* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download floral and vegetative morphogenesis in california
Survey
Document related concepts
Transcript
Int. J. Plant Sci. 166(4):537–555. 2005. Ó 2005 by The University of Chicago. All rights reserved. 1058-5893/2005/16604-0001$15.00 FLORAL AND VEGETATIVE MORPHOGENESIS IN CALIFORNIA POPPY (ESCHSCHOLZIA CALIFORNICA CHAM.) Annette Becker,1 ,* Stefan Gleissbergy, and David R. Smyth* *School of Biological Sciences, Monash University, Melbourne, Victoria 3800, Australia; and yInstitute of Systematic Botany, Johannes Gutenberg-Universität, Bentzelweg 9a, 55099 Mainz, Germany For studies of the evolution of development in angiosperms, early-diverging eudicot taxa are of particular interest for comparisons with established core eudicot model plants, such as Arabidopsis. Here we provide a detailed description of shoot and floral development of the basal eudicot California poppy (Eschscholzia californica). Rosette formation in the vegetative phase is accompanied by increased leaf complexity and shoot apex size. The flowering phase is characterized by internode elongation, formation of dissected cauline leaves, terminal flowers, and basipetal inflorescence branching. For developing flowers and fruits, we have defined 14 stages according to important landmark events, from inflorescence primordium initiation through seed dispersal. Floral organ initiation, morphogenesis, increase in floral meristem size, and the surface structure of mature floral organs are recorded in detail. The duration of the later floral stages, as well as the path of pollen tube growth in the gynoecium, is documented. Comparison of California poppy floral development with that of Arabidopsis indicates considerable differences in terms of organ fusion, whorl proliferation, and variability of size and organ number between the two species. Transitions in meristem identity from germination to floral organogenesis were monitored using expression of the developmental control gene EcFLO, the Eschscholzia ortholog of FLORICAULA/LEAFY. We found that the pattern of expression of EcFLO in the flanks of the shoot apex is maintained from late embryogenesis to flower initiation, indicating a continuous role for this gene in meristem function. As flower organs develop, EcFLO expression becomes more restricted to petal and stamen primordia. Development of the gynoecium occurs without EcFLO expression, indicating that EcFLO may not be necessary for the activation of C-class genes. Keywords: Eschscholzia californica, Papaveraceae, flower development, vegetative development, basal eudicot, FLORICAULA expression. Introduction A number of reasons in addition to its phylogenetic position favor California poppy as a model for comparative developmental genetics: (i) it is an easily cultivated annualto-biennial species; (ii) it is diploid, with a genome size only ca. 6.5 times larger than that of Arabidopsis (Bennett and Smith 1976); (iii) a large number of expressed sequence tags from Eschscholzia have been sequenced by the Floral Genome Project and are publicly available (Soltis et al. 2002); and, most important, (iv) California poppy is amenable to transgenic manipulation allowing characterization of gene functions (Park and Facchini 2000). California poppy is a qualitative long-day plant (Nanda and Sharma 1976) and is native in western North America from the Columbia River to Baja California and from the Pacific Coast eastward into the Great Basin. Within this large area it grows in a range of different habitats, spanning from sea level to 2000 m in altitude and from well-drained soils of dunes to alluvial fans, river terraces, and hillsides. It has been introduced to Chile, New Zealand, Tasmania, and mainland Australia, where it has become naturalized (Cook 1962). Here we provide descriptive baselines for shoot, inflorescence, and flower development in California poppy to aid ongoing and future developmental genetic work with this species. Development of the dissected leaves has been The striking diversity of vegetative and floral morphologies encountered in angiosperms raises the question of how development of these traits evolved. Extensive knowledge about the control of development has been obtained in core eudicot model species such as Arabidopsis thaliana (Brassicaceae), Antirrhinum majus (Scrophulariaceae), and Petunia hybrida (Solanaceae). However, these plants represent examples from more advanced orders of rosids (Brassicales) and asterids (Lamiales and Solanales) in the angiosperm phylogenetic tree. To understand evolutionary processes that have led to eudicot diversification, as well as mechanisms that govern development in all angiosperms, it will be vital to study the molecular bases of development of species with a phylogenetically more basal position. California poppy (Eschscholzia californica Cham.), a member of the Papaveraceae (order Ranunculales), is well suited to serve as a model plant for earlydiverging eudicots. 1 Author for correspondence; e-mail annette.becker@flower-evodevo .com. Manuscript received November 2004; revised manuscript received January 2005. 537 538 INTERNATIONAL JOURNAL OF PLANT SCIENCES described elsewhere (Gleissberg 2004). Development of the primary (seedling) shoot through rosette establishment, inflorescence and flower formation, and subsequent inflorescence branching is characterized, including leaf heteroblasty and enlargement of the shoot apical meristem. We address distinct morphological features of California poppy that contrast with those of Arabidopsis, such as phenotypic plasticity, terminal flowers, the occurrence of complex dissected leaves in the flowering region, floral organ fusion, the sequence of flower organ initiation and multiplication of floral organ whorls, and the common and unique properties of the gynoecium. Inflorescence meristem formation and complete flower development until the release of seeds are characterized by scanning electron microscopy and light microscopy, including a documentation of mature floral organ surface morphology. Landmarks are used to define stages of flower development that will be helpful in aligning developmental observations and to allow interpretation of gene expression patterns and defects in California poppy lines generated by transgenic approaches. For some of the later developmental stages, an approximate time line is given. In addition, we provide expression data of the developmental control gene ESCHSCHOLZIA CALIFORNICA FLORICAULA (EcFLO) in vegetative, inflorescence, and floral meristems. FLORICAULA/LEAFY-like genes are important developmental regulators with diverse roles in different species. Expression of EcFLO in vegetative meristems and during leaf development indicated a role in leaf dissection (Busch and Gleissberg 2003). Here we show that EcFLO exhibits a characteristic and constant pattern of expression through various phases of shoot apical meristem development and identity, indicating a general role in shoot apex maintenance in both vegetative and reproductive meristems. EcFLO expression during flower development is discussed with respect to the identity of floral organs. Comparisons of the molecular basis of California poppy development with that of model species from the rosids and asterids, as well as within the diverse Ranunculales, will help to decipher the evolution of developmental pathways on different systematic scales. Material and Methods Plants and Growth Conditions For analysis of flower development, Eschscholzia californica Cham. cv. Aurantiaca Orange King seeds were purchased from B & T World Seeds, Aigues-Vive, France, and cultivated in pots of 6 cm diameter using standard potting mix. After sowing, the seeds were kept at 4°C for 3 d to improve the germination rate and synchrony of development. The plants were then grown under natural daylight supplemented by constant light provided by cool-white fluorescent tubes at ca. 25°C. Under these conditions, plants flowered early, although their vigor was somewhat compromised. For analysis of heteroblasty and gene expression, seeds of a wild-type strain of E. californica were purchased from Larner Seeds, Bolinas, California. Seeds were sown in Jiffy pots at the end of March and later planted in the field at the Botanical Garden of the University of Mainz, Germany. For in situ hybridization and SEM analysis, shoots were harvested and fixed at different stages of vegetative and floral development, as described below. Germinating embryos were investigated using material sown on agar plates supplemented with Gamborg’s B5 medium. Analysis of Heteroblasty To assess leaf form change along the primary shoot, the degree of dissection (first-order and total number of segments) and the lengths of leaf blade, petiole, and whole leaf were documented in five plants. Fully grown foliage leaves were individually and carefully removed from growing plants just before senescence to allow undisturbed further development, and measurements were taken on a light box after leaves were dried in a paper stack. SEM and Light Microscopy Fresh floral buds and mature flowers were vacuum infiltrated and fixed in 5% glutaraldehyde in 0.03 M Pipes buffer at pH 6.8–7.0 for 2 h. Subsequently, the material was postfixed for 2 h in 1% aqueous osmium tetroxide solution, dehydrated by passing it through an ethanol series, and criticalpoint dried using liquid CO2. The specimens were mounted on stubs, and several outer-whorl organs were removed when necessary. The buds were then gold-coated, and SEM was performed with a Hitachi S570 microscope at 10–15 kV for floral stages and 15–30 kV for mature organ surface structures. Measurements of apex size on SEM images were done as described by Gleissberg (2004). For light microscopy, the buds were vacuum infiltrated in FAA (2% formaldehyde, 5% acetic acid, 60% ethanol), fixed for 24 h at 4°C, and dehydrated in an ethanol series. Subsequently, they were embedded in Paraplast Plus, sectioned, dewaxed, and stained overnight in 1% safranin in 30% ethanol and then for 3 min in 0.2% alcoholic fast green (Clark 1981). Preparation of the tissue for fluorescence microscopy was carried out in the same way, except that the sections were stained overnight in 0.01% aniline blue in 0.15 M sodium phosphate buffer at pH 10 (Clark 1981). All photographs were processed for publication using Adobe Photoshop Elements and Corel Draw 10. Measurements on in situ sections were done using Photoshop 7.0. In situ Hybridization Tissue fixation, Paraplast embedding, and detection of EcFLO transcripts on serial sections were done as described by Zachgo (2002) and Busch and Gleissberg (2003). For in vitro transcription of the probe, a PCR fragment was amplified from a plasmid containing the EcFLO sequence (GenBank accession number AY188789) using the forward primer EcL01F (AGGCAGGAGCTAGTTACATAAACAAGC) and a T3 primer as reverse primer, transcribed with T3 RNA polymerase. The digoxigenin-labeled antisense probe covered ca. 500 bps in the third exon and 39 untranslated region and was used without hydrolysis. Hybridization with a sense probe gave no specific signal (not