Download Molecular identification of tephritid fruit flies

Molecular identification of tephritid fruit flies (Diptera: Tephritidae) infesting sweet
oranges in Nsukka Agro-Ecological Zone, Nigeria, based on PCR-RFLP of COI gene
and DNA barcoding
1
2
1
I.E. Onah *, J.E. Eyo & D. Taylor
1
2
Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan
Department of Zoology and Environmental Biology, University of Nigeria, Nsukka, Nigeria
The exotic tephritid Bactrocera invadens (syn. Bactrocera dorsalis) and the native Ceratitis
species constitute serious pests and major impediment to Citrus production in Nigeria. Lack
of accurate and reliable diagnostic methods independent of the life stages intercepted for
both genera hampers implementation of appropriate early management programmes to
avoid economic losses and delays in quarantine decision regarding these pests. We used a
PCR amplification technique to successfully establish RFLP patterns of the COI coding gene
to differentiate the exotic B. invadens from the native Ceratitis species infesting sweet oranges
in Nigeria. The universal barcoding primer pair LCO1490/HCO2198 was used to amplify
658 bp-long fragment of the mitochondrial COI coding gene. The amplified fragment was
analysed by automated direct sequencing and RFLP. Intraspecific variation in nucleotide
sequences of B. invadens was very low with not more than 2 bp substitutions in four out of 31
individuals sequenced. Among the Ceratitis species intraspecific variation was also very low
with at most 4 bp substitutions in few of the 32 individuals sequenced. The restriction
enzymes Rsa I and Hsp92 II produced patterns that clearly and unambiguously separated
B. invadens from Ceratitis spp. DNA barcoding was also used to confirm the identities of the
tephritid species analysed. The molecular method established in this study will enhance
easy monitoring, early detection of species involved, and implementation of appropriate
management programmes that effectively reduce yield loses in Citrus production in Nigeria.
Key words: species delimitation, pest management, invasive, citrus, species identification.
INTRODUCTION
Tephritid fruit flies are considered an insect
group of major economic significance in agriculture. They attack different types of commercial
and wild fruits and vegetables, causing considerable damage to agricultural crops (De Meyer et al.
2012). Among all insect pests that afflict Citrus
crops, none has garnered greater notoriety than
tephritid fruit flies and these are recognized
worldwide as the most important threat to the
Citrus industry (Allwood & Drew 1997; Barnes
2004; Ekesi & Billah 2007). In addition, few insects
have a greater impact on international markets
and world trade in agricultural produce than
tephritid fruit flies (FAO/IAEA 2013). Direct damage is associated with fruit drops and rendering
fruits inedible. Besides the direct damage to fruits,
indirect losses are associated with quarantine
restrictions that are imposed by importing countries to prevent the entry and establishment of
exotic fruit fly species (Ekesi 2012).
*Author for correspondence. Present address: Department of
Zoology and Environmental Biology, University of Nigeria,
Nsukka, Nigeria. E-mail: [email protected]
Horticulture plays a major role in the economy
of many nations as a source of income, ensures
food security and creates jobs (Ekesi 2012). Citrus
fruits are the prime fruit crop in international trade
in terms of value (UNCTAD 2013). In Nigeria,
Citrus is the most widely grown fruit crop (Umeh
et al. 1998). Geographic distribution of global
Citrus production on the average from 2009 to
2010 showed that Nigeria is the world’s seventh
largest producer of Citrus (UNCTAD 2013). However, tephritid fruit fly attacks on Citrus cause economic yield losses and have been identified as the
major constraint to Citrus production in Nigeria
(Umeh et al. 1998; Umeh & Onukwu 2011). This
has drastically affected the country’s foreign
exchange earnings and Citrus production in
recent years. Observations have shown that in
Nigeria more than 70 % of Citrus fruit sets can be
lost to tephritid fruit flies (Umeh et al. 1998).
