Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
(CANCER RESEARCH57. 2378-2383. June 15. 19971 Advances in Brief Characterization of the Human Homologue of RAD54: A Gene Located on Chromosome 1p32 at a Region of High Loss of Heterozygosity in Breast Tumors' Debora Rasio,2 Yoshiki Murakumo,2 David Robbins, Tim Roth, Aaron Silver, Massimo Negrini, Carl Schmidt, John Burczak, Richard Fishel,3 and Carlo M. Croce Kimmel Cancer institute and Kimmel Cancer Center. Thomas Jefferson University, Philadelphia. SmithKline Beecham Pharmaceuticals, King of Prussia, Pennsylvania 19406 (C. S.. J. B.. D. R.) Abstract A search of the Human Genome Sciences database of expressed se quence-tagged DNA fragments, for sequences containing homologj@to known yeast DNA recombination and repair genes, yielded a eDNA fragment with high homologj@to RADS4. Here we describe the complete eDNA sequence and the characterization of the genomic locus coding for the human homologue of the yeast RA.D54 gene (hR4D54). The yeast RAD54 belongs to the R.4D52 epistasis group and appears to be involved in both DNA recombination and repair. The hRAD54 gene maps to chromosome lp32 in a region of frequent loss of heterozygosity in breast tumors and encodes a protein of Mr 93,000 that displays 52% identity to the yeast RADS4 protein. The hRADS4 protein sequence additionally contains all seven of the consensus segments of a superfamily of proteins with presumed or proven DNA helicase activity. Mutations in genes with consensus helicase homology have been found in cancer-prone syndromes such as xeroderma pigmentosum and Bloom syndrome as well as Wern er's syndrome, in which patients age prematurely, and the X-linked mental retardation with a-thalassemia syndrome, ATR-X. We have ex amined the hR4D54 gene in several breast tumors and breast tumor cell lines and, although the gene region appears to be deleted in several tumors, at present we have found no coding sequence mutations. Introduction A loss of DNA repair functions that results in elevated mutation rates has been proposed to be the driving force responsible for the multiple mutations found in the development of tumors (1). The foundation for this hypothesis was garnered when it was shown that mutations of the human mismatch repair genes hMSH2 and hMLHJ accounted for the majority of hereditary nonpolyposis colon cancer cases (2—7),a common cancer predisposition syndrome that accounts for 6—10%of colon cancers (8—10).Although alteration of mismatch repair functions has been found to increase the rate of mutation in bacteria, yeast, and human cells, presumably via misrepair of misin corporation errors during chromosome replication (1 1—13),there ap peared to be a number of other mechanisms in which altered repair functions could lead to higher mutation rates. One of the most common alterations observed in tumors is the loss or rearrangement of chromosomes (14—16).The mechanism of this type of alteration has been proposed to be the result of chromosome pairing disorders prior to mitotic dysjunction, aberrant recombina Received 10/18/96; accepted 5/12/97. