ribosome, resulting in cross-resistance among 14- and 15-membered macrolides, lincosamides and streptogramin B antibiotics. The erm genes involved may be linked to Tn1545-related transposons in pneumococci and it has been suggested that these transposons may be responsible for the rapid dissemination of erythromycin resistance in S. pneumoniae in France.9 An efflux mechanism conferring resistance to 14- and 15-membered macrolides, but not to streptogramin B antibiotics and clindamycin, was recently described in pneumococci and S. pyogenes and was designated the M phenotype.10 The majority of macrolide-resistant S. pyogenes and S. pneumoniae strains collected from different countries in that study belonged to the M phenotype. The macrolide efflux pump mechanism proposed for these strains differed from the multicomponent macrolide efflux system in coagulase-negative staphylococci.10 The M phenotype is one of three phenotypes of macrolide resistance recorded in S. pyogenes and S. pneumoniae isolates: it is characterized by resistance to macrolides only; the other two types are cross-resistant to streptogramin B and lincosamides (including clindamycin), either consitutively (cMLSB phenotype) or inducibly (iMLSB phenotype). The above-mentioned phenotypes were initially described in S. pyogenes isolates from Finland by Seppälä et al.6 who found that the novel M phenotype strains were fully susceptible to the 16-membered macrolide miocamycin (MIC50 0.25 mg/L), while the inducibly and constitutively resistant phenotypes were less susceptible or resistant to this macrolide (MIC50s of 1.0 and 32 mg/L, respectively). Seppälä et al.13 recently described a novel ermTR gene in S. pyogenes exhibiting an iMLSB phenotype. Pneumococcal isolates from our study were predominantly of the ermAM genotype (30 strains) while six exhibited the efflux (mefE) resistance mechanism. Erythromycin, roxithromycin, clarithromycin and azithromycin are in use in all the developed countries of the world, as well as in many developing countries. The 16-membered lactose ring agents have a more limited distribution. Spiramycin is available in France and some other European countries. Josamycin is registered for use in France, Germany, Spain, Italy, Austria, Switzerland, the Czech Republic, Japan and several other Asian countries, and some Latin American countries. The latter two macrolides have been less extensively evaluated at the clinical level than the other macrolides, but their efficacy in respiratory infections has been documented in clinical trials.14–16 With regard to the clinical significance of our findings, it should be emphasized that macrolides are not recommended as first-line agents for the treatment of streptococcal pharyngitis or for otitis media or sinusitis where pneumococci, Haemophilus influenzae and Moraxella catarrhalis are important pathogens. 17,18 Although there is no consensus on the use of antibiotics, including macro- lides, and their relative merits in the treatment of acute otitis media, there is strong evidence that appropriate antimicrobial agents have a legitimate place in the treatment of otitis media. They serve to resolve clinical sepsis and to prevent suppurative complications.19,20 Until the clinical efficacy of macrolides has been convincingly established and recorded, their use in the treatment of acute sinusitis is not recommended, especially in view of the real possibility of selection of macrolide-resistant mutants.13 For the same reason, and because of their expense, their extensive use for the empirical treatment of acute otitis media should be discouraged. These antimicrobial agents should also only be used selectively for community-acquired pneumonia, when Mycoplasma pneumoniae, Coxiella burnetii, Chlamydia spp. or Legionella pneumophila are suspected as the likely aetiological agent. The use of macrolides for the empirical treatment of community-acquired pneumonia in young adults with no co-morbidity is controversial. American and Canadian Thoracic Societies21,22 recommend macrolides for initial antimicrobial therapy in order to cover atypical pneumonias while the British Thoracic Society23 recommends an aminopenicillin for this purpose and macrolides or a second- or