Download Ectopic expression of fibroblast growth factor

From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
NEOPLASIA
Ectopic expression of fibroblast growth factor receptor 3 promotes
myeloma cell proliferation and prevents apoptosis
Elizabeth E. Plowright, Zhihua Li, P. Leif Bergsagel, Marta Chesi, Dwayne L. Barber, Donald R. Branch,
Robert G. Hawley, and A. Keith Stewart
The t(4;14) translocation occurs in 25% of
multiple myeloma (MM) and results in
both the ectopic expression of fibroblast
growth factor receptor 3 (FGFR3) from
der4 and immunoglobulin heavy chainMMSET hybrid messenger RNA transcripts
from der14. The subsequent selection of
activating mutations of the translocated
FGFR3 by MM cells indicates an important role for this signaling pathway in
tumor development and progression. To
investigate the mechanism by which
FGFR3 overexpression promotes MM development, interleukin-6 (IL-6)-dependent
murine B9 cells were transduced with
retroviruses expressing functional wildtype or constitutively activated mutant
FGFR3. Overexpression of mutant FGFR3
resulted in IL-6 independence, decreased
apoptosis, and an enhanced proliferative
response to IL-6. In the presence of
ligand, wild-type FGFR3-expressing cells
also exhibited enhanced proliferation and
survival in comparison to controls. B9
clones expressing either wild-type FGFR3
at high levels or mutant FGFR3 displayed
increased phosphorylation of STAT3 and
higher levels of bcl-xL expression than
did parental B9 cells after cytokine withdrawal. The mechanism of the enhanced
cell responsiveness to IL-6 is unknown at
this time, but does not appear to be mediated by the mitogen-activated protein kinases SAPK, p38, or ERK. These findings
provide a rational explanation for the mechanism by which FGFR3 contributes to both
the viability and propagation of the myeloma clone and provide a basis for the
development of therapies targeting this
pathway. (Blood. 2000;95:992-998)
r 2000 by The American Society of Hematology
Introduction
Multiple myeloma (MM) is a terminally differentiated and uniformly fatal B-cell malignancy that accounts for 10% of all
hematopoietic neoplasms.1 The pleotropic cytokine interleukin-6
(IL-6) plays a central role in disease pathobiology as the major
myeloma growth factor. Accumulated data suggest that IL-6
contributes to both the viability and proliferation of the malignant
clone2-4 in which the mitogenic signal is probably transmitted
through the mitogen-activated protein kinase (MAPK) pathway,
particularly via ERK25 and the anti-apoptotic signal through the
Jak-STAT pathway.6,7 Mechanisms by which IL-6 regulates myeloma cell survival include the up-regulation of an anti-apoptotic
gene, bcl-xL8, and the down-regulation of SAPK in response to cell
death stimuli.9 Nevertheless, the mechanism by which IL-6 signaling becomes dysregulated in myeloma remains unknown.
In this regard we and others have previously reported that
translocations into the immunoglobulin heavy (IgH) chain switch
region are ubiquitous in MM cells.10-18 These translocations
involve several heterogeneous translocation partners, including
c-myc,10 MUM1/IRF4,11 cyclin D1,12 c-maf,13 and FGFR3/
MMSET.14,15,18 These recurrent translocations have been identified
with a similar high frequency in primary patient samples by reverse
transcriptase (RT)-polymerase chain reaction,14 dual color interphase fluorescence in situ hybridization,17 and multicolor spectral
karyotypes.16 They are present in patients with monoclonal gammopathy of undetermined significance (MGUS),14 and we hypoth-
esize that these translocations are an early event in the development
of MGUS or MM.
FGFR3 is a receptor tyrosine kinase normally expressed in
cartilage, the central nervous system, and the brain. Mice lacking
the wild-type gene develop an overgrowth of the long bones,19,20
suggesting that this gene normally negatively regulates bone
growth. In humans, activating mutations of FGFR3 cause various
forms of dwarfism when the mutations arise within the germline.21-23 Interestingly, some of the same activating mutations of
FGFR3 known to cause dwarfism have been found to be involved
in the IgH translocations of MM. We have previously identified
activating mutations of FGFR3 in 3 of 6 cell lines and in 1 of 3
primary patient samples.14 One identified mutation results in
ligand-independent activation of the receptor and is known to
cause thanatophoric dysplasia type 2 (TD II) when it arises in
the germline.24
Currently, the consequences of translocated wild-type FGFR3
or constitutively active forms of FGFR3 on MM cells are
unknown. We postulated that inappropriate expression of FGFR3
by illegitimate isotype switch recombination would enable myeloma cells to phosphorylate STATs as previously reported in
chondrocytes.25,26 We also reasoned that one of the downstream
targets of STATs was bcl-xL, as we have previously shown that
IL-6, via gp130, causes bcl-xL up-regulation,8 and because leukemia inhibitory factor (LIF) signaling through gp130 up-regulates
From the Princess Margaret Hospital, Toronto, Ontario, Canada; and Weill
Medical College, Cornell University Medical School, New York, NY.
Floor Room 126, The Princess Margaret Hospital, 610 University Ave, Toronto,
Ontario M5G 2M9; e-mail: [email protected].
Submitted March 16, 1999; accepted September 11, 1999.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
Supported by funds from MRC of Canada and the Nelson Arthur Hyland
Foundation.
Reprints: A. Keith Stewart, Department of Medical Hematology-Oncology, 5th
992
r 2000 by The American Society of Hematology
BLOOD, 1 FEBRUARY 2000 • VOLUME 95, NUMBER 3
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 1 FEBRUARY 2000 • VOLUME 95, NUMBER 3
bcl-xL via STAT1 in cardiac myocytes.27 We report here the results
of the investigation of this hypothesis.