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement 18 U.S.C. Section 1734 solely to indicate this fact. I This work was supported by Outstanding Investigator Grant in accordance with CA39860 (to C. M. 3 To whom requests for equally reprints be addressed, (hRAD54) and mapped it to chromosomal region ip32. The short arm of chromosome 1 shows a complex pauern of internal deletions (26), suggesting the presence of tumor suppressor genes required for nor mal cellular maintenance. For example, chromosomal band lp32 has been identified as one of the four minimal regions of chromosome 1 deletion in breast carcinomas (27—29),and tumors of neural crest origin like medullary thyroid carcinomas and pheochromocytomas, together with meningiomas, show loss of genetic material (LOH4) at 1p32—pter(30—34).The predicted gene product ofthe hRAD54 is a Mr 93,000 protein belonging to a superfamily of DNA helicases (35). Mutations in genes with DNA helicase function have been found to be responsible for cancer-prone syndromes like xeroderma pigmentosum (36—38)and Bloom syndrome (39) as well as Werner's syndrome (40), in which patients age prematurely, and the X-linked mental retardation with a-thalassemia syndrome, ATR-X (41, 42). These results suggested that the hRAD54 gene could be a candidate modifier gene in tumors that display allelic imbalance at lp32. To test our hypothesis, we have determined the intron/exon structure of the hRAD54 gene and performed SSCP analysis on tumor genomic DNA to detect any potential mutations. Materials and Methods Database Search sequence from accession number for Novel DNA Repair the yeast DNA M63232) computer excision Enzymes. repair was used to screen enzyme The amino acid RAD54 (GenBank the HGS computer database software designed by the Genetics Computer Group (University of Wisconsin, Madison, WI). The HGS database contains to this work. should 19107 (D. R.. Y. M.. T. R., A. S.. M. N.. R. F.. C'. M. C'.). and tional repair processes, or loss of cell cycle check point functions that normally maintain chromosomal integrity (17, 18). The study of lower eukaryotes has identified several genes involved in chromosome pairing and recombinational repair which, if conserved in human cells, might be candidates for alteration in developing tumors (re viewed in Ref. 19). Yeast cells with mutations in the RAD54 gene display severe defects in the repair of DNA damage induced by ionizing radiation (20), in spontaneous and induced mitotic recombination (21), and in HO-catalyzed mating-type interconversion (22, 23). The RAD54 gene belongs to the RAD52 epistasis group that additionally includes RAD5I, RAD52, RAD55, and RAD57 (20, 24). Genes from this group have an established role in the repair of DNA double strand breaks, which are lethal if unrepaired in haploid yeast cells (25). A postulated role for the yeast RAD54 gene in recombinational repair is to provide access to regions of chromatin, thus making them available for recombination (24). We have cloned the human homologue of the RAD54 gene with the TFASTA C.) and NIH Grants CA56542 and CA57007 (to R. F.). 2 These authors contributed Pennsylvania at Kimmel Cancer Institute and Kimmel Cancer Center, Thomas Jefferson University, 233 South 10th Street, Philadelphia, PA 19107. Phone: (215) 503-1345; Fax: (215) 923-1098; E-mail: [email protected]. 4 The abbreviations used are: LOH, loss of heterozygosity; SSCP, single-strand con formational polymorphism; HGS, Human Genome Sciences; EST, expressed sequence tag; RACE, rapid amplification of cDNA ends; ORF, open reading frame. 