third-generation cephalosporin only as an alternative approach. For pneumococcal pneumonia, penicillin or amoxycillin would be preferable, even when strains are reported as being penicillinresistant, as MIC-based criteria for penicillin resistance (although applicable to meningitis) do not predict an unfavourable outcome in pneumonia caused by ‘penicillinresistant’ pneumococci.24,25 The use of macrolides can be justified in respiratory infections caused by pneumococci and S. pyogenes when patients are known to be allergic to penicillin. In the case of S. pyogenes infections in such patients, josamycin, spiramycin and, presumably, other 16-membered macrolides could be considered in countries where erythromycin resistance in this organism is common, provided laboratory-based surveillance confirms susceptibility. The place of these two agents in the treatment of respiratory infections caused by erythromycin-resistant pneumococcal strains is less clear as four (7.5%) of our 40 isolates had a josamycin MIC of 4 mg/L (which probably falls marginally within the resistance range) while 26 (65%) of the 40 isolates had spiramycin MICs 2 mg/L. Breakpoint MICs for spiramycin and josamycin recommended by French authorities are 2 mg/L for susceptibility and 8 mg/L for resistance.26 These authorities also propose MICs of 1 mg/L and 4 mg/L for susceptibility and resistance, respectively, for erythromycin. For comparison, the breakpoints recommended by the NCCLS for streptococci are 0.25 mg/L for susceptibility and 1.0 mg/L for resistance.11 Extrapolating from the latter guidelines, which do not directly refer to spiramycin and josamycin, realistic breakpoints for these two antibiotics relating to streptococci may be 0.5 mg/L for susceptibility and 732 Macrolide activity against Streptococcus spp. 2 mg/L for resistance. In our study, 24 of the 26 isolates that had josamycin or spiramycin MICs 2 mg/L were available for genotyping and all contained ermAM. A further note of caution relates to a single report of resistance to 16-membered macrolides in two pneumococcal strains which were susceptible to erythromycin.8 It is therefore suggested that if agents containing 16membered rings are considered for the treatment of pneumococcal infections in countries where pneumococcal resistance to erythromycin is common, resistance to these antibiotics be monitored. Acknowledgements The authors wish to thank Biochemie GmbH, A-6250 Kundl, Austria for their sponsorship of the study. C. Widdowson is in receipt of bursaries from the Medical Research Council, the South African Institute for Medical Research and the University of the Witwatersrand. References 1. Istre, G. R., Welch, D. F., Marks, M. I. & Moyer, N. (1981). Susceptibility of group A -hemolytic Streptococcus isolates to penicillin and erythromycin. Antimicrobial Agents and Chemotherapy 20, 244–6. 2. Chin, N.-X., Neu, N. M., Labthavikul, P., Saha, G. & Neu, H. C. (1987). Activity of A-56268 compared with that of erythromycin and other oral agents against aerobic and anaerobic bacteria. Antimicrobial Agents and Chemotherapy 31, 463–6. 3. Doern, G. V., Brueggemann, A., Holley, H. P. & Rauch, A. M. (1996). Antimicrobial resistance of Streptococcus pneumoniae recovered from outpatients in the United States during the winter months of 1994 to 1995: results of a 30-center national surveillance study. Antimicrobial Agents and Chemotherapy 40, 1208–13. 9. Leclercq, R. & Courvalin, P. (1991). Intrinsic and unusual resistance to macrolide, lincosamide and streptogramin antibiotics in bacteria. Antimicrobial Agents and Chemotherapy 35, 1273–6. 10. Sutcliffe, J., Tait-Kamradt, A. & Wondrack, L. (1996). Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrobial Agents and Chemotherapy 40, 1817–24. 11. National Committee for Clinical Laboratory Standards. (1995). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically: Standard M7-A3. NCCLS, Villanova, PA. 12. Sutcliffe, J., Grebe, T., Tait-Kamradt, A. & Wondrack, L. (1996). Detection of erythromycin-resistant determinants by PCR. Antimicrobial Agents and Chemotherapy 40, 2562–6. 