shown; Busch and Gleissberg 2003). BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT Results California Poppy Development until Flowering After germination, two deeply lobed cotyledons emerge from the seed. The shoot apical meristem (SAM) then generates between 13 and 25 highly dissected silver green leaves arranged in an alternate fashion, forming a rosette. In continuous light conditions, this takes at least 6 wk. With the onset of shoot elongation, internodes of the younger leaves expand, marking the conversion of the SAM into an inflorescence meristem. Cauline leaves lower on the stem are arranged alternately, as in the rosette. The last two leaves formed below the flower are mostly arranged in a subopposite manner, forming a pseudowhorl (fig. 1B, 1C). All leaves within the flowering region of the shoot remain highly dissected, and no reduced bractlike leaves are formed (i.e., it is a frondose inflorescence; Weberling 1989). After formation of the uppermost cauline leaves, the SAM is transformed into a terminal flower meristem, resulting in a single bud (fig. 1A–1C). Before the apical flower opens, secondary inflorescence meristems develop in the axils of one or both leaves immediately below the primary flower. These meristems, in turn, usually generate two opposite cauline leaves and then a terminal secondary flower. Further inflorescence meristems may then develop in the axils of the leaves subtending these secondary flowers, ultimately generating tertiary flowers, and so on, thus resulting in a compound cymose inflorescence (fig. 1A– 1D). Most flowering shoots examined in field-grown plants (66%, N ¼ 57) showed two subopposite cauline leaves subtending each flower, but variations were common. Often, a third cauline leaf joined in the pseudowhorl (28%), and one of them was sometimes only rudimentary (fig. 1B). Rarely, we observed a single cauline leaf below a flower. In addition, in 49% of cases only one axillary inflorescence meristem developed from the pseudowhorl; in 42% there were two. Rarely, three or no axillary inflorescence shoots developed. When there were two, the upper one was always more developmentally advanced than the lower one (fig. 1B, 1C). Further branching of the inflorescence occurs in basipetal direction along the primary shoot. These basal side shoots produce one to several alternate cauline leaves before they generate paired cauline leaves and ultimately a terminal flower. Higher-order inflorescence meristems then arise in the axils of these cauline leaves as before (fig. 1A, 1D). Heteroblastic Changes and Shoot Apex Corroboration Leaf size and form along the primary shoot show considerable heteroblasty between the cotyledons and the terminal flower (fig. 2A, 2B). Although we observed large individual differences in the measured parameters, particularly at higher nodes, some general patterns are evident. Both leaf length and degree of dissection increased during the vegetative phase but declined again after the transition to flowering. The maximum degree of dissection was reached at higher nodes (later in development) than the maximum leaf size (fig. 2A). Primary leaves started with two or three main acropetal segments and two to seven total segments on each side (four to 14 per leaf). The observed maximum number of lateral 539 pinnae ranged between five and seven and that of total segments between 37 and 98 on each side (84–196 per leaf). Leaf length increased for several nodes, at least until node 7. Typically, the cauline leaves were reduced, compared to leaves at a late rosette stage, but they were still highly dissected. They exhibited only a slight decrease, if at all, in the number of main segments, but reduction was more obvious for the total numbers of segments. The last leaf beneath the terminal flower had between 24 and 74 segments on each side (48 and 148 per leaf) (e.g., fig. 2B). Dynamics of SAM size are illustrated in figure 2C. Because of leaf initiation, SAM size changes periodically from plastochron to plastochron, resulting in a wide range of values for single age stages. In addition, differences between individual plants may add to SAM size variations. Remarkably, we found that SAM diameters vary approximately within the same range (between ca. 70 and 185 mm) from germination through a considerable time of postembryonic development (at least 1 mo) (fig. 2C, left). Axillary inflorescence meristems had SAM diameters similar to vegetative meristems. Pronounced increase of SAM diameter was only observed after the transition to floral identity. On the other hand, values obtained for SAM height (fig. 2C, right) indicate that a moderate increase of SAM size in this dimension already occurs during vegetative development, with a further pronounced elevation of the apical dome upon flower initiation. Flower Structure The California poppy flower consists of two sepals, four free petals, four to six or more whorls of stamens, and two carpels united in a gynoecium (fig. 1E, 1F). The sepals are fused into a caplike structure that is pushed off by the elongating petals during the last stage of bud development. The petals are bright orange in color, darker at the center of the flower and lighter at its periphery. They are 1–3 cm long and wide, depending on the condition of the plant (fig. 1E). The petals are arranged in two whorls, with the two medial petals occupying the inner and the two lateral petals the outer petal whorl. Petals and stamens are attached to the top of a floral tube, which surrounds the bottom quarter of the ovary, forming a perigynous flower (fig. 1F). A distinct rim encircles the floral tube immediately below where the sepals are inserted. Nectaries are not present. The stamens consist of a short filament and a long anther, which is bilobed and bisporangiate. The surface of the lower part of the filament is darkly pigmented in many flowers. Stamens are numerous, with the number per flower observed to vary between 18 and 34. There are usually four stamens in the first whorl and six in each subsequent whorl. Many flowers counted had either 22 (19%) or 28 (26%) stamens, which corresponds to four and five complete whorls. The gynoecium consists of two completely fused carpels, with a large ovary, a very short style, and four long stigmatic protrusions covered with papillae. The ovary is superior, as its basal region is surrounded by the floral tube but not joined to it (fig. 1F). Within the locule of the ovary, two parietal placentae are lined with a layer of papilla-like cells, and two rows of ovules are attached to each placenta. 540 INTERNATIONAL JOURNAL OF PLANT SCIENCES Early Stages of Flower Development (Stages 1–6) Fig. 1 California poppy morphology. A, California poppy plant before opening of the first flower (primary flower, pf ). One secondary flower (sf ) with its own two cauline leaves has developed in the axil of a cauline leaf of the primary shoot immediately below the primary flower. Another whole secondary inflorescence (si) has arisen in the axil of the cauline leaf further down. This plant is ca. 25 cm tall. B–C, Close-ups of pairs of lateral inflorescence shoots within axils of the uppermost cauline leaves (cl). These leaves are inserted in subopposite orientation on the shoot, in contrast to cauline leaves farther down that arise with alternate orientation. Development of the axillary bud of the upper cauline leaf (on the right in each case) is accelerated. Note that in B, a rudimentary third leaf has developed in the pseudowhorl. D, Diagram of the California poppy inflorescence structure. Dark green, rosette leaves; light green, cauline leaves; red, primary flower; orange, secondary flowers; yellow, tertiary flowers. Arrows show newly arising inflorescence shoots. E, Top view of a California poppy flower at anthesis. The sepals have already abscised, and the stigma (sa) extends above the stamens (st); petals (pe) are indicated. F, Lateral view of a longitudinal section of a California poppy flower at the beginning of pollen shed from the Within the flower developmental stages of Buzgo et al. (2004), other significant events have been identified (table 1). Descriptions are based on observations of secondary inflorescence shoots. Stage 1 begins with conversion of the primary SAM into an inflorescence meristem (not shown) or the formation of a new inflorescence meristem in the axil of a cauline leaf (fig. 3A). Inflorescence meristems increase in size by lateral outgrowth and sequentially form two (sometimes one or three) lateral cauline leaf primordia on their flanks. The first leaf primordium is visible as a small protrusion when the lateral diameter of the axillary inflorescence meristem is ca. 100 mm (fig. 3A). The second cauline leaf appears when the inflorescence meristem is ca. 160 mm in lateral diameter and the central dome is ca. 80 mm in diameter (not shown). Remarkably, development of the inflorescence meristems in the axils of two paired cauline leaves is antipodal, as the earlier and larger leaf of the two paired primordia point in opposite directions (fig. 3A, 3E). Once the two cauline leaves are formed, the apical dome above them converts into a floral meristem. When this reaches ca. 100 mm in diameter (fig. 3B), it is hemispherical in shape and begins to become separate from the two leaf primordia. At that time, new axillary inflorescence meristems may already appear in the cauline leaf axils (fig. 3C). The first appearance of the sepal ring primordium defines the beginning of stage 2 (fig. 3D). The central region of the floral meristem is still hemispherical in shape and ca. 130 mm in diameter. Sepals arise to form a ring-shaped structure encircling the floral dome. Later, it is clear that there are two primordia, but initially the height of the rim is not obviously bipartite around the circumference of the bud. At this point the floral bud (above the cauline leaves) can be divided horizontally into a pedicel zone at the bottom, the sepal zone in the middle, and the floral dome on top (fig. 3D). During stage 2, most of the increase in size of the floral bud can be attributed to the outgrowth of the sepal primordia, as the floral dome does not increase significantly in size (its lateral diameter has only increased from 130 to ca. 135 mm by the end of stage 3). At this stage it is clear that development of the flower buds within the two opposite leaves is not synchronous, with the lower flower lagging considerably behind the upper one (fig. 3E). Stage 3 begins with the appearance of two lateral petal primordia as protrusions from the floral apex, with the medial petals initiating soon afterward. The axis connecting the two lateral petal primordia is displaced by an angle of 30° in relation to the two cauline leaves (fig. 3F). Subsequently, the petals are separated from the floral apex by grooves. The lateral petal primordia are narrower, and the medial petal primordia are relatively wide. During this stage, the floral dome increases stamens (st). Pollen grains have not yet attached to the four long stigmatic extensions (sa; front stigmatic branch has been removed). The short style is indicated (sy). The lower quarter of the