* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download MEng BIOMEDICAL ENGINEERING BEng (Hons) MEDICAL ENGINEE
Vectors in gene therapy wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Genetic engineering wikipedia , lookup
Primary transcript wikipedia , lookup
History of genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
[LH92] UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES BEng (HONS)/MEng BIOMEDICAL ENGINEERING BEng (Hons) MEDICAL ENGINEERING SEMESTER ONE EXAMINATIONS 2015/16 MOLECULAR PRINCIPLES OF BIOMEDICAL ENGINEERING MODULE NO: BME4002 Date: Wednesday 13 January 2016 Time: 2.00 pm – 5.00 pm INSTRUCTIONS TO CANDIDATES: Candidates are advised that the examiners attach importance to legibility of writing and clarity of expression. YOU ARE STRONGLY ADVISED TO PLAN YOUR ANSWERS There are THREE sections. Answer ALL questions from Section A and Section B. Answer ONE question from Section C. Write all answers in answer booklet. Marks for parts of questions are shown in brackets. This examination paper carries a total of 100 marks. All working must be shown. A numerical solution to a question obtained by programming an electronic calculator will not be accepted. Page 2 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 SECTION A: Answer ALL questions in this section; 1 mark per question, 25 marks in total. 1. Light microscopes can effectively magnify the size of a specimen: a. Approximately 100x. b. Approximately 1000x. c. Approximately 10,000x d. More than 10,000x. 2. During mitosis, in which stage are all of the chromosomes aligned in the centre of the cell? a. Prophase. b. Metaphase. c. Anaphase. d. Telophase. 3. How many different codons are possible? a. 3. b. 20. c. 64. d. An infinite number. 4. Which site of the tRNA molecule binds to the mRNA molecule? a. Anticodon. b. Codon. c. Amino acid. d. 5’ (prime) end. 5. All of the chemical reactions that occur in the body are collectively known as: a. Metabolism. b. Catabolism. c. Anabolism. d. Embolism. 6. Chromosomal translocations involve: a. The deletion of DNA from a chromosome. b. The swapping of DNA between two homologous chromosomes. c. The swapping of DNA between two non-homologous chromosomes. d. The insertion of DNA into a chromosome. PLEASE TURN OVER Page 3 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 7. Which of the following is correct? a. Mr = mass x moles b. Moles = Mr ÷ mass c. Moles = mass x Mr d. Moles = mass ÷ Mr 8. Which carbon in a carbohydrate determines the configuration of an epimer? a. The most oxidized carbon (i.e. aldehyde or ketone). b. The carbon furthest from the most oxidized carbon. c. The most central carbon. d. None of the above. 9. The size of most bacterial cells is: a. Between 1 and 10 μm. b. Between 10 and 100 μm. c. Between 100 and 1000 μm. d. Greater than 1000 μm. 10. Which of the following events are unique to meiosis? a. Synapsis and crossing over. b. Alignment of tetrads at the metaphase plate. c. Homologous pairs of chromosomes separate to the cell poles. d. All of the above. 11. How many codons are needed to specify three amino acids? a. 3. b. 6. c. 9. d. 12. 12. Because of base pairing in DNA, the percentage of: a. Adenine bases in DNA is about equal to the percentage of guanine bases. b. Pyrimidines in DNA is about equal to the percentage of purines. c. Purines in DNA is much greater than the percentage of pyrimidines. d. Cytosine bases in DNA is much greater than the percentage of guanine bases. PLEASE TURN OVER Page 4 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 13. Why is it possible for an amino acid to be specified by more than one kind of codon? a. Some codons have the same sequence of nucleotides. b. There are 64 different kinds of codons but only 20 amino acids. c. Some codons do not specify an amino acid. d. The codon AUG codes for the amino acid methionine and serves as the "start" codon for protein synthesis. 14. Proteins are made from long, folded chain molecules. What are these chains called? a. Polysaccharides. b. Polypeptides. c. Polynucleotides. d. Fatty acids. 15. Which parts of amino acids are involved in peptide bonds? a. The carboxyl group on one amino acid and the side chain on the other. b. The carboxyl group on both amino acids. c. The amino group on one amino acid and the carboxyl group on the other. d. The amino group on both amino acids. 16. Starch is formed from: a. Glucose molecules linked by a 1-4 alpha glycosidic bond. b. Glucose molecules linked by a 1-4 beta glycosidic bond. c. Glucose molecules linked by a 1-6 alpha glycosidic bond. d. Alternating molecules of N-acetylmuramic acid and N-acetylglucosamine. 17. Which of the following is NOT an active method where molecules pass across the plasma membrane? a. Simple diffusion. b. Active transport. c. Endocytosis. d. Exocytosis. 