Materials and methods
Retroviral vector construction
Two pcDNA3 plasmids containing the full-length human complementary
DNA (cDNA) of wild-type or TD II mutant form of FGFR3 were obtained
from Daniel. J. Donoghue (San Diego, CA). FGFR3 was released by
restriction cutting with HindIII and SpeI, also removing the 38 untranslated
region. The recessed 38 termini ends of the cDNA fragments were filled, and
the fragments ligated into an HpaI/SnaBI-digested MINV retrovirus28
containing the neomycin-resistance gene as the selectable marker. The
resulting vectors were termed MFINV-WT (wild-type FGFR3) and
MFINV-TD (TD K650E mutant form of FGFR3). The parental MINV
vector (neor only) was used as a negative vector control.
Retrovirus production
Twenty micrograms of the constructed retroviral vectors and the parental
MINV (neor only) vector were electroporated into 1.5 ⫻ 106 PA317
amphotropic packaging cells.29 After 2 days of culture, the supernatant was
collected, passed through a 0.45-µm filter, and overlaid on subconfluent
monolayers of GP⫹E ecotropic packaging cells30 in the presence of
8 µg/mL of polybrene (Sigma, St. Louis, MO). On day 3 and 4 of culture,
this process was repeated. Transduced GP⫹E cells were selected in fresh
medium containing 1.2 mg/mL of G418 (Gibco, Grand Island, NY) over a
period of 14 days. Vector supernatant was collected from GP⫹E producer
cells 24 hours after the medium was changed to Iscove’s Modified
Dulbecco’s Medium (IMDM) plus 5% fetal calf serum (FCS) (Gibco).
Generation of B9 lines expressing wild-type FGFR3 and
FGFR3-TD mutant
Supernatant from the G418 selected GP⫹E producer lines was added to B9
cells along with 2% IL-6 conditioned media from the SP2/mIL-6 cell line31
and 8 µg/mL of polybrene (Sigma). After 2 days, fresh retroviral supernatant was added. After an additional 72 hours of incubation, B9 cells were
selected in 2% IL-6 conditioned medium and 1.2 mg/mL G418 for 2 weeks,
generating the cell lines B9-MINV (empty vector), B9-WT (wild-type
FGFR3), and B9-TD (TD II mutant form of FGFR3). After selecting for
stably transduced cells, a limiting cell dilution was performed to generate
single-cell clones of B9-WT and B9-TD. Subsequent Western blot analysis
used individual high- or low-expressing clones of B9-WT and B9-TD.
Tissue culture
Cells were cultured at 37°C in a humidified atmosphere containing 5% CO2.
B9 cells were grown in IMDM supplemented with 5% FCS, 2% IL-6
conditioned medium, and penicillin-streptomycin (Gibco). KMS11, a
human myeloma cell line containing an FGFR3 translocation, was kindly
provided by Masayoshi Namba (Okayama, Japan). KMS11 was grown in
RPMI Medium 1640 supplemented with 10% FCS and penicillin-streptomycin. U266, a human myeloma cell line, was grown in IMDM with 10% FCS.
GP⫹E and PA317 cells were grown in Dulbecco modified Eagle medium
supplemented with 10% FCS and penicillin-streptomycin.
ECTOPIC EXPRESSION OF FGFR3
993
3H-thymidine (Amersham, Arlington Heights, IL) was added to each well in
the last 18 hours of the assay. Cells were harvested onto glass filter paper
(Gelman Science, Ann Arbor, MI), and 3H-thymidine counts determined by
liquid scintillation.
Ligand stimulated proliferation assay
B9-WT cells were plated at a concentration of 2 ⫻ 105 cells/mL in a
96-well plate in the presence of increasing concentrations of acidic
fibroblast growth factor (aFGF) (R&D Labs, Minneapolis, MN) and
heparin (Sigma). Cells were subsequently incubated for 2 or 3 days and then
analyzed with the use of the chromogenic dye 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) (Boehringer Mannheim, Mannheim, Germany). Absorbance at 570 nm-650 nm was read on an enzymelinked immunosorbent assay plate reader (Molecular Devices, Sunnyvale,
CA). After optimal concentrations of aFGF (40 ng/mL) and heparin (30
µg/mL) for the support of cell proliferation were determined, B9, B9MINV, B9-WT, and B9-TD were washed four times in IMDM lacking FCS
and plated in triplicate at a concentration of 2 ⫻ 105 cells/mL in 96-well
plates. Each cell line was analyzed under 4 different conditions: 40 ng/mL
aFGF and 30 µg/mL of heparin, 40 ng/mL aFGF and 30 µg/mL of heparin
plus 2% IL-6, 2% IL-6 without ligand, and 0% IL-6 without ligand. Cells
were incubated for 48-72 hours and then analyzed by MTT.
Cell cycle and apoptosis analysis
Cell lines were washed and then plated in IMDM plus 5% FCS at a density
of 0.5 ⫻ 106 in 0% IL-6 or 0.1 ⫻ 106 in the presence of IL-6. Cells were
cultured for 48 or 72 hours. After harvesting the cells, 500 µL of a hypotonic
fluorochrome solution (0.1% sodium citrate, 0.1% Triton X-100, 50 µg/mL
of propidium iodide) was added to each cell pellet. The samples were
incubated overnight in the dark at 4°C. Flow cytometry was performed on a
FACScan (Becton Dickinson, Meylan, France) the following day, using
Cell Quest software to acquire data and ModFit LT software for analysis.