2378 Downloaded from cancerres.aacrjournals.org on June 11, 2017. © 1997 American Association for Cancer Research. HUMAN HOMOLOGUE OF RAD54 nucleotide sequence information of ESTs (43), which identify a diverse col for 20 5, 72°C for 30 s, followed lection of cDNAs derived from more than 400 cDNA libraries. One EST (designated C2) was found to have significant homology but not identity to the were electrophoresed on a 1.5% agarose gel and visualized by ethidium bromide staining. The result of the screening was analyzed with the statistical RAD54proteinsequence,62% identityin a 126-aminoacid overlap.At the program DNA sequence level, the EST was found to have a 51% identity to the yeast RAD54 over 492 bases. In a separate comparison, the amino acid sequence from the human DNA excision repair enzyme ERCC6 (GenBank accession number L0479l; Ref. 44) was also used to screen the HGS database with score, >3.0), was given. Isolation of Genomic Clones. PrimersC2f and C2r were used for PCR screening revealed that one of them contained a 3.2-kb Northern Northern Analysis. A probe the entire hRAD54 blot (Clontech) derived from the insert of the cDNA ORF was used to hybridize according to the manufacturer's sensus and thymus with much lower expression in small intestine on chromosome BAC library (Research Genetics). lp32 (LOD Four positive at sites where from the hRAD54 was used for the comparison cDNA the sequence sequence. of the sequences. of the genomic The computer Intron program product FASTA size was determined by direct sequencing or by gel electrophoresis of inter-exon PCR products. A 5-untranslated region upstream (1.5 kb) of the hRAD54 start site was se quenced additionally. Analysis of the 5 ‘-untranslated region for transcription factor binding motifs was performed using the GENETEX-MAC analysis program. SSCP Analysis. Genomic DNAs from 17 breast cancer cell lines and 20 sporadic breast tumors vidual exons were analyzed were designed for mutations. on the basis of intronic Primers sequences. amplifying mdi PCR reactions were performed in 10 @.d of final volume with 20 ng of genomic DNA using 0.5 units of Taq DNA polymerase, 200 @.tM each of dATP, dGTP, and dTI'P, 2.0 @.LM ofdCTP, and [a-32P]dCTP at 0.5 MCi/reaction. Cycles were as follows: 95°Cfor 5 mm; then 22 cycles of 94°Cfor 15 s; 57°Cfor 20 s; 72°Cfor 20 s; followed by 5 mm of extension at 72°C.SSCP products were run on a 0.5 x clone MDE gel (FMC BioProducts) for 16 h and exposed for visualization by autoradiography The filter was washed with 0.5X SSC-l% SDS for 1.5 h at 60°Cand subjected to autoradiography for 16 h. A highly expressed 3.2-kb transcript was detected in testis splice junctions differed a multitissue protocol. genomic D1S443, Determination of Exon-Intron Boundaries and Intron Sizes. Primers derived from the cDNA were used for bidirectional sequencing of the genomic BAC clones. Exon-intron boundaries were identified by the presence of con insert encoding the entire ORF. Double-strand sequencing of this clone was performed by a cycle sequencing program using the dye-deoxynucleotide kit and Taq DNA polymerase (Perkin-Elmer). Nucleotide sequences were determined by an automated Applied Biosystem Sequencer model 377. containing of a human to marker Qiagen Plasmid Midi kit and used as template for sequencing analysis. identity in an 84-amino acid overlap). At the DNA sequence level, the EST was found to have a 64% identity to the human ERCC6 over 220 bases. The EST sequence was compared to the HGS database using the FASTA program (Genetics Computer