ovary (o) is surrounded by the floral tube (ft). A protruding rim (r) surrounds the outside of the top of the floral tube. BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT Fig. 2 Leaf heteroblasty and change in size of the shoot apex. A, Heteroblasty of the 19 leaves of a typical primary shoot between cotyledons (left) and the terminal flower (right). Primary leaves, but also those preceding the terminal flower, are smaller and less complex. Open diamonds, number of primary lateral segments (pinnae) of one leaf half; filled diamonds, total number of segments on one leaf half including leaf tip; solid line, leaf size in centimeters. B, Examples of leaves, showing the range of complexity within a heteroblastic series. The large climax leaf is much more complex than the first three foliage leaves shown from right to left. C, Diameter (left) and height (right) of the shoot apical meristem (SAM) during vegetative development up to flowering. Measurements are, from left to right, primary shoots in germinating seeds (G), SAMs 10 (10d) and 30 d (30d) after germination, lateral inflorescence meristems (IFM), and stage 2 flowers (FM2). Individual values (diamonds) are connected by lines representing the observed range. in size laterally, leading to an elliptical shape (fig. 3F). By mid–stage 3 it is ca. 200 mm in lateral diameter, ca. 150 mm in medial diameter, and ca. 120 mm in height. At first, the sepal primordial ring is relatively shallow at the positions where the lateral petals arise, indicating that there are two sepals. The sepal primordia are ca. 30 mm thick, and they grow rapidly and evenly around the floral apex, forming a tube. They then curve inward to cover the floral apex in a bowl-shaped manner, leaving a small medial opening (not shown). Very shortly after the initiation of the petal primordia, stage 4 begins when four stamen primordia initiate in positions between and internal to the petal primordia (fig. 3G). Subsequently, up to four additional whorls of stamens, each usually containing six stamen primordia, arise centripetally. In the second stamen whorl, single primordia are formed opposite the two lateral petal primordia, whereas paired stamen primordia fill the gap opposite each of the two wider medial petal primordia (fig. 3H). Next, six stamen primordia arise in whorl 3 in positions alternate with those in the second stamen whorl (fig. 3H). While the innermost stamen primordia 541 are still being initiated, the outermost primordia are already well formed (figs. 3H, 4A). Sometimes naturally occurring variability can be observed in stamen number (see above). This is characterized by the lack of regular stamen formation, especially in the inner whorls, and results in disruption of the usual twofold axis of symmetry (fig. 3I). At the end of stage 4, the bud has reached a lateral diameter of ca. 370 mm. During stage 5, considerable changes occur in the morphology of the central part of the developing bud. In the beginning, the floral meristem resolves into a small dome separate from the stamen primordia, from which the gynoecium develops (figs. 3H, 4A). Stamen primordia are still being generated outside this dome. Once the gynoecial primordium starts elongating with vertical edges, it also develops an indentation in its center (figs. 3J, 4B). During stage 5, the perianth organs are developing. The fused sepals, enclosing the bud fully from the end of stage 4, elongate lengthwise, leaving a hollow cavity up to 550 mm high above the gynoecium and stamen primordia. The sepals do not fuse completely at the tip of the bud, leaving a narrow, open slit (fig. 4B). No significant longitudinal growth is detectable in the petals during stage 5 (fig. 4A, 4B). At the end of stage 5, the bud’s lateral diameter is ca. 650 mm. The sepals have grown to a thickness of ca. 40–70 mm (fig. 4B). The oval stamen primordia of the first stamen whorl are ca. 60 mm wide, while the primordia of the innermost whorl of stamens have just initiated (fig. 3J). The beginning of stage 6 is characterized by the appearance of microsporangia in the outermost stamen primordia. The anthers adopt a concave profile (viewed from the outside), corresponding with the appearance of locules and locular ridges (fig. 3K; fig. 4C, 4D). By the end of stage 6, the stamens in all whorls have developed locules (fig. 4D). The stamens grow laterally, and those in the outer whorls are longer than the inner ones. The stamens also become constricted at their base (fig. 3L). The gynoecium continues to grow vertically but is shorter than the outer stamens. Ovules have not yet initiated, but the two placental regions are bulging inward, resulting in a gynoecium that is shaped like a hollow tube with a very narrow center (fig. 4C, 4D). The bud has now grown to a diameter of ca. 1.25 mm. The lengthwise growth of the gynoecium and stamens begins to fill the cavity formed by sepal extension. In comparison, the petals do not show a significant increase in length (fig. 4C). Later Stages of Flower Development to Anthesis (Stages 7–11) Stage 7 begins with the initiation of two files of ovule primordia as small protrusions from each of the two placental regions within the gynoecium (fig. 4E). At this stage, the gynoecium increases in lateral diameter to ca. 0.5 mm (from ca. 350 mm in stage 6) to harbor the emerging ovule primordia. The connectives of the stamens begin to show vasculature (fig. 4E). In the outer stamen whorls, the locular tissue differentiates into compact sporogenous tissue in the center and a surrounding single layer of tapetal cells. In the innerwhorl stamens, sporogenous cells have not yet developed. Because of the start of pedicel elongation, the bud is no longer constricted to the space between the cauline leaf and pedicel INTERNATIONAL JOURNAL OF PLANT SCIENCES 542 Table 1 Landmarks of Floral Development (according to Buzgo et al. 2004) of Eschscholzia californica That Divide Floral and Fruit Development into 14 Stages Stage, developmental landmark Additional developmental events 1, Inflorescence meristem forms Inflorescence meristem emerges; grooves separate the floral meristem from two cauline leaf primordia; secondary inflorescence meristems may appear Sepal primordium encircles the floral primordium Lateral petal primordia emerge; medial petal primordia emerge Four stamen primordia initiate in the first stamen whorl; six stamen primordia initiate in the subsequent 3–4 whorls Continuous stamen initiation; gynoecium becomes indented Stamens stalked at their base; locular ridges Male sporogenous tissue forms Ovary valves develop ridges; first (inner) ovule integument initiates; second (outer) ovule integument initiates; pollen grains mature; megaspore mother cell differentiates Embryo sac development occurs (may continue into stage 10) Flower opens; stamens extend above stigma Pollen shed; gynoecium becomes receptive; stigma extends above anthers; petals and stamens wither Capsule elongates Capsule dries out 2, Sepal primordium emerges 3, Petal primordia emerge 4, First whorl of stamens initiates 5, Carpel initiation 6, Microsporangia initiate 7, Ovule initiation 8, Male meiosis 9, Female meiosis 10, Sepal cap abscises 11, Anthesis 12, Petals and stamens abscise 13, Capsule fully extended 14, Valves separate from dry capsule and seeds fall of the primary flower, and its originally oval shape becomes more rounded (fig. 4E, 4G). At the end of stage 7, the bud is ca. 2.0 mm in diameter. Stage 8 is characterized by the commencement of meiosis in the outer-whorl stamens. This occurs relatively rapidly, and tetrads of microspores soon appear (fig. 4F). Tapetal tissue and sporogenous cells have also differentiated in the inner stamens by now. The anthers elongate substantially during this stage, whereas the filaments shows no significant lengthwise growth. At the beginning of stage 8, the gynoecium is ca. 0.5 mm wide. Each carpel develops five longitudinal ridges, three medial and two lateral, resulting in a 10-pointed star when the gynoecium is viewed in cross section (fig. 4F). The gynoecium is significantly shorter than even the innermost stamens, and its base is surrounded by a floral tube (fig. 4G). Petals and stamens are attached to this floral tube, which encloses about one-quarter of the gynoecium (fig. 4H). Inside the ovary, the ovule primordia elongate and bend sideways into the lateral part of the locule of the ovary (fig. 4F). Next, the first (inner) ovule integuments initiate as small bulges approximately between the middle and the top third of the ovule primordium. The ovules increase in length and di- Observed range of bud diameters during stage Method of observation 80–120 mm SEM 130–190 mm SEM 170–240 mm SEM 250–370 mm SEM, sections 390–650 mm SEM, sections 1–1.25 mm 1.65–2.25 mm 2.3–2.8 mm 3.5–5.5 mm SEM, sections Sections Sections Sections, macroscopic Macroscopic Macroscopic Macroscopic Macroscopic Macroscopic ameter and consist of densely packed small cells (fig. 5A). The gynoecium continues its medial and lateral expansion and is now ca. 0.8 mm wide. As this stage progresses, tetrads appear in all stamen whorls (fig. 4F). In the outer-whorl stamens the tapetum layer begins to disintegrate. It becomes apparent now that the inner-whorl anthers will not grow in diameter to match those in the outer whorl but will remain at about onethird of their size (fig. 4E). The petals have enlarged laterally and show several differentiated vascular bundles. Later in this stage, the second (outer) ovule integument initiates. On the adaxial side of the ovule, the second integument elongates and will eventually cover the entire nucellus. On the abaxial side, the second integument initiates as a small protrusion (about two or three cells thick) but then fuses to the funiculus, which has elongated to approximately the same length as the nucellus, including integuments. Associated with the unequal growth of the second integument, the ovules now appear anatropous and curve back to the placenta (fig. 5B). The gynoecium has now grown to a lateral diameter of ca. 1.2 mm, and a large cavity has appeared within the ovary, of which only a small portion is occupied by the ovules at this stage. BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT The outer-whorl anthers now carry pollen grains that appear to be approaching maturity, and the tapetum layers have completely disintegrated (fig. 5E). In the inner-whorl stamens, the tapetum is visible, and most pollen grains are still immature. The filaments of the innermost stamen whorls are now longer than those in the outer whorls, so that their shorter anthers are elevated to the same total height. The petals have extended longitudinally and are about one-third of the length of the outer-whorl stamens (fig. 4H). Subsequently, the ovules differentiate a long and narrow megaspore mother cell. This is embedded in five to eight cell layers of nucellar tissue (i.e., the ovules are crassinucellate) and is enclosed in callose deposits toward its base. Also, the two integuments are now fully developed: the inner integument consists of three cell layers, and the outer integument can grow up to five layers thick, with