The fruit fly species that cause the damage are
not well known. Sub-Saharan Africa is the aboriginal home to 915 fruit fly species from 148 genera, of
African Entomology 23(2): 342–347 (2015)
Onah et al.: Molecular identification of tephritid fruit flies infesting sweet oranges in Nigeria
which 299 species develop in either wild or cultivated fruit. With the intensification of fruit trade,
the African continent has also become highly vulnerable to introduction of alien invasive fruit fly
species (Ekesi 2012). Fruit flies identified in major
Citrus-producing areas in Nigeria according to
Umeh et al. (1998) belong to the genera Bactrocera,
Ceratitis, Dacus and Trirhithrum. Accordingly, fruit
fly species of economic importance to Citrus in
Nigeria belong to the genera Ceratitis and Bactrocera.
Many species of these tephritid fruit flies are
morphologically similar but differ in their behaviour such as reproductive potentials, competitive
abilities and dispersive power (Duyck et al. 2004)
and thus have different potential impacts on food
production and implications for biosecurity and
market access. In addition, the immature stages of
different genera are morphologically indistinguishable and are the most likely life stages to be
intercepted in food produce (Blacket et al. 2012).
Moreover, in host fruit surveys immature stages of
different genera have been found to share the
same fruit (Copeland et al. 2002; Copeland et al.
2006; Ekesi et al. 2006) yet with no morphological
diagnostic features. Uncertainty in species limits
based on the traditionally used morphological
features, together with overlapping host and geographic ranges significantly impacts quarantine,
pest management, and general biological studies
(Clarke et al. 2005).
A critical aspect of prediction and also monitoring is the ability to accurately identify any intercepted specimen to the species level (Armstrong &
Ball 2005). Accurate identification is therefore
essential in host fruit surveys and for species
found in fruits destined for export, for distinguishing exotic from native fauna (Armstrong & Ball
2005). These limitations associated with morphological identification have been an impediment in
decision-making regarding fruit fly infestations at
quarantine checkpoints and in implementation of
appropriate management programmes for tephritid fruit flies. In effect, researchers have developed
other valuable alternative ways of fruit fly identification involving the use of molecular markers.
Currently, PCR-RFLP (polymerase chain reactionrestriction fragment length plymophism) and
DNA barcoding of the cytochrome oxidase c subunit I (COI) gene are becoming the preferred
molecular method to assist in precise and rapid
identification of fruit fly species at any stage of
development (PHA 2011).
343
In Nigeria, a molecular diagnostic method for
rapid and reliable identification of tephritid fruit
flies infesting sweet oranges has not been developed. The objectives of this study was to develop a
rapid diagnostic method based on PCR-RFLP of
the COI gene for distinguishing the native Ceratitis species from the exotic B. invadens (syn.
B. dorsalis) infesting sweet oranges in Nigeria.
B. invadens has recently been synonymized with
Bactrocera dorsalis (Schutze et al. 2015).
MATERIAL AND METHODS
Tephritid fruit flies collection and handling
Tephritid fruit flies infesting sweet oranges in
Nsukka Agro-Ecological Zone, Nigeria were collected by harvesting and breeding methods as
described in Novonty et al. (2005). The identity of
B. invadens was confirmed morphologically following descriptions by Drew et al. (2005) and De
Meyer et al. (2012). The identity of the genus
Ceratitis were inferred by comparing descriptions
and images of vouchers in EOL (Encyclopedia of
Life 2010).
DNA extraction and amplification
Genomic DNA was extracted from the fruit fly
samples using DNeasy® Blood and Tissue Kit
(Qiagen, U.S.A.) according to the manufacturers’
instructions. The genomic DNA samples were
analysed by PCR using a Dice TP600 Ver. 3.00 Gradient Standard Thermal Cycler (Takara, Japan)
and Platinum® Taq DNA Polymerase Kit (Invitrogen, Japan). The universal barcoding primer pair
LCO1490: 5’ GGTCAACAAATCATAAAGATATTG
3’ and HCO2198: 5’ TAAACTTCAGGGTGACCAA
AAAATCA 3’ (Folmer et al. 1994) (Life Technologies
Limited, Tokyo, Japan) was used to amplify portions of the mitochondrial cytochrome oxidase c
subunit I (COI) gene of the DNA samples. PCR
amplification was performed in a 50 µl final reaction volume consisting of 10× PCR Buffer, 10 mM
dNTPs, 50 mM MgCl2, 5 U Platinum® Taq DNA
Polymerase, 10 µM of each forward and reverse
primers, 50 ng/µl of DNA samples and ddH2O. The
PCR thermal cycle programme consisted of initial
denaturing at 94 °C for 2 min, followed by 35 cycles
of denaturing at 94 °C for 30 s, annealing at 48 °C
for 30 s and extension at 72 °C for 1 min with final
extension at 72 °C for 7 min and finally holding at
4 °C until analysed. The PCR products were analysed by gel electrophoresis on 2 % agarose gel at
344
African Entomology Vol. 23, No. 2, 2015
100 V for 30 min in 1× TAE Buffer; stained in
500 ng/µl of ethidium bromide, visualized and captured under UV light using UV transilluminator at
302 nm wavelengths.