Tunel assays (Promega, Madison, WI) were performed according to the
manufacturer’s protocol. In brief, 4 ⫻ 106 cells were fixed with 1%
paraformaldehyde for 20 minutes on ice. Cells were incubated at 37°C for 1
hour with terminal deoxynucleotidyl transferase (TdT) enzyme and nucleotide mix containing fluorescein-12-dUTP to end label the 38OH end of the
fragmented DNA. The reaction was ceased by addition of 20 mM
ethylenediaminetetraacetic acid, and cells were washed twice in 0.1%
Triton X-100 and stained with propidium iodide for 30 minutes. Analysis
was performed by flow cytometry, and apoptotic cells were fluorescein-12dUTP positive.
Western blots
Western blot analysis was carried out according to previously published
procedures.32 Membranes were probed with antibodies to the C-terminus
end of FGFR3, to murine bcl-xS/L, to murine bcl-2, to murine bax,
anti-phosphotyrosine (all Santa Cruz Biotechnology, Santa Cruz, CA),
anti-phospho-STAT1 (Upstate Biotechnology, Lake Placid, NY), antiSTAT3 and anti-STAT1 (Transduction Laboratories, Lexington, KY), or
with polyclonal rabbit anti-phospho-STAT1/STAT5, anti-phospho-STAT5,
anti-phospho-STAT3 (all 3 kindly provided by David A. Frank, DanaFarber Cancer Institute, Boston, MA), and anti-STAT5 (kindly provided by
Dr J. N. Ihle, Memphis, IN). Goat antirabbit IgG horseradish peroxidase
(PharMingen, Mississauga, ON) or sheep antimouse IgG horseradish
peroxidase (Amersham, Arlington Heights, IL) were used as secondary
antibodies, and blots were developed by enhanced chemiluminescence
(Amersham) according to manufacturer’s instructions.
Cell viability and proliferation
To examine cell viability and proliferation, B9, B9-MINV, B9-WT, and
B9-TD were washed 4 times in IMDM without FCS and then plated in
triplicate in a 96-well plate at a density of 1 ⫻ 104 cells/well in varying
concentrations of IL-6 and cultured for 48-96 hours. Total cell number and
percent viability were determined every 24 hours by trypan blue staining
and enumeration with a hemocytometer. For proliferation assays, 0.5 µCi of
Electrophoretic mobility shift assay (EMSA)
EMSA was carried out as previously described.33 After generation of
nuclear lysates from cells stimulated with and without IL-6, the gel shift
assays were performed with the use of double-stranded 32P-labeled
oligonucleotide derived from the IRF-1 promoter (CTGATTTCCCCGAAATGAC).34 Five micrograms of nuclear lysates was incubated with
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
994
PLOWRIGHT et al
BLOOD, 1 FEBRUARY 2000 • VOLUME 95, NUMBER 3
0.25 ng of 32P-labeled oligonucleotide in 20 µL of binding buffer,13 mmol/L
HEPES (pH 7.9; 65 mmol/L NaCl, 1 mmol/L DTT, 15 mmol/L ethylenediaminetetraacetic acid, 8% glycerol, 50 µg of poly (dI-dC)/mL) for 15
minutes at 4°C. For competition experiments, 50-fold molar excess of either
unlabeled IRF-1 or an oligonucleotide derived from T14 promoter (TTCTTGAGGTAATGAAAGCC)35 was added to the binding reaction. For supershifting experiments, a peptide-specific STAT3 (Zymed, San Francisco,
CA) was added at the completion of the binding reaction and incubated for
an additional 30 minutes at 4°C.
Immunoprecipitation and in vitro kinase assay
Immunoprecipitation and in vitro kinase assay were carried out as
previously described.32 Twenty-five microliters/reaction of 20% (v/v)
Protein-A Sepharose (Pharmacia, Uppsala, Sweden) was incubated with 12
µL of anti-FGFR3, anti-ERK1 (recognizes ERK1 and ERK2), anti-p38,
or anti-JNK1 (SAPK) (all from Santa Cruz Biotechnology) overnight at
4°C; 1250 µg of total cell lysate was incubated with the bead complex for 2
hours at 4°C. Immunoprecipitates were split into equal aliquots. One aliquot
was washed 4 times with kinase buffer and subjected to in vitro kinase
assay. The other aliquot was subjected to standard Western blotting
procedure, probing the membranes with anti-FGFR3, ERK1, p38, or
JNK1 (SAPK).
Results
Human FGFR3 is functional in transduced B9 cells
Western blots confirmed varying levels of expression of FGFR3 in
the transduced B9-WT (Figure 1A) and B9-TD (Figure 1B) lines
and subclones. An in vitro kinase assay demonstrated that both
wild-type and FGFR3-TD lines were capable of autophosphorylation (Figure 2). Phosphotyrosine Western blots further demonstrated that FGFR3 was phosphorylated only in the absence of
ligand within the B9-TD line, thus indicating that the mutant
receptor possessed constitutive tyrosine kinase activity. On addition of ligand, aFGF, and heparin, phosphorylation of wild-type
FGFR3 was induced in B9-WT (not shown).
FGFR3 overexpression can substitute for
IL-6 receptor signaling
We first asked if overexpression of FGFR3 would influence IL-6–
induced proliferation of B9 cells. Parental B9, B9-MINV, and
pooled B9-WT cells had a similar rate of proliferation at all
concentrations of IL-6 as assessed by 3H-thymidine incorporation.