18. Which of the following statements is NOT correct about the phospholipid molecules in the plasma membrane? a. Each phospholipid molecule has three nonpolar tails. b. Each phospholipid molecule has one polar head. c. The phospholipid tails are not attracted to water. d. The phospholipid heads face outward. PLEASE TURN OVER Page 5 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 19. If the Standard Gibb’s free energy, ΔG, for a reaction is positive then: a. The products will be favoured. b. The reactants will be favoured. c. The concentration of the reactants and products will be equal. d. All of the reactant will be converted to product. 20. Which type of inversion is able to change the shape of a chromosome? a. Paracentric. b. Pericentric. c. Porocentric. d. None of the above. 21. Which of the following statements about water molecules is true? a. The molecule is completely uncharged. b. The molecule is slightly charged. c. The molecule is ionic. d. The molecule has a lattice structure. 22. When NaCl is dissolved in water, the NaCl is the ____________ and the water is the ____________ . a. Solvent; solution. b. Solute; solvent. c. Solute; solution. d. Solvent; solute. 23. Which of the following is true of porin? a. It has a hydrophilic exterior and a hydrophobic internal channel. b. It has a hydrophilic exterior and a hydrophilic internal channel. c. It has a hydrophobic exterior and a hydrophobic internal channel. d. It has a hydrophobic exterior and a hydrophilic internal channel. 24. The absence of double bonds makes a fatty acid: a. Saturated. b. Hydrogenated. c. Oxygenated. d. Unsaturated. PLEASE TURN OVER Page 6 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 25. What happens during the process of transcription? a. Messenger RNA is made from DNA. b. The cell uses information from messenger RNA to produce proteins. c. Transfer RNA is made from messenger RNA. d. Copies of DNA molecules are made. [Total for Section A: 25 marks] PLEASE TURN OVER Page 7 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 SECTION B: Answer ALL questions in this section; 5 marks per question, 50 marks in total. 1. Describe three of the five main types of chromosomal aberration. [5 marks] 2. Name and describe the four levels of protein structure. [5 marks] 3. Name three of the main stages of mitosis and describe what happens at that stage. [5 marks] 4. How do the chemical properties of lipid molecules allow them to form cell membranes? [5 marks] 5. You are working as a technician in a medical laboratory, and you do not have access to a calculator. a) Describe how you would make 1 L of a 1 M solution of NaCl (Mr NaCl = 58.44; Mr H20 = 18.02). [3 marks] b) How would you dilute the solution described in part (a) to make 500 mL of a 0.5 M solution? [2 marks] [Total 5 marks] PLEASE TURN OVER Page 8 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 6. Describe the chemical structure of a nucleotide, making reference to the difference(s) between RNA and DNA. [5 marks] 7. Explain how enzymes allow energetically favourable chemical reactions to occur more quickly. [5 marks] 8. Explain, with examples, what carbohydrate epimers are. [5 marks] 9. Briefly describe three ways by which the classical Mendelian 3:1 ratio may be disrupted. [5 marks] PLEASE TURN OVER Page 9 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 10. You have been given the following sequence of double stranded DNA, which is at the start of a gene: Position 1 Position 18 5’ TACCAATGAATCGTCTAGAGCCATAA 3’ 3’ ATGGTTACTTAGCAGATCTCGGTATT 5’ Non-template strand Template strand a) Assuming transcription begins at position 1, what sequence of mRNA would be produced during transcription? [1 mark] b) Using the information supplied in Table 1 (see below), what amino acid sequence would be produced from your mRNA sequence in part (a) during translation? [2 marks] c) What would happen if the DNA base in the non-template strand at position 18 was mutated from G to T? [2 marks] [Total 5 marks] Table 1: The Genetic Code PLEASE TURN OVER Page 10 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 [Total for Section B: 50 marks] PLEASE TURN OVER Page 10 of 10 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 SECTION C: Answer ONE question only; 25 marks. 1. Explain why carbohydrates are essential for life. [25 marks] OR 2. Describe the differences in cellular structure between prokaryotic and eukaryotic cells. [25 marks] OR 3. Describe the processes utilised by a cell which allow DNA to encode for protein synthesis. [25 marks] [Total for Section C: 25 marks] Page 12 of 12 School of Sport and Biomedical Sciences Biomedical Engineering and Medical Engineering Semester 1 Examination 2015/16 Molecular Principles of Biomedical Engineering Module No. BME4002 END OF QUESTIONS PLEASE TURN OVER