by gel electrophoresis on 2 % agarose gels. The
nucleotide sequences of the species were deposited under DDBJ, EMBL, and GenBank accession
numbers as given in Table 1.
Sequencing and PCR-RFLP analysis of the DNA
samples
The PCR products were purified using Wizard®
SV Gel and PCR Clean-Up System (Promega,
U.S.A.). The purified PCR products were sequenced in both directions with forward (LCO
1490) and reverse (HCO 2198) primers using
BigDye® Direct Cycle Sequencing Kit (Life Technologies Limited, Tokyo, Japan) according to
manufacturer ’s instructions. Sequencing was performed in the Gene Research Centre, University of
Tsukuba, using a 3130 Genetic Analyzer (Applied
Biosystem, Japan). Sequence data was analysed
using Genetyx® Ver. 7.0 Software. Raw sequences
for each sample of B. invadens was aligned using
two sequences of B. invadens from GenBank
(accession numbers JQ692859 and JQ692866)
while raw sequences of Ceratitis species were
aligned using two sequences of Ceratitis anonae
from GenBank (accession numbers GQ154176 and
GQ154174). The aligned sequences were edited
manually in Microsoft Word®. The Barcode of Life
Data (BOLD) was used to confirm the species
identity of each sequenced specimen. The DNA
sequence data were used to predict restriction
sites. Two restriction enzymes Rsa I (Wako Nippon
Gene Co. Ltd, Japan) and Hsp92 II (Promega,
U.S.A.) satisfactorily produced specific banding
patterns that clearly separated the exotic
B. invadens from the native Ceratitis species. The
purified PCR products were digested with these
enzymes according to the manufacturers’ instructions. The digested PCR products were analysed
RESULTS
The invasive tephritid B. invadens and the native
Ceratitis anonae and C. fasciventris were identified
as key sweet orange fruit flies in the study area.
The identification was confirmed by sequencing
the COI genes and comparing with sequences
from GenBank. The sequences of all analysed
B. invadens, C. anonae and C. fasciventris showed
100 % similarities with their respective species
sequences on BOLD.
Fragment lengths of 658 bp were successfully
amplified in all the samples analysed which is
represented by 13 samples in Fig. 1. The two restriction enzymes RsaI and Hsp 92 II used in RFLP
analysis clearly separated the exotic B. invadens
from the native Ceratitis species (C. anonae and
C. fasciventris) (Figs 2, 3). The sizes of the banding
patterns obtained by digesting Bactrocera and
Ceratitis samples with the two restriction enzymes
are as shown in Table 1. Fragments of 322 bp and
336 bp in B. invadens(Fig. 2) could not be observed
as separate bands because they are very close
together and formed single bands between the
300 bp and 400 bp of DNA Ladder. The two Ceratitis species were separated by DNA barcoding
since they produced the same banding patterns
with the two restriction enzymes. This is because
they exist as a species complex with minor genetic
differentiation. Band sizes of 27 bp could not be
observed in 100 bp DNA Ladder on 2 % agarose S
gel.
Fig. 1. PCR products of Bactrocera invadens (syn. B. dorsalis) and Ceratitis spp. L = 100 bp DNA Ladder, Lanes: 1–7 =
B. invadens; 8–13 = Ceratitis spp. Numbers on the right indicate number of base pairs for DNA Ladder.
Onah et al.: Molecular identification of tephritid fruit flies infesting sweet oranges in Nigeria
345
Fig. 2. Fragment length patterns of Bactrocera invadens (syn. B. dorsalis) and Ceratitis spp. digested with the enzyme
Rsa I L = 100 bp DNA Ladder; Lanes: 1–6 = B. invadens, 7–11 = Ceratitis spp. Numbers on the right indicate number of
base pairs for DNA Ladder.