However, the proliferative rate of pooled B9-TD cells expressing
Figure 1. Expression of fibroblast growth factor receptor 3 (FGFR3) is achieved
at variable levels in B9-WT and B9-TD cells. (A) Western blot analysis, probing
with anti-FGFR3, shows the expression of FGFR3 in B9 clones: KMS11 myeloma cell
line positive control for FGFR3 (lane 1), parental B9 (lane 2), and B9-WT subclones
(lanes 3-15). Lane 4 (clone #3) and lane 7 (clone #6) represent clones selected for
further study. (B) KMS11 positive control for FGFR3 (lane 1), U266 myeloma cell line
negative control (lane 2), parental B9 (lane 3), and B9-TD subclones (lanes 4-18).
Lane 17 represents clone #14 selected for further study.
Figure 2. Fibroblast growth factor receptor 3 (FGFR3) is functional in B9-WT
and B9-TD Cells. Parental B9, B9 MINV, B9-WT, and B9-TD cells were subjected to
an in vitro kinase assay with the use of anti-FGFR3 to initially immunoprecipitate
FGFR3. Presence or absence of the ligand acidic fibroblast growth factor is indicated.
Autophosphorylation of FGFR3 is apparent in B9-WT and B9-TD cells, demonstrating
functionality of the expressed protein.
mutant FGFR3 was higher than that for the other 3 cell lines at all
concentrations of IL-6 (Figure 3). Two days after withdrawal of
IL-6, B9, B9-MINV, B9-WT, and B9-TD, cells were 30%, 16%,
44%, and 75% viable, respectively. After 4 days of cytokine
starvation, there were 6 times more viable cells in B9-TD culture
than for the other lines, and, unlike the parental B9 cell line, B9-TD
cells could be maintained indefinitely in the absence of IL-6. Thus,
activated FGFR3 enhanced cell proliferation in response to IL-6
and could substitute for the absolute dependence of B9 cells on
IL-6. Because many myelomas do not immediately acquire FGFR3
mutation, we next examined the response of cells expressing the
wild-type or mutant protein to the addition of the aFGF ligand. On
ligand stimulation of IL-6–starved cells, B9-WT proliferation was
greater than that seen for parental B9 and B9-MINV cells, and the
already increased proliferation of B9-TD cells was further enhanced (Figure 4). Some B9-WT clones expressing the highest
levels of FGFR3 (eg, clone #3 and clone #6) also exhibited IL-6
independence. These data together demonstrate an enhanced responsiveness of FGFR3-expressing cells to IL-6 stimulation and the
acquisition of IL-6 independence proportional to the degree of
activation of FGFR3.
Signaling by FGFR3 decreases apoptosis in the absence of IL-6
The mechanism of enhanced survival of B9-TD cells in the absence
of IL-6 and ligand was next examined. There was little difference in
Figure 3. Cells expressing activated fibroblast growth factor receptor 3
(FGFR3) have an enhanced proliferative rate in the presence and absence of
interleukin-6 (IL-6). Parental B9 (U), B9-MINV (䊐), pooled B9-WT (䉱), and B9-TD
(⫻) cell lines were incubated in the presence of increasing concentrations of IL-6, and
a 3H-thymidine proliferation assay was performed. Pooled B9-TD cells exhibit
enhanced proliferation at all concentrations of IL-6.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 1 FEBRUARY 2000 • VOLUME 95, NUMBER 3
ECTOPIC EXPRESSION OF FGFR3
Figure 4. Ligand-stimulated cells expressing wild-type fibroblast growth factor
receptor 3 (FGFR3) proliferate in the absence of interleukin-6 (IL-6). A chromogenic dye 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay
was performed on IL-6–starved FGFR3-expressing cell lines and controls in the
presence or absence of ligand (acidic fibroblast growth factor and heparin). Pooled
B9-WT cells exhibit enhanced proliferation in comparison to cytokine-starved
controls only in the presence of ligand. Pooled B9-TD cells demonstrate increased
proliferation in the absence of IL-6 and further enhancement of proliferation in
response to ligand.
the cell-cycle status of B9, B9-WT, and B9-TD in the presence or
absence of IL-6. It was noted, however, that B9-TD cells had fewer
sub-G0 apoptotic cells in the absence of IL-6 and ligand than did
either controls or B9-WT. Indeed, with the use of a Tunel assay, the
vast majority of parental B9 cells were apoptotic 5 days after
withdrawal of IL-6, whereas only 53% of pooled B9-TD cells were
undergoing apoptosis (Table 1). B9-MINV and pooled B9-WT had
between 85% and 88% apoptotic cells in the absence of IL-6 and
ligand. These data demonstrate that activated FGFR3 prevents
apoptosis of IL-6–dependent cells in the absence of IL-6.
FGFR3 signaling induces phosphorylation of STAT3
Because the STATs are a key mediator of cytokine signaling,
Western blot analysis was performed with the use of antibodies that
bind to tyrosine phosphorylated STAT1, STAT3, or STAT5. STAT5
was phosphorylated in all cell lines independent of the presence or
absence of IL-6 and was not further activated by FGFR3. STAT1
and STAT3 were phosphorylated in all of the cell lines after IL-6
stimulation. However, STAT3 was also constitutively phosphorylated (in the absence of IL-6) in both B9-WT clones expressing
high levels of FGFR3 and in B9-TD cells (Figure 5). To confirm
that STAT3 was constitutively activated in cells expressing high
levels of wild-type FGFR3 or mutant FGFR3, EMSAs were
performed. In the absence of IL-6 stimulation, both B9-WT and
B9-TD cells displayed a protein-DNA complex that was only
present in parental B9 cells in the presence of IL-6 (Figure 6). This
complex could be competed with an excess of unlabeled IRF-1 but
was not affected by a molar excess of nonspecific oligonucleotide.
It was demonstrated that the complex contained STAT3 because a
peptide-specific STAT3 antibody could supershift the complex in
B9-TD cells.