Group), and two additional ESTs were found to give overlapping sequence identity. The three ESTs were assembled into a single consensus sequence of 401 bases with the SEQMAN routine of the LaserGene software package (DNAstar). eDNA Cloning. Primersfrom the 5' and 3' end of the C2 EST were used on peripheral blood cDNA to generate a PCR-derived probe for the screening of a normal testis ADR2 cDNA library (Clontech) by conventional plaque hybridization. Eight clones were initially isolated and excised in pDR2 plasmid according to the manufacturer's instructions. Sequence analysis of the eight clones and linkage at 72°C. PCR products clones were identified, and DNA from two of them was purified with the TFASTA. The same EST homologous to yeast RAD54 was found to have significant homology but not identity to the ERCC6 protein sequence (36.9% positive RHMAP, by 5 mm of extension on KODAK X-AR5 film. Results and colon Search of the HGS database for ESTs having homology to known yeast repair genes revealed the presence of a 400-bp EST, C2, having 62% homology to the yeast RAD54 protein. PCR primers were prepared from human testis poly(A) mRNA (Clontech) using a Promega designed that specifically amplified a l20-bp product when the human cDNA synthesis kit. The cDNA was then treated with RNase H, extracted with genomic DNA was used as a template and not when hamster DNA phenol, and precipitated with ethanol. The single-strand cDNA was used was used. This primer pair was used to screen the GeneBridge 4 directly in a RACE reaction. Four different oligonucleotides were used in this radiation hybrid panel constructed in hamster recipient cells to deter experiment: RACE anchor, 5'-CA COG ATC CAC TAT CGA UC TGG AAC; RACE primer, 5'-CCA GAA TCG ATA GTG GAT CCG T; mine the chromosomal map position of C2. The primers amplified a band of the expected size in 13 of the 93 hybrids forming the panel, hRAD54-A, 5'-GCC AAG CTC CTC CTC ATC CT; and hRAD54-B, 5'-CTG Ccc TCA GGT‘ITf CrC TTG. Di-deoxythymine(Perkin-Elmer)was added and computational analysis of the screening linked the C2 EST to to the RACE anchor using terminal transferase (Pharmacia Biotech). The marker D1S443, located on chromosomal band lp32. The screening RACE anchor was then ligated to the single-stranded cDNA for 6 h at 37°C was repeated twice, yielding identical results. To clone the full-length using RNA ligase (New England Biolabs) in 50 mM Tris (pH 7.8), 10 mM cDNA, we synthesized primers that amplified the entire C2 EST to magnesium chloride, 1 mMhexamine cobalt chloride, 20 ,.LMAlP, 10 @g/ml generate a PCR probe that was used for plaque hybridization of a BSA, and 50% polyethyleneglycol 8000, and this cDNA was used directly for testis cDNA library. Upon screening, eight different A clones, B I to PCR. The first round of PCR was carried out for 35 cycles using the RACE B8, were isolated. The cDNA inserts were excised from the A clones primer and hRAD54-A primer. One @.d of the resulting PCR product was then to generate plasmid clones, and nucleotide analysis was performed on used as a template for a second round of PCR using the RACE primer and both strands using insert-derived primers and primers derived from hRAD54-B primer for 25 cycles. PCR reaction was performed in 75 mMTris 9.0, 20 mMammonium sulfate, 2 mMmagnesium chloride, 0.01% Tween 20, the newly generated sequences. Sequence analysis of plasmid clone 10% glycerol, 