Fig. 3. Fragment length patterns of Bactrocera invadens (syn. B. dorsalis) and Ceratitis. spp. digested with the enzyme
Hsp92 II. L = 100 bp DNA Ladder; Lanes: 1–5 = B. invadens, 6–8 =Ceratitis spp. Numbers on the left indicate number of
base pairs for DNA Ladder.
DISCUSSION
The key tephritid fruit flies infesting sweet
oranges in Nsukka Agro-Ecological Zone, Nigeria
were reliably identified based on PCR-RFLP
patterns of the COI gene and DNA barcoding.
Bactrocera invadens identified in this study was also
recorded by Umeh et al. (2008) on sweet oranges in
Nigeria. However, variation in tephritid fruit fly
distribution which was reported in Umeh et al.
(2008) may be a reason why some of the species
recorded in their study were not identified in this
study. Their identification was based solely on
Table 1. PCR-RFLP fragments of partial COI gene of Bactrocera invadens (syn. B. dorsalis) and Ceratitis spp. for the
two restriction enzymes.
Fruit fly species
Restriction enzymes banding profiles
Number of samples
Accession numbers
Rsa I GT^AC
Hsp 92 II CATG^
B. invadens
322, 336
137, 521
31
AB911077,
AB911140–AB911169
C. anonae
201, 457
27, 110, 231, 290
31
AB911170–AB911200
C. fasciventris
201, 457
27, 110, 231, 290
1
AB911334
346
African Entomology Vol. 23, No. 2, 2015
morphological features while in this study both
morphological and molecular methods were
employed in the species identification. Morphological features only identified B. invadens but
could not establish the species of Ceratitis present.
Given the existence of morphologically indistinguishable species complexes both in Bactrocera and
Ceratitis species, morphological identification is
inefficient, unreliable and may lead to misidentification of a species or incomplete identification.
Thus, the PCR-RFLP of COI gene developed in
this study combined with DNA barcoding will be
of prime importance in distinguishing B. invadens
from Ceratitis species on sweet oranges in Nigeria.
The two genera Bactrocera and Ceratitis were
clearly separated by the two restriction enzymes
used (Figs 2, 3). However, given that C. anonae and
C. fasciventris exist as species complexes in Africa
they could not be distinguished by restriction
enzyme digestion. This was overcome by confirming the species by DNA barcoding of the Ceratitis
species collected. All the analyses confirmed the
presence of C. fasciventris and C. anonae. B. invadens
is the only member of B. dorsalis complex so
far reported in Nigeria and Africa. In addition,
B. curcubitae reported on sweet oranges in Nigeria
by Umeh et al. (2008) is morphologically different
from B. invadens in having a medial thoracic vitta
(De Meyer et al. 2012). Moreover, other invasive
Bactrocera spp. in Africa that may be similar to
B. invadens such as B. zonata and B. latifrons have
not been detected in Nigeria. Thus, the PCR-RFLP
patterns of COI gene so far developed will unambiguously identify B. invadens and may report
other potential invasive Bactrocera spp. in Nigeria
such as B. zonata and B. latifrons.
Molecular approaches involving PCR-RFLP of
COI gene and DNA barcoding are effective complementary of morphological identification of
tephritid fruit flies (PHA 2011). In some cases they
have proved to be a valuable alternative and the
only available option for identification. Lewter &
Szalanski (2007) who employed PCR-RFLP to
identify and differentiate fall armyworm (Spodo-
ptera frugiperda) noted that the technique offers a
very affordable and accurate method for the identification of insect species. The technique is quick,
reliable and results can be obtained within one single working day. Chua et al. (2010) showed that
this molecular method is effective even when only
body parts or immature stages of tephritid fruit
flies are present. Khemakhem et al. (2012) successfully developed PCR-RFLP patterns of the COI
gene in Tunisia to reliably identify and separate
the quarantine pests B.curcubitae, B. zonata and
C.capitata.