995
Figure 5. STAT3 phosphorylation in fibroblast growth factor receptor 3 (FGFR3)expressing cells. FGFR3-expressing and control cell lines were depleted of cytokine
and then stimulated with or without interleukin-6 for 10 minutes at 37°C. B9-WT
clones selected for high expression of FGFR3 were used. Total cell lysates were resolved
via SDS-PAGE, and the membrane was probed with a tyrosine phospho-specific STAT3
antibody (upper panel). The membrane was reprobed for loading equivalence with a
peptide-specific antibody that recognized total STAT3 (lower panel).
expressing constitutively activated FGFR3 than in B9 controls
(Figure 7A). With the withdrawal of IL-6 from B9 or B9-MINV
control cells, there is a decrease in the amount of bcl-xL protein
over 48 hours. In contrast, the expression of bcl-xL in B9-TD clones
remained relatively constant after the withdrawal of IL-6 from the
culture medium. Some B9-WT clones expressing high levels of
FGFR3 also exhibit a marked increase in baseline expression of
bcl-xL (Figure 7B). Of interest, the addition of ligand actually
decreases bcl-xL expression in B9-WT clones, perhaps because of
down-regulation of the receptor.
Western blots were also used to examine the expression levels
of bcl-xS, bax, and bcl-2. There was no change in the expression of
bax because of the presence of FGFR3 either in the presence or
absence of IL-6. Levels remained similar to those expressed by
parental B9 cells. Expression of bcl-2 and bcl-xS was not detected in B9 cells or in the FGFR3-expressing derivatives (data
not shown).
Enhanced proliferative response to IL-6 is not
mediated by MAP kinases
Although overexpression of bcl-xL may explain the enhanced
survival of B9 cells overexpressing FGFR3, it does not explain the
enhanced proliferative rate of the transduced cell lines in response
to IL-6. Because cytokines not only activate the JAK-STAT
signaling pathway but also function to phosphorylate members of
FGFR3 survival signal is mediated by up-regulation of bcl-xL
Because we have previously shown that the IL-6 survival signal in
myeloma is mediated by up-regulation of bcl-xL,8 we next examined the expression of this protein by Western blots and demonstrated that the baseline level of bcl-xL is higher in B9-TD cells
Table 1. Percentage of apoptotic cells assessed by tunel assay after 5 days of
culture in the presence or absence of interleukin-6 (IL-6)
IL-6 Concentration
B9
B9 MINV
B9-WT
B9-TD
0
97
85
85
53
2
3
5
9
12
Figure 6. STAT3 DNA binding is constitutively activated in B9-WT and B9-TD
cells. Nuclear extracts were prepared from B9, B9 MINV, B9-WT#3, and B9-TD#14
stimulated with and without interleukin-6 for 10 minutes at 37°C. Complexes were
resolved on a 5% native polyacrylamide gel. The specificity of DNA binding was
determined by the addition of unlabeled IRF-1 oligonucleotide (S) or a nonspecific
oligonucleotide from the T14 promoter (N) and by incubation with a peptide-specific
STAT3 antibody. (The absence of supershifting in B9-MINV and B9-WT cells is likely
technical in nature.)
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
996
PLOWRIGHT et al
Figure 7. Expression of bcl-XL protein is elevated in fibroblast growth factor
receptor 3 (FGFR3)-overexpressing cells. Total cell lysates were prepared at
varying time points from FGFR3-expressing clones or from control cells grown in the
absence of interleukin-6 (IL-6) over a 48-hour period. The lysates were resolved via
SDS-PAGE, and the membrane was probed with an anti–bcl-xS/L antibody. Membranes were reprobed with ERK as a protein-loading control. (A) bcl-xL is overexpressed at baseline in cells expressing mutant FGFR3 (B9-TD#14) and remains high
after IL-6 withdrawal (top panel). (B) bcl-xL is also overexpressed at baseline in cells
expressing high levels of wild-type FGFR3 (B9-WT#3 and B9-WT#6) and remains
high after IL-6 withdrawal (first and third panel). With the addition of fibroblast growth
factor ligand, down-regulation of bcl-xL is noted.
the MAPK family, we next examined ERK-, p38-, and SAPKinduced activation. Although p38 was induced by IL-6, no change
in SAPK, ERK1, ERK2, or p38 activity was noted in the
FGFR3-expressing cell lines (not shown). Thus, the mechanism
of enhanced IL-6 responsiveness in FGFR3-expressing cells remains unknown.
Discussion
The t(4;14) translocation occurs in approximately 25% of MM cell
lines and patient samples and results in the ectopic expression of
FGFR3 from the der1414 and IgH-MMSET hybrid messenger RNA
transcripts from the der4.18 Furthermore, activating mutations of
the translocated FGFR3 have been identified in some myeloma
samples, indicating an important role for the FGFR3 signaling
pathway in these cases.14 One such activating mutant of FGFR3 is
known to cause TD II, a severe form of human dwarfism, when the
mutation arises in the germline.21,22 Prior investigation of the role
of FGFR3 in dwarfism has demonstrated that such mutations result
in constitutive activation of the receptor independent of ligand.23,24
This activation leads to phosphorylation and translocation of
STAT1 to the nucleus followed by up-regulation of the cell cycle
regulator p21, resulting in growth arrest in chondrocytes.25 In a
related TD I mutation of FGFR3, STAT1 is also activated, along
BLOOD, 1 FEBRUARY 2000 • VOLUME 95, NUMBER 3
with the MAPK pathway, with a resulting increase in apoptosis
secondary to increased levels of bax and decreased bcl-2.26 The net
effect of these mutations in human chondrocytes is, therefore,
growth arrest and cell apoptosis, explaining the chondrocyte
growth arrest viewed clinically. Clearly, such changes would not
explain why activation of FGFR3 promotes the growth or development of MM cells.