an even larger number of cell layers toward the micropyle. The funiculus shows vasculature and does not further increase in length or diameter (fig. 5C). In the ovary, lignification occurs in the walls of a single line of cells that extends from the center of the placenta to the outside of the ovary wall (fig. 6A, 6B). This indicates the site of dehiscence of the two valves that occurs much later in the mature fruit. The lateral diameter of a bud at the end of stage 8 ranges from ca. 2.3 to 2.8 mm. From the commencement of stage 9, the megaspore mother cell undergoes meiosis. One resulting megaspore develops into the embryo sac, which contains the egg apparatus (consisting of the egg cell and synergids), central cell, and antipodals (fig. 5D). Substantial amounts of callose are deposited in the cells surrounding the megaspore mother cell within the nucellus before megasporogenesis begins, and these callose deposits are maintained until anthesis (fig. 5C, 5D). The ovules do not fill all available space in the ovary, as spaces are apparent even close to anthesis (fig. 6A). The pollen grains in all anthers have matured in stage 9, and the tapetum has disintegrated, as has the cell layer separating the two locules in each theca from each other. Every pollen sac has developed a thickened endodermis and a stomium, through which pollen is released later at anthesis (fig. 5F, 5H). Stage 10 begins with the abscission of the sepals as a single cap, pushed off by the elongating petals. The bud size at the beginning of this stage varies considerably, falling between ca. 3.5 and 5.5 mm (average 6 standard error ¼ 4:37 6 0:11 mm). Subsequently, the flower opens, and the petals, wrinkled at first, straighten. The stamens extend above the stigma. Pedicel elongation stops during stage 10, and final pedicel lengths were observed to range between 4 and 8.25 cm, possibly associated with the position of the flower on the plant and/or plant growth conditions. Stage 11 is characterized by anthesis. The anthers dehisce simultaneously through long slits (stomia) at their abaxial side, ca. 1 d after flower opening (fig. 5H), and release bright yellow pollen grains. The staining properties of the endothecium layer in the anticlinal walls of the anthers (fig. 4F) indicate that these thickened cell walls contain cellulose rather than lignin. However, the endothecium cell walls oriented toward the anther center contain lignin as well as cellulose. The gynoecium continues growing, and soon the style extends above the anthers. The gynoecium becomes receptive 543 shortly after the stomia open (protandry), with pollen sticking to its stigmatic tissue. After the pollen grains have attached to the stigmatic papillae, the pollen tubes start growing down the stigma toward the ovary (fig. 6F–6H). They choose a path along the inside of the solid style wall at the base of the papilla-like cells (fig. 6G). Once they have reached the ovary, the pollen tubes are apparently directed to grow down inside the two placentae before fertilizing the ovules (fig. 6H). Surface Morphology of the Mature Floral Organs To document the surface structure of mature floral organs, SEM was used. Both sepal surfaces are composed of large, irregularly shaped cells that can extend up to 50 mm in length and more than 30 mm in width. Many stomata are interspersed between these cells on the outer surface (fig. 7A). Both surfaces of the petals are covered with highly elongated (ca. 75 mm long), narrow (ca. 5 mm wide) cells. They are arranged in long, regular rows. Thick deposits likely to be cellulose create a ridge along the whole length of the cell. This ridge even continues over the plane of contact between two adjacent cells (fig. 7B). The cells on the abaxial side of the petals have less pronounced ridges (not shown). Petals do not have stomata. The surface of the stamen filament consists of cells with approximately the same width as the petal cells, but they are considerably shorter (a maximum of 30 mm long) and lack pronounced ridges (fig. 7C). The cells of the anther surface are comparably large, up to 60 mm long and up to 20 mm wide. Stomata were observed on the surface of the filament but not on the anther (fig. 7C, 7D). Stigmatic papillae densely cover the whole length of the dry stigma. They are club shaped, with the rounded end (ca. 15 mm in diameter) bulging outward (fig. 7E). The surface of the ovary wall is composed of small, irregularly shaped cells with interspersed stomata (fig. 7F). Two distinct cell surface types occur: cells with a smooth, bulging surface that contribute to the regions between the ovary ridges and cells with a flat, ribbed surface that form the ridge’s surface. Deposits of waxy granules can be observed as white dots (fig. 7F). Trichomes are not present on any mature floral organ of California poppy. Postfertilization Development and Fruit Maturation (Stages 12–14) During late stage 11, the petals and stamens start to wither, and at the beginning of stage 12, they abscise from the floral tube. In most cases, one petal and a few stamens positioned abaxially of it remain attached and abscise together. The gynoecium has grown to a length of 8:25 6 0:43 mm, on average, at the beginning of stage 12, and it continues its rapid elongation throughout this stage. Prominent ridges run the length of each capsule, three in medial regions of each valve (fig. 6C) and two in lateral regions (fig. 6D). Stage 13 commences once the elongation of the capsule is complete. Mature capsules ranged in final length between 3.1 and 6.6 cm, with an average of 5:0 6 0:2 cm. The capsules then dry out while the seeds inside mature. Parallel to the drying process of the capsule, the pedicel dries out as well. BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT Stage 14 is marked by the explosive release of the seeds. This occurs when the now dry valves separate basipetally from each other. During this separation process, the bottom parts of the two valves bend toward their abaxial side, remaining connected at the style. In each case, the valve also usually separates from the two lateral placental regions along each of its edges. Thus, when both valves have dehisced, four placental remnants remain, partially separated and partially attached to the valves. These replum-like frames may also remain attached to the style but not to the receptacle, so that the capsule abscises as a whole (see fig. 6E). Duration of Some Flower Development Progressions Individual poppy plants varied in respect to luxuriance, flowering time, and flower numbers at any given time. Even so, some time course data could be collected once buds were sufficiently large, so that measurements of the diameter of individual buds could be followed over time. The stage reached by buds of a specific diameter was estimated from sections of equivalent buds. This was relatively constant at first, but, by the end of stage 8, variability between buds meant that the diameter was not a good predictor of bud stage (table 1). The diameter of 10 buds was measured each day, starting from 1.25 mm (micorsporangia initiation, stage 6) until they reached 2.5 mm, at which size male meiosis occurs (stage 8). These buds needed 6.95 d, on average (60.39 d standard error, range 6–8 d), to pass through these stages. Four buds were measured starting from a 1.5-mm diameter (in stage 6) until sepal abscission (stage 10). They needed an average of 11:37 6 1:49 d (range 9.5–13 d) to pass from stage 6 to stage 10. These four buds showed pronounced differences in growth rate, especially apparent after commencement of male meiosis in stage 8, resulting in bud diameter before flower opening ranging from 3.2 to 5.2 mm. Interestingly, the steady increase in bud diameter was usually observed to slow ca. 2 d before sepal abscission. After sepal abscission (stage 10), the flower opens, and the petals extend fully. After that, 0:9 6 0:1 d (range 0–2 d) pass until anthesis begins (stage 11). Following abscission, the 545 flowers are open for 3:16 6 0:17 d, on average (range 3–4 d), until the petals and stamens abscise (stage 12), although these organs start withering ca. 2 d after anthesis. Following petal and stamen loss, the capsule grows longitudinally for 5:8 6 0:17 d (range 5–7 d), on average, until the final length is reached (stage 13). Expression of EcFLO during the Life Cycle of Eschscholzia Expression of EcFLO in apical meristems was monitored from before germination to the development of axillary inflorescences and flowers (fig. 8). Expression was first detected in imbibed seeds that usually germinated after 5 d. After breaking the seed coat, the root pole grows outward, being pushed by the elongating cotyledons that remain within the seed coat at this stage (fig. 8A, 8D). EcFLO expression occurs in a ringlike zone around the central zone of the seedling SAM at various germination stages (fig. 8B, 8C). During development of the rosette, the position of the expression domain in the flank meristem remains the same but the domain becomes larger with the overall increase of SAM size. As previously reported (Busch and Gleissberg 2003), leaf initiation is associated with expression gaps corresponding to the center of prospective and emerging leaf primordia (fig. 8E). Initiation of axillary shoots is also marked by downregulation in the prospective central zone of the axillary meristem (not shown; see Busch and Gleissberg 2003). Lateral inflorescence meristems arising from the axils of the uppermost cauline leaves show the same expression pattern restricted to the flank meristem before (fig. 8F) and during sequential initiation of the cauline leaf pairs (fig. 8G–8I). As in rosette leaf primordia, expression is discontinued in the center of arising cauline leaf primordia (fig. 8H, 8I). After transition to floral meristem identity, the pedicel starts to develop on the enlarging floral apex that has initiated the sepal ring primordium (stage 2; fig. 8J). EcFLO transcripts extend into the periphery of the sepal ring. Above the sepal primordia, expression is seen in a clearly defined peripheral ring excluding a broad central area, similar to Fig. 3 Scanning electron micrographs of early stages of floral development. A, Vertical view of two primary inflorescence meristems (im) in early stage 1. These are developing from the uppermost cauline leaves below the terminal primary flower, which has been removed from the center. Bar ¼ 75 mm. B, C, Vertical view of buds in late stage 1. Cauline leaf primordia (lp) and the floral meristem (fm) are indicated. In C, an axillary inflorescence meristem (im) has initiated from the axil of the lower cauline leaf (lp). Bar ¼ 75 mm. D, Lateral view of a bud at stage 2. The dome of the floral meristem (fm) is now encircled by the sepal primordia (sp). Bar ¼ 100 mm. E, Vertical view of two secondary inflorescences that have reached early stage 2 (left side) and late stage 2 (right side). The primary flower has been removed. Bar ¼ 100 mm. F, Vertical view of a late stage 3 bud, showing petal primordia (pp) already separated from the remaining floral meristem (fm) and showing that the sepal primordia (sp) are