The PCR-RFLP pattern of the COI gene so constructed is the first of its kind in Nigeria. The application of this method to identify the species
present is indispensable in tackling fruit fly problems on citrus in Nigeria given that successful fruit
fly management rely on accurate identification of
the pestiferous species involved. In addition, the
method will enhance quarantine decision-making
at quarantine checkpoints for distinguishing the
exotic B.invadens from the native Ceratitis spp.,
especially at the immature stages when the two
genera are morphologically indistinguishable. In
further studies, this method will be tested on
immature stages of the tephritid fruit flies in
Nigeria.
ACKNOWLEDGEMENTS
The authors are grateful to R. Ugwuoke and
J. Okwor of the Department of Zoology and Environmental Biology, University of Nigeria, Nsukka,
who helped during the field work. We are also
thankful to A. Alonge, T. Owoeye and U. Nnanna
of the Bioscience Centre, International Institute
of Tropical Agriculture (IITA), Ibadan, Nigeria,
who helped during DNA extraction. Our gratitude is also due to M.H. Ogihara of Department of
Integrated Biosciences, University of Tokyo, and T.
Shimazaki of the Gene Research Centre, University of Tsukuba, Japan, for their help during laboratory work. This research was supported with
funds from the University of Tsukuba, Tsukuba,
Japan.
REFERENCES
ALLWOOD, A.J. & DREW, R.A.I. 1997. Management of
fruit flies in the pacific. ACIAR Proceedings No. 76.
ARMSTRONG, K.F. & BALL, S.L. 2005. DNA barcodes for
biosecurity: invasive species identification. Philosophical Transactions of the Royal Soceity B 360: 1813–1823.
BARNES, B.N. 2004. Proceedings of the 6th International
Symposium on Fruit Flies of Economic Importance.
Isteg Scientific Publications, Irene, South Africa.
BLACKET, M., SEMERARO, L. & MALIPATIL, M. 2012.
Barcoding Queensland fruit flies (Bactrocera tryoni):
impediments and improvements. Molecular Ecology
Resources 12: 428–436.
CHUA, T.H., CHONG, Y.V. & LIM, S.H. 2010. Species
determination of Malaysian Bactrocera species using
Onah et al.: Molecular identification of tephritid fruit flies infesting sweet oranges in Nigeria
PCR-RFLP analyses (Diptera: Tephritidae). Pest Management Science 66: 379–384.
CLARKE, A.R., ARMSTRONG, K.F., CARMICHAEL,
A.E., MILNE, J.R. & RAGHU, S. 2005. Invasive
phytophagous pests arising through a recent evolutionary radiation: the Bactrocera dorsalis complex of
fruit flies. Annual Review of Entomology 50: 293–319.
COPELAND, R.S., WHARTON, R.A., LUKE, Q. &
DE MEYER, M. 2002. Indigenous hosts of Ceratitis
capitata (Diptera: Tephritidae) in Kenya. Annals of the
Entomological Society of America 95: 672–694.
COPELAND, R.S., WHARTON, R.A., LUKE, Q., DE
MEYER, M., LUX, S., ZENZ, N., MACHERA, P. &
OKUMU, M. 2006. Geographic distribution, host
fruit, and parasitoids of African fruit fly pests Ceratitis
anonae, Ceratitis cosyra, Ceratitis fasciventris, and
Ceratitis rosa (Diptera: Tephritidae) in Kenya. Annals
of the Entomological Society of America 99: 262–278.
DE MEYER, M., MOHAMED, S. & WHITE, I.M. 2012.
Invasive fruit fly pests in Africa: a diagnostic tool and
information reference for the four Asian species of
fruit fly (Diptera, Tephritidae) that have become accidentally established as pests in Africa, including the
Indian Ocean Islands. Online at: http://www.
africamuseum.be/fruitfly/AfroAsia.htm (accessed 19
August 2012).
DREW, R.A.I., TSURUTA, K. & WHITE, I.M. 2005. A new
species of pest fruit fly (Diptera: Tephritidae:
Dacinae) from Sri Lanka and Africa. African Entomology 13(1): 149–154.