Clues to the latter come from the observation that signaling
through gp130 by LIF in cardiac myocytes up-regulates bcl-xL via
STAT1.27 Because the myeloma-promoting cytokine IL-6 also
signals through gp130 to up-regulate bcl-xL in myeloma cells8 and
because FGFR3 phosphorylates STAT1,25,26 we hypothesized that
FGFR3 could enable cells to bypass gp130 signaling by constitutively up-regulating STATs and thus bcl-xL in myeloma cells. To
examine the consequences of FGFR3 overexpression, IL-6–
dependent murine B9 myeloma cells were engineered to express
either wild-type human FGFR3 or FGFR3-TD containing the
K650E-activating mutation. We observed an increased level of
responsiveness to IL-6 in the resultant cell lines that correlated with
the expression level of FGFR3. Indeed, some cells expressing the
constitutively active FGFR3-TD or high levels of wild-type
FGFR3 exhibited complete independence from IL-6. Consistent
with these results, others have shown that BaF3 cells overexpressing FGFR3 also exhibit sustained proliferation in the absence of
ligand,23 suggesting that, in cytokine-dependent hematopoietic
cells, the net effect of FGFR3 overexpression is to promote rather
than to inhibit cell growth.
The concept that FGFR3 can produce seemingly opposing
signals in chondrocytes and cytokine-dependent BaF3 cells (or as
shown here in IL-6–dependent B9 cells) has precedence, as
cytokine signaling via gp130 may also simultaneously induce
contradictory intracellular signaling pathways.36 The central orchestrator of this gp130-signaling dichotomy appears to be STAT3 in
that phosphorylation of STAT3 in response to IL-6 up-regulates
cyclins and down-regulates p21, resulting in cell cycle transition.36
In contrast, when STAT3 is suppressed, signaling via gp130
can induce up-regulation of p21 and growth arrest, as viewed in
human dwarfism.25
We initially hypothesized that the effect of FGFR3 in conferring
IL-6 independence occurred via enhanced phosphorylation of
STAT1 as previously observed in chondrocytes; however, we found
that expression of FGFR3 in B9 cells did not alter the phosphorylation of STAT1 but did constitutively phosphorylate STAT3. Because STAT3 is implicated in gp130 signaling6 and because gp130
signaling also up-regulates bcl-xL,8,37,38 we next examined bcl-xL
expression. Indeed, B9-TD clones and clones expressing high
levels of wild-type FGFR3 also express a relatively constant
amount of bcl-xL protein regardless of whether IL-6 is present or
absent, and this baseline level is higher than that expressed by
parental B9 cells.
It has previously been reported that the activating TD II
mutation of FGFR3 results in a level of kinase activity of the
receptor higher than can be achieved by maximally stimulating
wild-type FGFR3 with ligand.24 From this observation, we theorize
that the wild-type receptor would activate the same pathways as
FGFR3-TD, but the magnitude of activation is expected to be less.
This theory would appear to be true with our cell lines because
there is a greater proliferative effect of expressing mutant FGFR3
than when the wild-type receptor is maximally stimulated with
aFGF. Indeed, a dose effect of FGFR3 was observed for STAT3
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 1 FEBRUARY 2000 • VOLUME 95, NUMBER 3
ECTOPIC EXPRESSION OF FGFR3
phosphorylation and for IL-6 independence in high- and lowexpressing FGFR3 clones.
Whereas phosphorylation of STAT3 and resulting overexpression of bcl-xL likely explains the reduction in apoptosis of
FGFR3-expressing cells after IL-6 withdrawal, it does not account
for the enhanced proliferative response to IL-6 that was observed.
In this regard, activated FGFR3-expressing cells exhibit an enhanced proliferative response to IL-6 at all concentrations of
cytokine in comparison with controls, and cells expressing the
wild-type protein demonstrate an enhanced proliferative response
when ligand is present. Cells expressing high levels of wild-type
FGFR3 may also show growth in the complete absence of IL-6.
Although ERKs are thought to be involved in the enhanced
proliferative response of IL-6–stimulated myeloma cells6,7 and
FGFR3 has been shown to be capable of phosphorylating ERK1
and ERK2 in other systems,26,39 we were unable to demonstrate
enhanced ERK phosphorylation secondary to FGFR3 overexpression. Similarly, activity of the other MAP kinase family members
SAPK9 and p3840 was not altered by FGFR3 overexpression. The
mechanism of cytokine-enhanced proliferation induced by FGFR3,
therefore, remains unexplained.
Around 25% of myelomas translocate the FGFR3 gene. This
fact alone may confer a survival advantage to B cells, as cells
overexpressing FGFR3 proliferate at a higher rate than do controls
in the presence of ligand. It can be further hypothesized that
selective pressures subsequently result in the acquisition of activating FGFR3 mutations. A report by Fracchiolla et al41 suggests that
FGFR3 mutations occur rarely in MM. However, the authors chose
to analyze DNA rather than cDNA by SSCP, which is likely to
increase the background and decrease the sensitivity of this assay.
Furthermore, DNA analysis for detection of mutations would be
more sensitive if tumor cells were selected or if only samples
997
containing at least 30% tumor cells were analyzed. Because serial
dilutions of DNA from a cell line known to have an FGFR3
mutation, such as KMS11, and of DNA from a cell line with
nonmutated FGFR3 were not performed to determine the minimal
concentration of tumor DNA required to detected the abnormal
migrating band by SSCP, the true incidence of FGFR3 mutation
remains unknown.