starting to overgrow the floral dome. The axis connecting the two lateral petal primordia is displaced by an angle of ca. 30° in relation to the cauline leaf primordium (lp). Bar ¼ 100 mm. G, Vertical view of a bud in stage 4. The sepals enclosing the bud at this stage have been removed. Four stamen primordia arise in the first stamen whorl (1). More stamen whorls are being initiated around the floral dome (fd), and there is not yet a distinct gynoecium primordium. Lateral and medial petal primordia (lpp and mpp, respectively) are shown. Bar ¼ 100 mm. H, Bud at the beginning of stage 5 in which the gynoecium (g) is separated from the region producing stamen primordia. Stamen whorls are numbered from the oldest (1) to the youngest (3 in H and I, 4 in J). Bar ¼ 100 mm. I, View of a bud between stage 4 and 5 showing irregular stamen initiation. In stamen whorls 1 and 2, the stamens have initiated regularly, but those in whorl 3 and the following whorls grow in a disordered fashion. Bar ¼ 100 mm. J, Vertical view of a late stage 5 bud showing the indented gynoecium (g) separated by a deep groove from the stamen primordia. The latter do not yet show locular ridges on their abaxial surfaces. Bar ¼ 120 mm. K, Vertical view of a bud in stage 6 showing clearly visible locular ridges (arrows) in the outer stamens. The gynoecium has begun growing vertically as a tube. Bar ¼ 150 mm. L, Lateral view of the bud in K, showing triangular petals (p) and stamen primordia that are constricted at the base (arrows). The height of the stamen primordia is in proportion to when they arose. Bar ¼ 150 mm. BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT vegetative SAMs. Expression also extends downward around the periphery of the elongating pedicel. At a slightly later stage, before extension of sepal primordia to form a cap, EcFLO expression corresponds to a domain from which petals and stamens start to initiate. This ring-shaped area is slightly elevated, and it is separated from the gynoecial initiation field in the center by a smooth sinus (figs. 4G, 8K). Isolated gaps within the peripheral expression domain appear to correspond to initiating stamens, as seen in tangential sections (fig. 8L). Up to this point, weak EcFLO expression is maintained in the periphery of the sepals and pedicel. During further initiation of stamens and the beginning of gynoecium elevation and outgrowth (stage 5), EcFLO transcript accumulation retreats to smaller areas at the base of petal primordia, near the base, and around the insertion of stamen primordia (fig. 8N, 8O). Expression in the receptacle between developing sepals, petals, stamens, and the gynoecium is still visible in stage 6 flower buds. No EcFLO expression could be observed in gynoecium tissue at any stage of flower development. Discussion Our observations on the development of Eschscholzia californica are to a large extent consistent with previous, less detailed work on California poppy flower development (Ronse Decraene and Smets 1990; Karrer 1991). In addition, we studied the expression pattern of EcFLO, the Eschscholzia ortholog of the Arabidopsis flower meristem identity gene LFY, to understand its role in conferring inflorescence and flower meristem identity and floral organ properties in the poppy. Californian Poppy Morphology Shows a High Degree of Plasticity Extensive variation in growth habit, floral structure, and plant longevity can be observed in Eschscholzia specimens collected in a single population and within populations (Beatty 1936; Cook 1962). In this study, plants grown in constant light in the glasshouse showed elongated internodes and very few basal branches (fig. 1A), in comparison to specimens grown in spring in the field. Large differences 547 were observed in SAM size, floral meristem size, bud diameter at various floral stages, and stamen number in plants grown under the same conditions (fig. 2C; table 1; Cook 1962). Vigorous plants are more procumbent, with only the pedicel elongated, and they have several secondary inflorescences in more basal positions (Günther 1975). Much of the flexibility in developmental program seems to be intimately associated with environmental factors, but some growth habit differences are genetically determined, including annual/ perennial and erect/procumbent growth habits (Beatty 1936; Günther 1975). The observed phenotypic variation could be associated with the strong genetic self-incompatibility (SI) system present in California poppy (Beatty 1936). This is a gametophytic system, and a single genetic factor (controlled by the S-locus) apparently acts in the stigma and inhibits pollen tube growth soon after pollen germination. Outbreeding systems like this can lead to high levels of heterozygosity in natural populations (Wright 1979). Even though some Eschscholzia populations, especially naturalized ones, are somewhat selfcompatible, the extent of inbreeding is still very low. In rare cases of self-compatibility, the resulting seed set and viability of the F1 generation was low, and the few F1 plants that flowered were sterile (Beatty 1936). It will be of interest to determine if the SI system in Eschscholzia involves the same mechanism of action, programmed cell death of incompatible pollen, as occurs in the related poppy Papaver rhoeas (Thomas and Franklin-Tong 2004). Comparison of Flower Development in Californian Poppy and Other Poppy Species The poppy family comprises 23 genera with ca. 240 species, which are distributed mainly in the Northern Hemisphere of the Old and New World. They have actinomorphic, bisexual flowers. Usually, there are two or three free sepals, which abscise at or shortly after flower opening. Typically, Papaveraceae species have two whorls of two or three petals, which are crumpled in the bud. Numerous free stamens arise centripetally in whorls, with basifixed anthers containing four sporangia. The ovary is syncarpous and made up of two to 20 carpels, with many ovules arising from parietal placentas. Fig. 4 Sections of California poppy buds stained with safranin and fast green. A, Longitudinal section of a bud in stage 4, showing the domeshaped floral meristem (fm), stamen primordia (sp), petal primordia (pp), and elongating sepal cap (se). Secondary inflorescence meristems (si) have formed in the axils of the cauline leaves of the primary bud. Bar ¼ 200 mm. B, Longitudinal section of a stage 5 bud, showing the indented gynoecium primordium (gp) and the petal (pp) and stamen (sp) primordia. Bar ¼ 200 mm. C, Longitudinal section of a bud in stage 6, showing the elongating tubelike gynoecium in the center. Locular regions in the stamens surrounding the gynoecium are darker in color. Bars in C–H ¼ 500 mm. D, Transverse section of a stage 6 bud, showing the narrow gynoecium (g) in the center with two placentae (pl) protruding inward and the four locules containing microsporangia in each stamen (st). The petals are not visible because of the position of the cross section. E, Transverse section of a bud in stage 7. Ovule primordia (o) are initiated at this stage and are visible as small protrusions extending from the placenta (pl). In the anthers, the vasculature (v) of the connectives is indicated, as well as the sporogenous tissue (st) in the locules. F, Transverse section of a bud in stage 8, which commences when male meiosis begins. The valves of the gynoecium show 10 protruding ridges (ri). The inset shows an enlargement of an outer-whorl anther. Tetrads of microspores (te) appear as an agglomeration of light blue–stained cells, and the tapetum (ta) is visible surrounding the tetrads. G, Longitudinal section of a bud in stage 7. Within the gynoecium, part of the placenta (pl) with initiating ovules (o) is visible. The gynoecium is surrounded at its base by the floral tube (ft), which is encircled by a rim (r) on its outside. Petals (pe) and stamens are attached to the top of the floral tube. Stamens consist of a short filament (f ) and an anther (a) that contains densely packed sporogenous cells surrounded by the dark blue–stained tapetum. H, Longitudinal section of a late stage 8 bud. Within the anthers (a), the tapetum layer disintegrates and pollen grains (pg) mature. The style of the gynoecium (st) elongates, and the ovary harbors ovules (o), now consisting of two integuments and a nucellus with a megaspore mother cell in the center. The floral tube (ft), expanding petals (pe), and outer rim (r) are also indicated. 548 INTERNATIONAL JOURNAL OF PLANT SCIENCES Fig. 5 Ovule and stamen development. A, Transverse section showing ovules protruding from the placenta (pl) of a bud late in stage 8, when the first (inner) integument (ii) arises. B, Transverse section of two ovules from a bud late in stage 8, where the second integument has already initiated and the ovules adopt their anatropous shape. The nucellus (nu) is embedded in the inner (ii) and outer (oi) integuments. The ovule is connected to the placenta (pl) by the funiculus (fu). C, Transverse section of an ovule from a bud in stage 8. The long and narrow megaspore mother cell (mmc) is surrounded by callose deposits (cd, stained pink). Inner (ii) and outer (oi) integuments embed the nucellus and are open at the micropylar end (mp). D, Transverse section of an ovule from a bud in stage 9, after megasporogenesis (female meiosis) has occurred. The egg apparatus (ea) and antipodal cells (ac) are part of the embryo sac, which is still surrounded by callose deposits (cd). E, Transverse section of anthers from a bud late in stage 8, when the first immature pollen grains (pg) appear. The vasculature (v) in the connective, petals (pe), and sepals (se) are indicated. F, Transverse section of an anther from a bud at the end of stage 8. Mature pollen grains (pg) are stained dark blue. The endothelium (e), stomium (st), and connective (c) are indicated. G, Scanning electron micrograph showing the lower part of mature stamens before anthesis. The bases of the filaments (f ) are attached to the petal (pe) as indicated by an arrow, and they will dehisce together at anthesis. The connective (c) is situated between the two thecae (th). Bar ¼ 75 mm. H, Scanning electron micrograph showing the top part of an anther at anthesis (stage 11). The anthers open through the long, slit-shaped stomium (st) to release pollen grains. The connective (c) between the two thecae (th) is also indicated. Bar ¼ 0:5 mm. The stigma is often sessile and merges with the style, and poppy fruits normally dehisce as dry capsules (Kadereit 1993). In most aspects of flower morphology, California poppy is a typical representative of the Papaveraceae (Hoot et al. 1997). However, its fused sepals are typical only for members of the genus Eschscholzia and for Eomecon, a genus in subfamily Chelidonioideae. Most poppy species have hypogynous flowers, and the presence of a floral tube (hypanthium) is specific to the genus Eschscholzia. In addition, a conspicuous torus rim developing below the sepal ring before anthesis is characteristic of E. californica (Ernst 1962). The California poppy gynoecium consists of two fused carpels with entirely free carpel tips (free carpel tips are also found in