13. Seppälä, H., Klaukka, T., Vuopio-Varkila, J., Muotiala, A., Helenius, H., Lager, K. et al. (1997). The effect of changes in the consumption of macrolide antibiotics on erythromycin resistance in group A streptococci in Finland. Finnish Study Group for Antimicrobial Resistance. New England Journal of Medicine 337, 441–6. 14. Kernbaum, S. (1982). La spiramycine. Utilisation en thérapeutique humaine. Semaine des Hospitaux 58, 289–97. 15. Wenzel, R. P., Hendley, J. O., Dodd, W. K. & Gwaltney, J. M. (1976). Comparison of josamycin and erythromycin in the therapy of Mycoplasma pneumoniae pneumonia. Antimicrobial Agents and Chemotherapy 10, 899–901. 16. Fraschini, F. (1990). Clinical efficacy and tolerance of two new macrolides, clarithromycin and josamycin, in the treatment of patients with acute exacerbations of chronic bronchitis. Journal of International Medical Research 18, 171–6. 17. Marchant, C. D. (1990). Spectrum of disease due to Branhamella catarrhalis in children with particular reference to acute otitis media. American Journal of Medicine 88, Suppl. 5A, S15–9. 18. Wald, E. R., Milmoe, G. J., Bowen, A., Ledesma-Medina, J., Salamon, N. & Bluestone, C. D. (1981). Acute maxillary sinusitis in children. New England Journal of Medicine 304, 749–54. 4. Hardy, D. J., Hensey, D. M., Beyer, J. M., Vojtko, C., McDonald, E. J. & Fernandes, P. B. (1988). Comparative in vitro activities of new 14-, 15-, and 16-membered macrolides. Antimicrobial Agents and Chemotherapy 32, 1710–9. 19. Kaleida, P. H., Casselbrant, M. L., Rockette, H. E., Paradise, J. L., Bluestone, C. D., Blatter, M. M. et al. (1991). Amoxicillin or myringotomy or both for acute otitis media: results of a randomized clinical trial. Pediatrics 87, 466–74. 5. Visalli, M. A., Jacobs, M. R. & Appelbaum, P. C. (1997). Susceptibility of penicillin-susceptible and -resistant pneumococci to dirithromycin compared with susceptibilities to erythromycin, azithromycin, clarithromycin, roxithromycin and clindamycin. Antimicrobial Agents and Chemotherapy 41, 1867–70. 20. Marchant, C. D., Carlin, S. A., Johnson, C. E. & Shurin, P. A. (1992). Measuring the comparative efficacy of antibacterial agents for acute otitis media: the ‘Pollyanna phenomenon’. Journal of Pediatrics 120, 72–7. 6. Seppälä, H., Nissinen, A., Yu, Q. & Huovinen, P. (1993). Three different phenotypes of erythromycin-resistant Streptococcus pyogenes in Finland. Journal of Antimicrobial Chemotherapy 32, 885–91. 7. Lister, P. D. (1995). Multiply-resistant pneumococcus: therapeutic problems in the management of serious infections. European Journal of Clinical Microbiology and Infectious Diseases 14, Suppl. 1, S18–25. 8. Emond, J. P., Fremaux, A., Dublanchet, A., Sissia, G., Geslin, P., Sedalian, A. et al. (1989). Resistance of two strains of Streptococcus pneumoniae to pristinamycin associated with 16-membered macrolides. Pathologie Biologie 37, 791–2. 21. Niederman, M. S., Bass, J. B., Campbell, G. D., Fein, A. M., Grossman, R. F., Mandell, L. A. et al. (1993). Guidelines for the initial management of adults with community-acquired pneumonia: diagnosis, assessment of severity, and initial antimicrobial therapy. American Review of Respiratory Disease 148, 1418–26. 22. Mandell, L. A., Niederman, M. S. & The Canadian Community Acquired Pneumonia Consensus Conference Group. (1993). Antimicrobial treatment of community acquired pneumonia in adults: a conference report. Canadian Journal of Infectious Diseases 4, 25–8. 23. British Thoracic Society. (1993). Guidelines for the management of community-acquired pneumonia in adults admitted to hospital. British Journal of Hospital Medicine 49, 346–50. 733 K. P. Klugman et al. 24. Klugman, K. P. (1994). Management of antibiotic-resistant pneumococcal infections. Journal of Antimicrobial Chemotherapy 34, 191–3. 25. Sanchez, C., Armengol, R., Lite, J., Mir, I. & Garau, J. (1992). Penicillin-resistant pneumococci and community-acquired pneumonia. Lancet 339, 988. 26. Soussy, C. J., Cluzel, R., Courvalin, P. & the Comité de l’Antibiogramme de la Société Française de Microbiologie. (1994). Definition and determination of in vitro antibiotic susceptibility breakpoints for bacteria in France. European Journal of Clinical Microbiology and Infectious Diseases 13, 238–46. Received 26 January 1998; returned 31 March 1998; revised 5 June 1998; accepted 8 July 1998 734