0.2 mMeach of the 4 deoxynucleotide triphosphates, and 0.4 @M B5 (pBS)showedthatitsinsert,containing3135 nucleotides,included of each primer. Cycling temperatures consisted of 30 s at 94°C,1 mm at 50°C, an entire ORF with substantial homology to the yeast RAD54 protein and 1 rain at 72°Cand was performed in a Perkin-Elmer 2400. Amplified (termed hRAD54). Nucleotide sequence of the hRAD54 cDNA and its fragments were cloned using a TA cloning kit (InVitrogen) and sequenced predicted ORF are shown in Fig. 1. The first in-frame ATG start using a Sequenase 3.0 sequencing kit (United States Biochemical) or a ABI373 codon is present at nucleotide position 675, upstream of the ATG, in sequencer. The sequences 5‘-RACE product was found to be identical to the the 5'-untranslated region; in-frame stop codons are present at posi cDNA clone, suggesting that we have isolated the full-length hRAD54 cDNA. tions 657, 627, and 564. Downstream of the ATG, the ORF extends At present, we have been unable to identify or sequence the 4.0-kb mRNA until nucleotide 2915. A potential consensus AATAAA polyadenyl observed by Northern analysis. ation signal sequence is found at position 3090 of the cDNA, which Chromosomal Mapping. Primers C2f (AGCCCTGAC1TFGTCUCA) upstream of the poly(A) tail. The predicted protein and C2r (GCTTGTTCATCCATFGGCT), derived from C2 EST, were able to is 20 nucleotides of the hRAD54 gene contains 747 amino acids, encoding a Mr 93,000 amplify a l20-bp product on human genomic DNA. They were used for PCR screening of the GeneBridge 4 radiation hybrid mapping panel (Research protein with 52% identity to the yeast RAD54 protein. To isolate genomic clones containing the hRAD54 gene, a human Genetics). PCR reactions were carried out in a lO-pi final volume with the following conditions: 95°Cfor 5 mm, then 35 cycles of 94°Cfor 15 s, 57°C BAC library was screened by PCR, and two positive clones were mucosa. An approximately 4.0-kb minor transcript was also observed in testis. 5'-RACE Amplification of hRAD54. 5'-RACE (Apte, 1993 #842) was used to identify the 5' end of the hRAD54 cDNA. Random primed cDNA was 2379 Downloaded from cancerres.aacrjournals.org on June 11, 2017. © 1997 American Association for Cancer Research. HUMAN HOMOLOGUE OF R4D54 1 GGTCTTGGCGGGTCGGTGAGTCTTGGCGGCTGTTAACGCGCGCTTTGGGAACAGGAAGGTTGAGA 66 GAGAGGTGCTGGGGTCTGCGTCTATCTCTGTCGCTCTTTTCAGCCCCTCCTGGTATTCCCCTCCTAACCTGGGTTTTTTACACGCCC 15 3 GCGTGGCTTCCTGCTCGACCTCCCTGAGTCTGATCCTGGTTTCCACCTCCAGCCCTGGGAAATTTCCTTTCTCCAGACTCGCCCTCC 2 40 CCACCCGGGCCTCGGACTTTCACCCCAGCTTCTCTCTCCTGGCCAGTGATTACCCACCCCCAATCCCACCCCGCCCCGCCGCGCAAC 327 TACCTCCTCCCTTCACCCGGACTGGGACCATCATCCCCACTCCACTCCGCCCAGTCTGGGACTCCACCTGCCTCCTCcCCAATCCCA 4 14 CACTAATCTCTGCTTGGTCTCTTCCTCTTTGGCCTAATCTCTCGTCTCGGCTTATTGGGGACGGCCACTCTCACAGTTTGGTTCCAA 50 1 ACACCAGTTCCTGGATGGATTCCCGCCATCCATGCCCCCTCTTTAATTAGCCGGTCCTCTCAATAATGTAGCAGCCCCCTCTACAGA 588 TTAGACCCTGGTCCTACACTCTTAGCCGCTGCCTGCTTTTGACCTTTGGCTCATGGGTACTTGACGTTTTAAACTCCTAGGCCCAGG Met Arg Arg Ser Leu Ala Pro 6cr Gin Leu Ala Lye Arg Lye Pro Glu Gly Arg Ser Cys Asp Aep 675 ATG AGG AGG AGC TTG GCT CCC AGC CAG CTG GCC AAG AGA AAA CCT GAA GGC AGG TCC TGT GAT GAT Glu Asp Trp Gb Pro Gly Leu Val Thr Pro Arg Lye Arg Lys 6cr Ser Ser Glu Thr Glu Xl. Gln 22 44 742 GAA GAC TGG CAA CCT GGC CTA GTG ACT CCT AGG AAA CGG AAA TCC AGC AGT GAG ACC CAG ATC CAG Glu Cys Pbs Lsu Ser Pro Phe Arg Lys Pro Leu Ssr Gin Leu Thr Am Gin Pro Pro