the genus Platystemon and allies in subfamily Papaveroideae). Two long stylar protrusions occur above the valves, and two more are usually present above the placentae in all members of the Eschscholzioideae (Kadereit 1993). According to the classical two-carpel theory, the gynoecium consists of two carpels, with the placental regions at their points of fusion (Karrer 1991; Brückner 2000). However, a four-carpel theory has been proposed to account for the presence of four stigmatic lobes. This assumes the presence of two types of carpels within two-valved gynoecium, one type being fertile and expanding, the other fertile and contracting (or, according to older ideas, two fertile and two sterile carpels) in two whorls. However, our results and the work of Karrer (1991) have shown that the gynoecium initiates as a single hemispherical structure and that additional carpel whorls were never observed. Also, the stigmatic lobes above the placentas develop only late in floral development (during or after the beginning of stage 8), are extremely variable in length, and in some cases do not develop at all. Nectar is absent in all Papaveraceae, but pollen is provided in abundance as a pollination reward. California poppy is BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT 549 Fig. 6 Late stages of gynoecium and fruit development. A, Transverse section through a gynoecium just before female meiosis begins in stage 9. The gynoecium, containing the ovules (o), is surrounded by the floral tube (ft). Each of the two valves includes three median (mr) and two lateral ridges (lr) within the ovary wall. The replum region is situated between the two neighboring lateral ridges. The black arrows indicate six vascular bundles in the ovary wall, and the white arrows show the file of lignified cells in the valve/replum border region. B, Enlargement of the valve/ replum border in the ovary wall (ow) of a bud in stage 9. Lignified cells with pink-stained cell walls (white arrows) are arranged transversely from the replum to the placenta (pl). Later in capsule development, the dehiscence zone between the two rows of seeds attached to the placenta will form in this position. The placenta is lined with papillae-like cells (pc). C, View of the valve region of a mature California poppy capsule. The median ridges (mr) are indicated. D, View of the valve/replum border of a mature capsule. Lateral ridges (lr) and the zone of the valve/replum (v/r) border are indicated. E, Dry silique with valves (v) separated from the replum-like frame (r). Californian poppy siliques open explosively from bottom to top, and the two valves remain attached below the style (st). Replum material also dehisces from the receptacle and usually remains attached to the valves. The coin is 19 mm in diameter. F, Longitudinal section of the stigma after pollination, stained with aniline blue. Callose appears brightly fluorescent. Pollen tubes (pt) are visible, growing internal to the papillae cells (pc) that cover the surface of the stigma. Callose is also present in the sieve plates of the phloem (ph). The cell walls of the xylem (xy) are also weakly fluorescent. G, Transverse section of the style region after pollination, stained with aniline blue. The pollen tubes (pt) are visible as small circles internal to the papillae cells (pc) that line the hollow internal space of the style. The xylem vessels (xy) are also fluorescent. H, Longitudinal section of the base of the style and top part of the ovary (o). Pollen tubes (pt) grow down the ovary at the inside of the papillae-like tissue (pc) lining the placenta. The ovary wall (ow) and style wall (sw) are also indicated. pollinated by a variety of insects, the most significant being honeybees, bumblebees, beetles, and some other insect species (Cook 1962). California poppy capsules dehisce explosively in an acropetal direction, leaving the replum-like frames partly attached to the two valves, and seeds may be scattered in a radius of 1.5 m by this action (Cook 1962). The fruits of the Papaveraceae are very variable; some dehisce basipetally or laterally, however, and some more derived poppy species, such as Papaver somniferum (opium poppy), have indehiscent capsules 550 INTERNATIONAL JOURNAL OF PLANT SCIENCES Fig. 7 Scanning electron micrographs of floral organ surfaces at maturity (stages 10 and 11). All bars ¼ 25 mm. A, Outer surface of a sepal just before bud opening, showing large, irregularly shaped cells interspersed with stomata. B, Inner surface of a mature petal, showing long but narrow cells with thick deposits (probably cellulose) at their apex. The cells are arranged in regular files. C, Surface of a stamen filament, showing narrow cells that are shorter than the petal cells and lack the surface deposit. The filament surface also contains occasional stomata. D, Surface of the anther, showing cells that are longer and wider than those of the filament. The anther surface lacks stomata. E, Papillae covering the surface of the stigma at anthesis. F, Surface of the valve region of the ovary wall at anthesis, showing compact cells arranged in files with scattered stomata. The flatter cells in the bottom right corner are part of a longitudinal ridge within the ovary wall. consisting of up to 20 carpels that release their seeds through small pores (Karrer 1991; Kadereit 1993). Comparison of Flower Development in California Poppy and Higher Eudicot Model Plants Sepal fusion. In California poppy, sepals have a specialized structure, occurring as a single abscising cap. They arise as a continuous ring-shaped primordium during stage 2. In this work, we were not able to observe completely separated sepal primordia at any point of floral development, although two sinuses were present at around stage 3. This is in accordance with previous investigations (Ernst 1962; Karrer 1991). Postgenital fusion of sepals can therefore be excluded as the cause of the ring-shaped sepal structure. Rather, intersepal zones never develop. It will be interesting to analyze whether the missing intersepal zones in the California poppy correlate with absence of action of genes known to establish such zones by growth suppression in Arabidopsis, including CUP-SHAPED COTYLEDON genes (Aida et al. 1997) and PETAL LOSS (Brewer et al. 2004). Petal placement. Petal formation in California poppy is very regular, and it remains unclear how petals obtain their positional information. Around the time the petals initiate, the sepal ring is quite uniform, and only later does it show indentations at the lateral site of the flower primordium, where the lateral petal primordia separate from the floral apex (fig. 3F). A possibility is that petal positional information is defined by the lateral and medial axes of the flower rather than by the preceding whorl (Endress 1999). This would also explain the fact that the gynoecium initiates consistently along the lateral axis, irrespective of the number of stamen whorls initiated. Alternatively, a premorphological establishment of two discrete sepal domains and their lateral fusion, allowing appropriate localization of petal initiation sites, may precede visible outgrowth of the uniform sepal ring primordium. Interestingly, we observed that the usual medial position of the two sepals also depends on two Fig. 8 Expression of EcFLO in seedling and floral developmental stages. All scale bars ¼ 100 mm. A–D, Longitudinal sections through the embryo shoot apical meristem (SAM) at beginning of (A, magnified in C) and during (D, magnified in B) seed germination. Arrows in A and D point to the SAM. In D, the two bifid cotyledons (co) are still inserted in the seed coat. E, Median section of a vegetative shoot apex with rosette leaf primordia (rlp) 10 d after germination. F–I, Successive stages of lateral inflorescence meristem development, during which two cauline leaves are initiated (clp; stage 1). J, Stage 2 flower with initiated sepal primordia (sp). K, L, Medial (K) and tangential (L) sections of flower primordia at the beginning of stamen formation (late stage 3–early stage 4). Petal primordia are not visible in these sections. M–O, Initiation of the gynoecium (gp) and further stamens (st) after generation of the sepal hood. Development of petal primordia (pp) still lags behind that of other organs (stage 5). P, Stage 6 floral bud. Sporangia-forming stamens have overgrown the central gynoecium, and petals (pp) start to elongate. 552 INTERNATIONAL JOURNAL OF PLANT SCIENCES preceding transverse cauline leaves. In cases where a third, even rudimentary, cauline leaf is present, the two sepals form in alternation to this leaf in approximately transverse positions. Proliferation of stamen whorls. During the course of stages 4 and 5, multiple whorls of stamen primordia are formed in California poppy. The number of whorls that arise is variable and may be under environmental control. Counts of 34 and 40 stamens per flower (Karrer 1991) indicate that up to seven whorls can be initiated. A wide range of floral meristem sizes was observed at the appropriate stage, perhaps dependent on plant vigor (fig. 2C), and the number of whorls initiated might be correlated with this. In stage 4, the gynoecium primordium in the center of the bud separates, with a groove from the zone of stamen primordia initiation, while whorls of stamens are still to be formed. So far, molecular processes of flower development have been analyzed in model plants with effectively only one whorl of stamens. How is it that in California poppy new whorls of stamen primordia can arise in the presence of an already determined gynoecium primordium? This may involve SUPERMAN (SUP) gene function. In the superman mutant of Arabidopsis, stamen number is increased but at the cost of normal carpel development. SUP is thought to maintain the boundary between whorls 3 and 4 by controlling the balance of cell proliferation activity in these regions of the floral meristem (Sakai et al. 1995, 2000). Similar expression and function has also been reported for SUP orthologs in petunia and rice (Nandi et al. 2000; Nakagawa et al. 2002, 2004), suggesting that this mechanism predates the evolution of monocots and dicots. Properties of the gynoecium. Remarkably, the gynoecium of the California poppy superficially shares the same basic design as that of Arabidopsis. They are both linear, two-carpeled structures with parietal placentae along the carpel margins, and they both mature as dry, abscising capsules. Despite these similarities, they were apparently derived independently during eudicot evolution (Armbruster et al. 2002). On the other hand, there are important morphological differences between the two species. A specialized false septum grows across the gynoecium in Arabidopsis (and other Brassicaceae) but not in Eschscholzia, and pollen tubes are directed to grow down the transmitting tract in this septum in Arabidopsis, whereas in Eschscholzia they use the placental regions. Conversely, style development is very specialized in Eschscholzia. Protrusions of the short style elongate very late during flower development (at or after stage 8), and they grow rapidly and continuously