In conclusion, FGFR3-overexpressing myeloma cells proliferate in the absence of IL-6, exhibit an enhanced proliferative
response in the presence of IL-6, and exhibit decreased apoptosis
on IL-6 withdrawal. Cells overexpressing FGFR3 phosphorylate
STAT3 and up-regulate bcl-xL expression, thus inhibiting apoptosis
following cytokine withdrawal. The mechanism of FGFR3enhanced proliferation is not yet elucidated.
We speculate that an initial translocation of FGFR3 into the IgH
chain switch region in a germinal center B cell likely provides the
affected B cells with enhanced growth potential, with signaling
occurring through both the IL-6 receptor and FGFR3. Further,
activating mutations of FGFR3 would enable the cells to entirely
escape the need for ligand stimulation, whether by IL-6 or aFGF,
and would result in enhanced proliferation and a competitive
advantage over other B cells. These findings provide a plausible,
albeit partial, explanation for the myeloma-promoting properties of
FGFR3 and provide a basis for the development of therapies
targeting this pathway.
Acknowledgments
We are grateful to Dr Brent Zanke and Dr Ian Dubé for advice, as
well as to Nathan Faliconi, Fawzy Saad, Darrin Cappe, Meenakshi
Bali, and Christine Dodgson for technical assistance.
References
1. Malpas J, Bergsagel DE, Kyle RA. Myeloma: Biology and Management. Oxford, England: Oxford
University Press; 1998.
2. Klein B, Zhang X, Lu Z, Bataille R. Interleukin-6 in
human multiple myeloma. Blood. 1995;85:863872.
3. Sabourin LA, Hawley RG. Suppression of programmed death and G1 arrest in B-cell hybridomas by interleukin-6 is not accompanied by altered gene expression of immediate early
response genes. J Cell Physiol. 1990;145:564574.
4. Kawano M, Hirano T, Matsuda T, et al. Autocrine
generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature. 1988;332:83-85.
5. Berger LC, Hawley RG. Interferon-␤ interrupts
interleukin-6-dependent signaling events in myeloma cells. Blood. 1997;89:261-271.
6. Fukada T, Hibi M, Yamanaka Y, et al. Two signals
are necessary for cell proliferation induced by a
cytokine receptor gp130: involvement of STAT3 in
anti-apoptosis. Immunity. 1996;5:449-460.
7. Ogata A, Chauhan D, Teoh G, et al. IL-6 triggers
cell growth via the ras-dependent mitogen-activated protein kinase cascade. J Immunol. 1997;
159:2212-2221.
8. Schwarze MMK, Hawley RG. Prevention of myeloma cell apoptosis by ectopic bcl-2 expression
or interleukin 6-mediated up-regulation of bcl-xL.
Cancer Res. 1995;55:2262-2265.
9. Xu F, Sharma S, Gardner A, et al. Interleukin-6induced inhibition of multiple myeloma cell apoptosis: support for the hypothesis that protection is
mediated via inhibition of the JNK/SAPK pathway.
Blood. 1998;92:241-251.
10. Bergsagel PL, Chesi M, Nardini E, Brents LA,
Kirby SL, Kuehl WM. Promiscuous translocations
into immunoglobulin heavy chain switch regions
in multiple myeloma. Proc Natl Sci Acad U S A.
1996;93:13,931-13,936.
11. Iida S, Rao PH, Butler M, et al. Deregulation of
MUM1/IRF4 by chromosomal translocation in
multiple myeloma. Nat Genet. 1997;17:226-230.
12. Chesi M, Bergsagel PL, Brents LA, Smith CM,
Gerhard DS, Kuehl WM. Dysregulation of cyclin
D1 by translocation into an IgH gamma switch
region in two multiple myeloma cell lines. Blood.
1996;88:674-681.
13. Chesi M, Bergsagel PL, Shonukan OO, et al. Frequent dysregulation of the c-maf proto-oncogene
at 16q23 by translocation to an Ig locus in multiple myeloma. Blood. 1998;91:4457-4463.
14. Chesi M, Nardini E, Brents LA, et al. Frequent
translocation t(4;14)(p16.3;q32.3) in multiple myeloma is associated with increased expression
and activating mutations of fibroblast growth factor receptor 3. Nat Genet. 1997;16:260-264.
15. Avet-Loiseau H, Li JY, Facon T, et al. High incidence of translocations t(11;14)(q13;q32) and
t(4;14)(p16;q32) in patients with plasma cell malignancies. Cancer Res. 1998;58:5640-5645.
16. Sawyer JR, Lukacs JL, Munshi N, et al. Identification of new nonrandom translocations in multiple
myeloma with multicolor spectral karyotyping.
Blood. 1998;92:4269-4278.
17. Nishida K, Tamura A, Nakazawa N, et al. The Ig
heavy chain gene is frequently involved in chro-
mosomal translocations in multiple myeloma and
plasma cell leukemia as detected by in situ hybridization. Blood. 1997;90:526-534.
18. Chesi M, Nardini E, Lin RSC, Smith KD, Kuehl
WM, Bergsagel PL. The t(4;14) translocation in
myeloma dysregulates both FGFR3 and a novel
gene, MMSET, resulting in IgH/MMSET hybrid
transcripts. Blood. 1998;92:3025-3034.
19. Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder
P. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell. 1996;84:911921.
20. Colvin JS, Bohne BA, Harding GW, McEwan DG,
Ornitz DM. Skeletal overgrowth and deafness in
mice lacking fibroblast growth factor receptor 3.
Nat Genet. 1996;12:390-397.