Cys Leu Asp 808 GAG TGT TTC CTG TCT CCT TTT CGG AAA CCT TTG AGT CAG CTA ACC AAT CAA CCA CCT TGT CTG GAC S.r Ser Gin His Giu Ala Phe Ii. Arg Ser lie L.u Ser Lys Pro Ph. Lys Val Pro Ii. Pro Asn 874 AGC AGT CAG CAT GAA GCA TTT ATT CGA AGC ATT TTG TCA AAG CCT TTC [email protected] CCC ATT CCA AAT Tyr Gin Gly Pro Leu Gly Ser Arg Ala Leu Giy L.u Lys Arg Ala Giy Vai Arg Arg Ala Leu His 9 40 TAT Asp 1006 GAC Lys 1072 AAG Pro 1138 CCT His 1204 CAT Thr 1270 ACA Ser 1 3 36 AGC Ii. 1402 ATC Arg 1468 AGG Lye 1534 AAA Tyr 1600 TAC Asp 1666 GAT Phe CAA Pro CCC Leu CTT His CAT Giy GGC Leu CTT Leu CTG Asp GAT Val GTG Giy GGA Gin CAA Lsu CTG Lye GGT Leu CTG Asp GAC Gin CAG Cys TGC Leu TTA Val GTG Giy GGA Her TCT Ser AGT Ala GCC L.u CTT Lye CCT Giu GAA Lys AAG Arg AGA lie ATC Arg CGC Lys AAG Giy GGA Her TCT Vai GTT Leu CTG Giu GAG His CTG Lys AAA Glu GAG Giu GAG It@t ATG Gin CAG Asn AAC S.r TCT Pro CCC Giy GGT Asp GAC Tyr TAT Phe GGC Asp GAT Lys AAA Giy GGA Ala GCT Ser AGT Trp TGG Lys AAG lie ATC Leu CTG 5cr AGC Pbs TTC Giu TCT Ala GCC Leu CTC Val GTG Asp GAT Pro CCA Tyr TAC Asp GAT Leu CTC Val GTC L.u TTG Car AGC L.u CGA L.u TTG Pro CCT Lys AAA Glu GAG Giu GAG Asn AAT Giu GAA lie ATC tie ATA Asn AAC L.u TTG Pro GCA Val GTT Vai GTC Pbs TTC Met ATG Cys TGC Giu GAG Ii. ATA Ii. ATT Cys TGT Tb.r ACC Vai GTA Ii. TTG Leu CTG His CAT Leu CTG Giy GGC Lys AAG Vai GTT Asp GAC Ser TCC Asp GAC Ser AGC His CAT Leu GGC Tyr TAT Val GTG Trp TGG Lou CTA Pro CCA Giy GGG Gin CAA Tyr TAT Giu GAG Arg CGG Phe TTT Lye CTG Glu GAG Vai GTT Giu GAG Gly GGA Giu GAA Lys AAA Lye AAG Giu GAG Giy GGA Arg CGG Vai GTT Giy AAA Pro CCT Vai GTT Cys TGT Lys AAG lie ATT Trp TGG Leu CTG Thr ACC His CAC Vai GTG Asn AAT Arg AGG Pro CCC Asp GAC Vai GTC Thr ACG Asp GAC Leu CTC Giu GAA Pbs TTC Arg AGG Leu CTC 8cr TCC Asp GCT Pro CCG Pro CCT Thr ACC Lou CTG Lys AAG Giy GGA Giy GGA Arg CGC Leu CTC lie ATC Giy GGC Ala GGG Leu CTG Ii. ATT Ser AGT Gin CAG Ala GCA Giy GGG Phe TTC Leu CTT Lye AAG 5cr TCC tie ATC Aia GTC Ser AGC Lou CTC Arg CGG Cys TGC Vai GTG Arg AGG Met ATG His CAT Asn AAC Giy GGA Leu CTA Aia CGC Ala GCT Her AGT Arg CGC Ii. ATC Vai GTG lie ATC Asn AAC Vai GTT Car TCT Thr ACT Giy GGG 6cr CGG His CAT Lys AAG Ii. ATC Thr ACA Vai GTG Gin CAA Gin CAG Giy GGA Giu GAG Pro CCC Thr ACT Giu GCC CTC Asp Gin GAC CAG Val Leu GTT TTG Pro Gly CCT GGC Lou Met TTG ATG Ser Pro TCG CCT Pro Leu CCT CTG XXX Giy CGN GGA Vai Leu GTC CTC Aan Gin AAT CAG Ii•Gin ATC CAG Ala His GCC CAT Ala Asp CAT Leu CTG Arg CGG Her AGC Trp TGG Ser TCC Ala GCC Ala GCC Gin CAG Thr ACT Mn AAT Giu GAA Arg 66 88 110 132 154 176 198 220 242 264 286 308 330 352 374 17 32 TTC AAG AAG CAT TTT GAA TTG CCA ATT TTG AAG GGT CGA GAC GCT GCT GCT AGT GAG GCA GAC AGG Gin Lou Giy Giu Giu Arg Leu Arg Giu Leu Thr Her Ii. Vai Asn Arg Cys Lou Ii. Arg Arg Thr 396 1798 CAG CTA GGA GAG GAG CGG CTG CGG GAG CTC ACC AGC ATT GTG AAT AGA TGC CTG ATA CGG AGG ACT 1864 6cr Asp Ii. Leu 6cr Lye Tyr Lsu Pro Val Lye XiS Giu Gin Vai Vai Cye Cye Arg L.u Thr Pro TCT GAT ATC CTT TCT AAA TAT CTG CCT GTG AAG ATT GAG CAG GTC GTT TGT TGT AGG CTG ACA CCC Leu Gin Thr Giu Lou Tyr Lye Arg Ph. Leu Arg Gin Ala Lys Pro Ala Giu Glu L.u L.u Glu Giy 418 440 193 0 CTT CAG ACT GAG TTA TAC AAG AGG TTT CTG AGA CAA GCC AAA CCG GCA GAA GAA TTG CTT GAG GGC Lye Met 8cr Vai Ser 5cr Leu 6cr 5cr Ii. Thr 6cr Leu Lye Lye Leu Cye ken His Pro Ala Leu 462 1996 AAG ATG AGT GTG TCT TCC CTT TCT TCC ATC ACC TCG CTA AAG AAG CTT TGT