in a specialized and highly concerted process of cell division and expansion even after the flower opens. Such similarities and differences may be reflected in three categories of carpel development genes acting in poppy: conserved core carpel genes, such as AGAMOUS and CRABS CLAW, shared widely across monocots and eudicots (Bowman and Smyth 1999; Kramer et al. 2004; Yamaguchi et al. 2004); genes recruited independently in both Eschscholzia and Arabidopsis that have resulted in convergent developmental outcomes; and specialized genes specific to the Eschscholzia lineage. Characteristics of Primary Shoot Development in Eschscholzia Eschscholzia is a typical semirosette plant in which the primary shoot bolts after developing a rosette, giving rise to the flowering region of the plant. Vegetative development is characterized by strengthening growth (‘‘Erstarkung’’ sensu Troll and Rauh 1950; Jones and Watson 2001) of the shoot, which is expressed, on the one hand, in the gradual increase of leaf size and complexity and, on the other hand, by an increase in height of the apical meristem. Significantly, strengthening growth during the vegetative phase was not reflected in a pronounced increase of SAM diameter, as reported for other species (Röbbelen 1957; Williams 1975). One developmental hallmark for flower formation is the pronounced increase of both SAM diameter and height. During vegetative development, moderate size increase of the SAM is paralleled by a marked increase of leaf size and complexity in heteroblastic development. This correlation is lost in uppermost cauline leaves that show a decrease of complexity, while the SAM undergoes further marked increase in size upon floral transition. Leaf reduction below flowers is only slight in comparison to that in other members of the poppy family (S. Gleissberg, unpublished results). Maintenance of a high level of leaf complexity in more basal cauline leaves may indicate that these leaves underwent early morphogenesis before floral transition and were elevated by internode growth after that. Roles for EcFLO in Inflorescence and Flower Development Does Eschscholzia have an inflorescence meristem? The apical meristem of Arabidopsis, a species with an indeterminate inflorescence, progresses through distinct identities, a rosette leaf-forming vegetative SAM, a bract- and flowerforming inflorescence meristem, and flower meristems produced laterally in acropetal succession along an elongated axis (Alvarez et al. 1992; Hempel and Feldman 1994). In Arabidopsis, the switch from vegetative to inflorescence identity is marked by lateral flower initiation without any bracts and by bolting of the shoot axis that includes internodes of the latest-formed leaves. The few bracts (cauline leaves) attached to the elongated inflorescence axis are initiated before flower formation and axis elongation. After production of many lateral flowers, the inflorescence apex stops developing without being converted to a flower meristem. The situation in Eschscholzia is distinct, because a single terminal flower is formed from the elongating primary axis above a few cauline leaves. Continuation of flowering occurs by generation of lateral shoot meristems that produce at least two leaves before being converted, in turn, to a flower meristem. Formation of these lateral flowering shoots proceeds basipetally, paralleling the basipetal generation of new axillary secondary inflorescence shoots in Arabidopsis (Troll 1964; Günther 1975; Alvarez et al. 1992; Hempel and Feldman 1994). Clearly, the flowering shoots develop quite differently in the two species, highlighting fundamental differences between open and closed inflorescences. Of the three features that characterize the inflorescence meristem in Arabidopsis, internode elongation, leaf reduction, and immediate production BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT of lateral flowers, only one (internode growth) is found in Eschscholzia. One possibility is that in Eschscholzia, vegetative SAM identity is directly converted into flower meristem identity, without proceeding through an intermediate inflorescence identity, and that internode elongation affecting the leaves below is a consequence of conversion to floral identity. In this case, one would expect that the onset of terminal flower differentiation starts within the rosette at the same time as the elongation of the pedicel and the internodes below. Alternatively, transition from a vegetative to an inflorescence meristem identity is marked by the onset of primary shoot elongation, with a second transition to flower meristem identity occurring later, after formation of cauline leaves. We were not able to track transitions in the primary shoot, because the end of the rosette stage occurs rapidly and is not very synchronous among plants. Therefore, we studied lateral flowering shoots arising from the pseudowhorl of uppermost cauline leaves. Onset of first flower formation is evident from a sudden meristem size increase and sepal ring initiation. Significantly, this is accompanied by early elongation of the pedicel. Expression of EcFLO at this stage in the pedicel periphery may indicate a role in the process of axis bolting, although expression diminishes at later stages of elongation. In contrast, during formation of the two (or three) cauline leaves that precede lateral flowers, there is no evidence for internode elongation, which occurs later during lateral shoot development. This observation would be in accordance with floral identity directly following vegetative identity and also causing internode growth. This model would also explain the continued formation of foliage leaves in the flowering region of Eschscholzia, whereas in Arabidopsis, bracts subtending flowers are completely suppressed. If there is a two-step transition (from vegetative to inflorescence to floral identity) in Eschscholzia, then inflorescence identity is less pronounced, as it still allows for continued foliage leaf production. Flowering shoots arising later closer to the rosette may need longer to overcome vegetative traits, as they produce several leaves before formation of a terminal flower. We show here that the transition from vegetative to putative inflorescence meristem identity, as well as the transition to early floral meristems, is not accompanied by a significant change in the expression pattern of the Eschscholzia LFY homolog, EcFLO. Instead, a ringlike expression domain at the shoot apex flanks, which was evident from late embryo shoots onward, is stably maintained until onset of stamen initiation. First, this indicates constancy in the developmental control of the SAM during growth, of which EcFLO may be a part. Alternatively, genes maintaining SAM function may direct EcFLO expression. Second, EcFLO expression is uninformative regarding the distinction of vegetative versus inflorescence and floral meristem identities. This is in contrast to Arabidopsis, where LFY expression is not seen in the inflorescence apex but occupies the entire floral meristem. Also, in Arabidopsis a quantitative increase in LFY expression levels occurs during floral transition. We could not observe such a noticeable upregulation in Eschscholzia, other than expansion of the expression domain due to size increase of the shoot apex. Expression in a ringlike domain at the vegetative and floral SAM flanks is more similar to that reported for 553 Nicotiana (Kelly et al. 1995). Thus, our data support the view that LFY/FLO expression and function in vegetative and reproductive phase of shoots has been subject to considerable evolutionary change. Information from other taxa is needed before general inferences can be made regarding genetic changes during inflorescence evolution. To further investigate the nature of inflorescence identity in Eschscholzia, it would be useful to study expression of the ortholog of TERMINAL FLOWER1 (TFL1), a gene that acts as an antagonist to LFY in Arabidopsis and serves to prevent terminal flower formation by repressing LFY in the inflorescence apex. Since the antagonistic LFY/TFL1 mechanism appears not only in rosids, but also in asterids (Antirrhinum and Solanaceae; Bowman et al. 1992; Bradley et al. 1996; Souer et al. 1996; Pnueli et al. 1998; Ratcliffe et al. 1998; Molinero-Rosales et al. 1999), it may well also act in basal eudicots in determining inflorescence structure. One possibility is that a TFL1 gene functions to restrict EcFLO expression to the flank meristem from embryo stages on. In addition, comparisons with Fumariaceae, the sister family of Papaveraceae in which open inflorescences are common, would provide a further opportunity to study evolution of inflorescence development. EcFLO and floral organ identity. In Arabidopsis, LFY functions as a floral meristem identity gene necessary to turn on floral organ identity genes. In double-mutant combination with apetala1, lfy mutants lose the ability to initiate sepals, petals, stamens, and the gynoecium and instead produce bractlike leaves thought to represent a default organ state underlying floral organ identities. In accordance with this, LFY expression completely encompasses the early flower meristem. Our detailed analysis of EcFLO expression during Eschscholzia flower development shows that transcripts are specifically absent from the center of the floral meristem, corresponding to the gynoecial initiation field, and that gynoecium development at least until stage 6 also proceeds without EcFLO expression. While floral EcFLO expression is consistent with a conserved role in directing B- (and C-) function to petal and stamen initiation regions (Parcy et al. 1998), the gynoecium of Eschscholzia can possibly develop without EcFLO. Published data for other eudicots indicate that expression, and possibly function, of FLORICAULA/LEAFY orthologs in floral meristems diversified during evolution. In several species, FLO/LFY expression occurs in the whole floral primordium before floral organ initiation, as in Arabidopsis (Populus, Rottmann et al. 2000; Vitis, Carmona et al. 2002; Joly et al. 2004; Petunia, Souer et al. 1998; Lycopersicon, Pnueli et al. 1998; Molinero-Rosales et al. 1999). In most of these, expression occurs later, during carpel initiation and development. Exclusion of FLO/LFY expression from the center of early floral meristems, as seen in Eschscholzia, has also been reported for Nicotiana (Kelly et al. 1995) and Pisum (Hofer et al. 1997). However, while we could not detect EcFLO at stages of gynoecium development, the Pisum FLO/ LFY gene UNIFOLIATA is expressed later in the developing carpel. Only very faint expression in developing gynoecia was found in Nicotiana (Kelly et al. 1995). In Arabidopsis, LFY becomes downregulated in the center of the floral apex after initiation of sepals. It is thought that AG, which serves to specify carpel identity, contributes to the 554 INTERNATIONAL JOURNAL OF PLANT SCIENCES maintenance of flower identity after being activated by LFY (Parcy et al. 2002). If AG can substitute for FLO/LFY in the role of maintenance of floral identity, this might explain the lack of FLO/LFY gene expression in