21. Tavormina PL, Shiang R, Thompson LM, et al.
Thanatophoric dysplasia (types I and II) caused
by distinct mutations in fibroblast growth factor
receptor 3. Nat Genet. 1995;9:321-328.
22. Bonaventure J, Rousseau F, Legeai-Mallet L, Le
Merrer M, Munnich A, Maroteaux P. Common mutations in the fibroblast growth factor receptor 3
(FGFR 3) gene account for achondroplasia, hypochondroplasia, and thanatophoric dwarfism.
Am J Med Genet. 1996;63:148-154.
23. Naski MC, Wang Q, Xu J, Ornitz DM. Graded activation of fibroblast growth factor receptor 3 by
mutations causing achondroplasia and thanatophoric dysplasia. Nat Genet. 1996;13:233-237.
24. Webster MK, D’Avis PY, Robertson SC, Donoghue DJ. Profound ligand-independent kinase
activation of fibroblast growth factor receptor 3 by
the activation loop mutation responsible for a le-
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
998
BLOOD, 1 FEBRUARY 2000 • VOLUME 95, NUMBER 3
PLOWRIGHT et al
thal skeletal dysplasia, thanatophoric dysplasia
type II. Mol Cell Biol. 1996;16:4081-4087.
25. Su WS, Kitagawa M, Xue N, et al. Activation of
Stat1 by mutant fibroblast growth-factor receptor
in thanatophoric dysplasia type II dwarfism.
Nature. 1997;386:288-292.
26. Legeai-Mallet L, Benoist-Lasselin C, Delezoide A,
Munnich A, Bonaventure J. Fibroblast growth factor receptor 3 mutations promote apoptosis but
do not alter chondrocyte proliferation in thanatophoric dysplasia. J Biol Chem. 1998;273:13,00713,014.
27. Fujio Y, Kunisada K, Hirota H, Yamauchi-Takihara
K, Kishimoto T. Signals through gp130 upregulate
bcl-x gene expression via STAT1-binding cis-element in cardiac myocytes. J Clin Invest. 1997;99:
2898-2905.
28. Hawley RG, Lieu FHL, Fong AZC, Goldman SJ,
Leonard JP, Hawley TS. Retroviral vectors for
production of interleukin-12 in the bone marrow to
induce graft-verus-leukemia effect. Ann N Y Acad
Sci. 1996;795:341-345.
29. Miller AD, Buttimore C. Redesign of retrovirus
packaging cell lines to avoid recombination leading to helper virus production. Mol Cell Biol. 1986;
6:2895-2902.
30. Markowitz D, Goff S, Bank A. A safe packaging
line for gene transfer: separating viral genes on
two different plasmids. J Virol. 1988;62:11201124.
31. Harris JF, Hawley RG, Hawley TS, CrawfordSharpe GC. Increased frequency of both total
and specific monoclonal antibody producing hybridomas using a fusion partner that constitutively
expresses recombinant IL-6. J Immunol Methods.
1992;148:199-207.
32. Branch DR, Mills GB. pp60c-src expression is
induced by activation of normal human T lymphocytes. J Immunol. 1995;154:3678-3685.
33. Ho JMY, Beattie BK, Squire JA, Frank DA, Barber
DL. Fusion of the ets transcription factor TEL to
Jak2 results in constitutive Jak-Stat signaling.
Blood. 1999;12:4354-4364.
34. Pine R, Canova A, Schindler C. Tyrosine phosphorylated p91 binds to a single element in the
ISGF2/IRF-1 promoter to mediate induction by
IFN alpha and IFN gamma, and is likely to autoregulate the p91 gene. EMBO J. 1994;13:158167.
35. Jaster R, Zhu Y, Pless M, Bhattacharya S,
Mathey-Prevot B, D’Andrea AD. JAK2 is required
for induction of the murine DUB-1 gene. Mol Cell
Biol. 1997;17:3364-3372.
36. Fukada T, Ohtani T, Yoshida Y, et al. STAT3 orchestrates contradictory signals in cytokine-induced G1 to S cell-cycle transition. EMBO J.
1998;17:6670-6677.
37. Catlett-Falcone R, Landowski TH, Oshiro MM, et
al. Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity. 1999;10:105-115.
38. Zushi S, Shinomura Y, Kiyohara T, et al. STAT3
mediates the survival signal in oncogenic rastransfected intestinal epithelial cells. Int J Cancer.
1998;78:326-330.
39. Kanai M, Goke M, Tsunekawa S, Podolsky DK.
Signal transduction pathway of human fibroblast
growth factor receptor 3: identification of a novel
66-kDa phosphoprotein. J Biol Chem. 1997;272:
6621-6628.
40. Tan Y, Rouse J, Zhang A, Cariati S, Cohen P,
Comb MJ. FGF and stress regulate CREB and
ATF-1 via a pathway involving p38 MAP kinase
and MAPKAP kinase-2. EMBO J. 1996;15:46294642.
41. Fracchiolla NS, Luminari S, Baldini L, Lombardi L,
Maiolo AT, Neri A. FGFR3 gene mutations associated with human skeletal disorders occur rarely in
multiple myeloma. Blood. 1998;92:2987-2989.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2000 95: 992-998
Ectopic expression of fibroblast growth factor receptor 3 promotes
myeloma cell proliferation and prevents apoptosis
Elizabeth E. Plowright, Zhihua Li, P. Leif Bergsagel, Marta Chesi, Dwayne L. Barber, Donald R. Branch,
Robert G. Hawley and A. Keith Stewart
Updated information and services can be found at:
http://www.bloodjournal.org/content/95/3/992.full.html
Articles on similar topics can be found in the following Blood collections
Neoplasia (4182 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.