AAT CAT CCA GCT CTA 2062 Ii. Tyr Asp Lye Cye Vai Giu Giu Giu Asp Giy Phe Vai Giy Ala Leu Asp Leu Phe Pro Pro Giy ATC TAT GAT AAG TGT GTG GAA GAG GAG GAT GGC TTT GTG GGT GCC TTG GAC CTC TTC CCT CCT GGT Tyr 5cr Ser Lye Aia Lou Glu Pro Gin Leu Ser Gly Lye Met Leu Vei Leu Asp Tyr Ii. Leu Ala 484 506 2128 TAC AGC TCT AAG GCC CTG GAG CCC CAG CTG TCA GGT AAG ATG CTG GTC CTG GAT TAT ATT CTG GCG 2194 2260 Vai GTG Ph. TTT Lye Thr ACC Giu GAG Arg Arg CGA Lye AAG Ala 8cr AGC Leu CTG Lye Arg CGT Cys TGC Vai 5cr AGC Arg CGT Val 5cr AGT Ala GCC Giu Asp GAC Arg CGA Arg Lye AAA Arg AGG Phe Vai GTA Tyr TAC Aen Vai GTG Leu TTA Ser Leu CTG Tyr TAC Pro Val GTG Vai GTC 8cr Her TCG Arg CGC Ser ken AAT Leu CTG Pro Tyr TAC Asp GAT Asp Thr ACC Giy GGC Phe Gin CAG Thr ACG Vai Thr ACT Met ATG Ph. Leu TTG Ser TCC Met Asp GAT lie ATT L.u Leu CTC Lye AAG Ser 528 550 572 2326 AAG CGA GCC AAG GTT GTA GAA CGC TTC AAT AGT CCA TCG AGC CCT GAC TTT GTC TTC ATG CTG AGC 6cr 2 392 AGC Trp 2 45 8 TGG Tyr 2524 TAT Lye Lye AAA ken AAC I].. ATC Ala Aia GCT Pro CCA Tyr TAC Leu Giy GGG Ala GCC Arg CGC Her Giy GGC Asn AAT Leu CTG Her Cye TGT Asp GAT L.u CTG Cye Giy GGC Giu GA.A Ser TCT Vai Leu CTC Gin CAA Ala GCA Vai Asn AAT Ala GCC Giy GGG Asp Lou CTC Met ATG Thr ACC Giu Xi. ATT Ala GCC Ii. ATT Glu Giy GGG Arg CGG Glu GAG Gin Ala GCT Vai GTC Giu GAG Asp Asn AAC Trp TGG Lye AAG Vai Arg CGG Arg CGA Ii. ATC Giu Leu CTG Asp GAT Ph. TTC Arg Val GTC Gly GGT Gin CAG His Met ATG Gin CAA Arg CGT Ph. Phe TTT Lye AAG Gin CAG Ser Asp GAC Lye AAG Ser AGC Leu Pro CCT Thr ACT Hie CAC Giy Asp GAC Cye Lye AAG Giu 594 616 638 660 2 59 0 AAG GCA CTG AGC AGC TGT GTG GTG GAT GAG GAG CAG GAT GTA GAG CGC CAC TTC TCT CTG GGC GAG 2656 Leu Lye Giu Leu Phe lie L.u Asp Giu Ala Ser Leu Her Asp Thr His Asp Arg L.u His Cye Arg TTG AAG GAG CTG TTT ATC CTG GAT GAA GCT AGC CTC AGT GAC ACA CAT GAC AGG TTG CAC TGC CGA Arg Cye Vai Aen Ser Arg Gin Xi. Arg Pro Pro Pro Asp Giy Ser Asp Cye Thr Her Asp Leu Ala 682 704 2722 CGT TGT GTC AAC AGC CGT CAG ATC CGG CCA CCC CCT GAT GGT TCT GAC TGC ACT TCA GAC CTG GCA Giy Trp Am Hie Cye Thr Asp Lye Trp Giy Leu Arg Asp Giu Vai Leu Gin Ala Aie Trp Asp Ale 726 2788 GGG TGG AAC CAC TGC ACT GAT AAG TGG GGG CTC CGG GAT GAG GTA CTC CAG GCT GCC TGG GAT GCT 2854 Ala Her Thr Aia Ii. Thr Ph. Val Ph. His Gin Arg Her His Glu Giu Gin Arg Gly Leu Arg Stop GCC TCC ACT GCT ATC ACC TTC GTC TTC CAC CAG CGT TCT CAT GAG GAG CAG CGG GGC CTC CGC TGA 747 29 20 TAACCAGCTGGTCTGGGTGTAGCTCTTAGAGGAAGGAGATAGGGAAAAGGGGCTCCTTGCTCCACAGGGCCCTGTTGAATTTTGTTC 30 07 TTTGGGAGAAAATCATCAAGAAGGGCTGCATGATGTTTGCCCAAAATTTATTTTATAAGAAAAACTTTTTTGGTTAA@AA@@G@ 3094 @@GGTATGAAAGGGTTAAAAAAAAAAAAAA.AAAAAAAJ,AAAA Fig. I . Nucleotide sequence and predicted amino acid sequence of hRAD54. The sequence is in the one letter code (boldface) below coding sequence. A potential polyadenylation signal sequence is underlined. identified. Both BAC clones were subsequently found to contain the entire hRAD54 genomic locus. We compared the hRAD54 cDNA with cloned genomic DNA to determine the genomic organization of the hRAD54 locus (Fig. 2). The gene spans a minimum of 25 kb of DNA and consists of at least 18 exons. Length and relative position of FIRADS4 exons and introns are summarized in Table 1. Exon 1 is the 1 2 3 4 5 6 7 8 largest exon, spanning the first 677 bp of the pBS cDNA. We cannot exclude the presence of additional untranslated exons upstream of exon 1 because Northern