developing gynoecia reported here for Eschscholzia and maybe also that in Nicotiana (Kelly et al. 1995). Exclusion of FLO/LFY from the center of early flower primordia, as seen in Eschscholzia, Pisum, and Nicotiana, may imply that AG can establish its expression domain independently of FLO/LFY in these species, perhaps by activation through the WUSCHEL gene (Lenhard et al. 2001). Alternatively, EcFLO may act noncell-autonomously in activating AG, as reported for Arabidopsis (Sessions et al. 2000). The systematic distribution of these expression patterns is scattered in both major eudicot clades, rosids and asterids. The basalmost position of Eschscholzia in eudicots may indicate that FLO/LFY expression in the center of the floral meristem and in developing carpels is a derived feature and that exclusion from the floral center has been maintained in Nicotiana and Pisum. Alternatively, functional redundancy between FLO/LFY and AG may have allowed for a more frequent evolutionary fluctuation of FLO/LFY expression. Interestingly, in the case of Solanaceae, variation in expression patterns occurs within the family (Kelly et al. 1995; Souer et al. 1998; Molinero-Rosales et al. 1999). In Papaveraceae, expression in at least another species is similar to that in Eschscholzia (S. Gleissberg, unpublished results). In the long run, modulation of expression in transgenic plants is necessary to clarify the role of EcFLO, and further studies, particularly in other basal eudicots, should help to resolve the overall picture of FLO/LFY evolution. Acknowledgments We thank two anonymous reviewers for constructive comments on the manuscript. A. Becker and D. R. Smyth thank fellow workers for discussions and interest and Gunta Jaudzems of the Monash Micro Imaging Facility for help with SEM and technical advice. A. Becker is especially grateful to Günter Theißen for initial support of the project. This study was assisted by the German Research Foundation grant BE 2547/3-1 to A. Becker and a Monash University Small Grant. S. Gleissberg thanks members of his lab for technical help and discussion. Research in Mainz was supported by the German Research Foundation grant GL 213/1-4 and by the Forschungsfonds of the University of Mainz to S. Gleissberg. Literature Cited Aida M, T Ishida, H Fukaki, H Fujisawa, M Tasaka 1997 Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9:841–857. Alvarez J, CL Guli, X-H Yu, DR Smyth 1992 terminal flower: a gene affecting inflorescence development in Arabidopsis thaliana. Plant J 2:103–116. Armbruster WS, EM Debevec, MF Willson 2002 Evolution of syncarpy in angiosperms: theoretical and phylogenetic analyses of the effects of carpel fusion on offspring quantity and quality. J Evol Biol 15:657–672. Beatty AV 1936 Genetic studies on the California poppy. J Hered 17: 331–338. Bennett MD, JB Smith 1976 Nuclear DNA amounts in angiosperms. Philos Trans R Soc Lond Ser B 274:227–274. Bowman J, DR Smyth 1999 CRABS CLAW, a gene that regulates carpel and nectary development in Arabidopsis, encodes a novel protein with zinc finger and helix-loop-helix domains. Development 126:2387–2396. Bowman JL, H Sakai, T Jack, D Weigel, U Mayer, ME Meyerowitz 1992 SUPERMAN, a regulator of floral homeotic genes in Arabidopsis. Development 114:599–615. Bradley D, R Carpenter, L Copsey, C Vincent, R Rothstein, E Coen 1996 Control of inflorescence architecture in Antirrhinum. Nature 379:791–797. Brewer PB, PA Howles, K Dorian, ME Griffith, T Ishida, RN Kaplan-Levy, A Kilinc, DR Smyth 2004 PETAL LOSS, a trihelix transcription factor gene, regulates perianth architecture in the Arabidopsis flower. Development 131:4035–4045. Brückner C 2000 Clarification of the carpel number in Papaverales, Capparales, and Berberidaceae. Bot Rev 66:155–307. Busch A, S Gleissberg 2003 EcFLO, a FLORICAULA-like gene from Eschscholzia californica is expressed during organogenesis at the vegetative shoot apex. Planta 217:841–848. Buzgo M, DE Soltis, PS Soltis, H Ma 2004 Towards a comprehensive integration of morphological and genetic studies of floral development. Trends Plant Sci 9:164–173. Carmona MJ, P Cubas, JM Martinez-Zapater 2002 VFL, the grapevine FLORICAULA/LEAFY ortholog, is expressed in meristematic regions independently of their fate. Plant Physiol 130:68–77. Clark G 1981 Staining procedures. Williams & Wilkins, Baltimore. Cook SA 1962 Genetic system, variation, and adaptation in Eschscholzia californica. Evolution 16:278–299. Endress PK 1999 Symmetry in flowers: diversity and evolution. Int J Plant Sci 160(suppl):S3–S23. Ernst WR 1962 A comparative morphology of the Papaveraceae. PhD diss. Stanford University, Palo Alto, CA. Gleissberg S 2004 Comparative analysis of leaf shape development in Eschscholzia californica and other Papaveraceae-Eschscholzioideae. Am J Bot 91:306–312. Günther KF 1975 Beiträge zur Morphologie und Verbreitung der Papaveraceae. II. Die Wuchsformen der Papavereae, Eschscholzieae und Platystemonoideae. Flora 164:393–436. Hempel FD, L Feldman 1994 Bi-directional inflorescence development in Arabidopsis thaliana: acropetal initiation of flowers and basipetal initiation of paraclades. Planta 192:276–286. Hofer J, L Turner, R Hellens, M Ambrose, P Matthews, A Michael, N Ellis 1997 UNIFOLIATA regulates leaf and flower morphogenesis in pea. Curr Biol 7:581–587. Hoot SB, J Kadereit, FR Blattner, KB Jork, AE Schwarzbach, PR Crane 1997 Data congruence and phylogeny of the Papaveraceae s.l. based on four data sets: atpB and rbcL sequences, trnK restriction sites, and morphological characters. Syst Bot 22: 575–590. Joly D, M Perrin, C Gertz, J Kronenberger, G Demangeat, JE Masson 2004 Expression analysis of flowering genes from seedlingstage to vineyard life of grapevine cv. Riesling. Plant Sci 166: 1427–1436. Jones CS, MA Watson 2001 Heteroblasty and preformation in mayapple, Podophyllum peltatum (Berberidaceae): developmental flexibility and morphological constraint. Am J Bot 88:1340–1358. Kadereit J 1993 Papaveraceae. Pages 494–506 in K Kubitzki, ed. The families and genera of vascular plants. Springer, Berlin. BECKER ET AL.—CALIFORNIA POPPY DEVELOPMENT Karrer AB 1991 Blütenentwicklung und systematische Stellung der Papaveraceae und Capparaceae. Inaugural diss. Universität Zürich. Kelly AJ, MB Bonnlander, DR Meeks-Wagner 1995 NFL, the tobacco homolog of FLORICAULA and LEAFY, is transcriptionally expressed in both vegetative and floral meristems. Plant Cell 7: 225–234. Kramer EM, MA Jaramillo, VS Di Stilio 2004 Patterns of gene duplication and functional evolution during the diversification of the AGAMOUS subfamily of MADS-box genes in angiosperms. Genetics 166:1011–1023. Lenhard M, A Bohnert, G Jürgens, T Laux 2001 Termination of stem cell maintenance in Arabidopsis floral meristems by interactions between WUSCHEL and AGAMOUS. Cell 105:805–814. Molinero-Rosales N, M Jamilena, S Zurita, P Gomez, J Capel, R Lozano 1999 FALSIFLORA, the tomato orthologue of FLORICAULA and LEAFY, controls flowering time and floral meristem identity. Plant J 20:685–693. Nakagawa H, S Ferrario, GC Angenent, A Kobayashi, H Takatsuji 2004 The petunia ortholog of Arabidopsis SUPERMAN plays a distinct role in floral organ morphogenesis. Plant Cell 16:920–932. Nakagawa M, K Shimamoto, J Kyozuka 2002 Overexpression of RCN1 and RCN2, rice TERMINAL FLOWER 1/CENTRORADIALIS homologs, confers delay of phase transition and altered panicle morphology in rice. Plant J 29:743–750. Nanda KK, R Sharma 1976 Effects of gibberellic acid and cyclic 39,59-adenosine monophosphate on the flowering of Eschscholtzia californica Cham., a qualitative long day plant. Plant Cell Physiol 17:1093–1095. Nandi AK, K Kushalappa, K Prasad, U Vijayraghavan 2000 A conserved function for Arabidopsis SUPERMAN in regulating floral-whorl cell proliferation in rice, a monocotyledonous plant. Curr Biol 10:215–218. Parcy F, K Bomblies, D Weigel 2002 Interaction of LEAFY, AGAMOUS and TERMINAL FLOWER1 in maintaining floral meristem identity in Arabidopsis. Development 129:2519–2527. Parcy F, O Nilsson, MA Busch, I Lee, D Weigel 1998 A genetic framework for floral patterning. Nature 395:561–566. Park S-U, PJ Facchini 2000 Agrobacterium-mediated genetic transformation of California poppy, Eschscholzia californica Cham., via somatic embryogenesis. Plant Cell Rep 19:1006–1012. Pnueli L, L Carmel-Goren, D Hareven, T Gutfinger, J Alvarez, M Ganal, D Zamir, E Lifschitz 1998 The SELF-PRUNING gene of tomato regulates vegetative to reproductive switching of sympodial meristems and is the ortholog of CEN and TFL1. Development 125: 1979–1989. Ratcliffe O, I Amaya, C Vincent, S Rothstein, R Carpenter, E Coen, D Bradley 1998 A common mechanism controls the life cycle and architecture of plants. Development 125:1609–1615. 555 Röbbelen G 1957 Über Heterophyllie bei Arabidopsis thaliana (L.) Heynh. Ber Dtsch Bot Ges 70:39–44. Ronse Decraene LP, E Smets 1990 The systematic relationship between Begoniaceae and Papaveraceae: a comparative study of their floral development. Bull Jard Bot Natl Belg 60:229–273. Rottmann WH, R Meilan, LA Sheppard, AM Brunner, JS Skinner, C Ma, S Cheng, L Jouanin, G Pilate, SH Strauss 2000 Diverse effects of overexpression of LEAFY and PTLF, a poplar (Populus) homolog of LEAFY/FLORICAULA, in transgenic poplar and Arabidopsis. Plant J 22:235–245. Sakai H, BA Krizek, SE Jacobsen, EM Meyerowitz 2000 Regulation of SUP expression identifies multiple regulators involved multiple regulators involved in Arabidopsis floral meristem development. Plant Cell 12:1607–1618. Sakai H, LJ Medrano, EM Meyerowitz 1995 Role of SUPERMAN in maintaining Arabidopsis whorl boundaries. Nature 378: 199–203. Sessions A, MF Yanofsky, D Weigel 2000 Cell-cell signaling and movement by the floral transcription factors LEAFY and APETALA1. Science 289:779–781. Soltis DE, PS Soltis, VA Albert, DG Oppenheimer, CW dePamphilis, H Ma, MW Frohlich, G Theißen 2002 Missing links: the genetic architecture of flower and floral diversification. Trends Plant Sci 7: 22–31. Souer E, A van der Krol, D Kloos, C Spelt, M Bliek, J Mol, R Koes 1998 Genetic control of branching pattern and floral identity during petunia inflorescence development. Development 125: 733–742. Thomas SG, VE Franklin-Tong 2004 Self-incompatibility triggers programmed cell death in Papaver pollen. Nature 429:305–309. Troll W 1964 Die Infloreszenzen. Gustav Fischer, Stuttgart. Troll W, W Rauh 1950 Das Erstarkungswachstum krautiger Dikotylen, mit besonderer Berücksichtigung der primären Verdickungsvorgänge. Sitzungsber Heidelb Akad Wiss Math Natwiss Kl 1950(1):1–86. Weberling F 1989 Morphology of flowers and inflorescences. Cambridge University Press, Cambridge. Williams RF 1975 The shoot apex and leaf growth. Cambridge University Press, Cambridge. Wright GM 1979 Self-incompatibility in Eschscholzia californica. Heredity 43:429–431. Yamaguchi T, N Nagasawa, S Kawasaki, M Matuoka, Y Nagato, HY Hirano 2004 The YABBY gene DROOPING LEAF regulates carpel specification and midrib development in Oryza sativa. Plant Cell 16:500–509. Zachgo S 2002 In situ hybridization. Pages 41–63 in PM Gilmartin, C Bowler, eds. Molecular plant biology. Vol 2. Oxford University Press, Oxford.