DUYCK, P.F., DAVID, P. & QUILICI, S. 2004. A review of
relationships between interspecific competition and
invasions in fruit flies (Diptera: Tephritidae). Ecological Entomology 29: 511–520.
EKESI, S. 2012.Combating fruit flies in Eastern and
Southern Africa (COFESA): elements of a strategy
and action plan for a regional cooperation program.
Online at: http://www.globalhort.org/media/
uploads/File/Fruit%20Fly/Fruit%20fly%20Issue%20
Paper%2010.05.2010-1.pdf (accessed 19 August 2012).
EKESI, S. & BILLAH, M.K. 2007. A Field Guide to the
Management of Economically Important Tephritid Fruit
Flies in Africa. ICIPE, Nairobi, Kenya.
EKESI, S., NDERITU, P.W. & RWOMUSHANA, I. 2006.
Field infestation, life history and demographic
parameters of Bactrocera invadens Drew, Tsuruta and
White, a new invasive fruit fly species in Africa. Bulletin of Entomological Research 96: 379–386.
ENCYCLOPAEDIA OF LIFE (EOL). 2010. Afrotropical
Fruitfly Project. Online at: http://eol.org/collections/
259?page=58 (accessed 19 August 2013).
FAO/IAEA. 2013.Trapping guidelines for area-wide fruit
347
fly programmes. Online at: http://www-pub.iaea.
org/MTCD/publications/PDF/TG-FFP_web.pdf
(accessed 12 December 2013).
FOLMER, O., BLACK, M., HOEH, W., LUTZ, R. &
VRIJENHOEK, R. 1994. DNA primers for the amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular
Marine Biology and Biotechnology 3(5): 294–299.
KHEMAKHEM, M.M., LAZAHR, W.B., BOUKTILA, D.,
SLIMEN, H.B., MAKNIA, H. & MAKNIA, M. 2012. A
rapid diagnostic technique of Bactrocera cucurbitae
and Bactrocera zonata (Diptera: Tephritidae) for quarantine application. Pest Management Science, DOI:
10.1002/ps.3433.
LEWTER, J.A. & SZANLASKI, A.S. 2007. Molecular identification of the fall armyworm, Spodoptera frugiperda
(J.E. Smith) (Lepidoptera: Noctuidae) using PCRRFLP. Journal of Agricultural and Urban Entomology
24(2): 51–57.
N OVO N T Y, V. , C L A R K E , A . R . , D R E W, R . A . I . ,
BALAGAWI, S. & CLIFFORD, B. 2005. Host specialization and species richness of fruit flies (Diptera:
Tephritidae) in a New Guinea rain forest. Journal of
Tropical Ecology 21: 67–77.
PHA (PLANT HEALTH AUSTRALIA). 2011. The Australian Handbook for Identification of Fruit Flies. Version 1.0.
Plant Health Australia (PHA), Canberra, ACT, Australia.
SCHUTZE, M.K., AKETARAWONG, N., AMORNSAK,
W., ARMSTRONG, K.F., AUGUSTINOS, A.A., et al.
2014. Synonymization of key pest species within
the Bactrocera dorsalis species complex (Diptera:
Tephritidae): taxonomic changes based on a review
of 20 years of integrative morphological, molecular,
cytogenetic, behavioural and chemoecological data.
Systematic Entomology 40: 456–471.
UMEH, V. & ONUKWU, D. 2011. Effectiveness of foliar
protein bait sprays in controlling Bactrocera invadens
(Diptera: Tephritidae) on sweet oranges. Fruits 66:
307–314.
UMEH, V.C., AHONSI, S. & KOLADE, J.A. 1998. Insect
pests encountered in a citrus orchard in Nigeria.
Fruits 53: 397–408.
UMEH, V.C., GARCIA, L.E. & DE MEYER, M. 2008. Fruit
flies of citrus in Nigeria: species diversity, relative
abundance and spread in major producing areas.
Fruits 63: 145–153.
UNCTAD. 2013. Citrus Fruit – Market. United Nations
Conference on Trade and Development. Online at:
http://www.unctad.info/en/Infocomm/Agricultural_Products/Citrus-fruit/market/ (accessed 11
December 2013).
Accepted 25 June 2015