analysis appears to suggest a larger minor transcript of4.0 kb in testis (Fig. 3). RACE amplification ofthe 5'-end suggests that the approximately 3.2-kb transcript starts at nucleotide 1 of our 3135 cDNA clone (data not shown). Within exon 1 lies the 9 10 11 12 13 14 15 16 1718 Fig. 2. Physical map of hRADS4. Exons are represented by boxes, introns by lines. Exon numbers are shown above each exon. 2380 Downloaded from cancerres.aacrjournals.org on June 11, 2017. © 1997 American Association for Cancer Research. HUMAN HOMOLOGUE OF RADS4 Table 1 Length and position of exons and introns of the hRAD54 gene DNA sequence analysis of this altered exon product revealed a C-to-T transversion, which resulted in a missense alteration (R587W). Be ExonLength (bp)1―>6771—6771103287678—764213003120765—88431100461885—945411005136946—108154426701082—1151611572891152—1440724681251441—15658520091511566 (bp)Position cDNAIntronLength cause this alteration is heterozygous with the wild-type sequence, it is likely to represent a sequence polymorphism, although we cannot rule out a dominant-negative mutation. Interestingly, some tumors ap peared to show LOH of one of the two alleles (data not shown), confirming the involvement of this chromosomal region in breast carcinomas. on Discussion We have cloned the human homologue of the RAD54 gene and mapped it to chromosome lp32. The hRAD54 gene encodes for a Mr 93,000 protein containing 747 amino acids and belongs to the SNF2 superfamily of DNA and RNA helicases, the members of which are involved in various aspects of DNA replication, repair, and gene expression. Proteins from this family share homology within seven conserved helicase motifs and in regions outside these motifs (35). The first motif(motifl) corresponds to the A-Box of the NTP-binding motif and lies within exon 7 of hRAD54. The consensus for motifs Ia and II, the latter corresponding to the B-Box of the NTP-binding motif, lies in exons 7 and 8—9of hRAD54, respectively. Conserved sequence for the remaining motifs are encoded by exons 9 (motif III), exons 10—11 (motif IV), exon 16 (motif V), and exons 17—18(motif VI) of hRAD54. A multitissue Northern blot revealed that hRADS4 was expressed as a 3.2-kb transcript primarily in testis and thymus, with lower (but detectable levels in small intestines, colon mucosa, breast, and prostate; Fig. 3). The function and/or translation of the low level 4.0 mRNA transcript observed in testis is unknown. This cx aThe5'endboundary ofexon 1wasnotdetermined. S // RAD54 Table 2 Sequences ofprimers ampl@fvingindividual hRAD54 exons Primer sequences 1 5‘ -CTAATCTCTCGTCTCGGC -3' 5'-TGACCCAGGGCTATTCCCA- 3' 5 ‘ -TAGGCTGCAGGATCCTTG- 3' 5 , -CTAGAAACCAAATCCTGGC-3' 5,-CCTGGCACTTAATAAGCAC -3' 5,-TGACTGGGCACAGACATAC -3' 273 5, -CCATAACATCTCCAGTCAG -3' 164 2 Fig. 3. Multitissue Northern blot analysis of hRAD54. A 3.2-kb transcript is detected primarily in testis and thymus tissues with lower levels ofexpression 3 in small intestine and colon mucosa. A minor 4.0-kb transcript can be identified in testis. PBL, peripheral blood 4 5,-CAGGCACACGTACATATG lymphocytes. presumptive ATG start codon at position 675—677,immediately be fore the 5'-end boundary ofintron 1. Introns 2—4,8—10,and 16 are the largest, and their sizes were determined by gel electrophoresis of inter-exon PCR products. The size of the remaining introns was determined by direct sequencing. All of the intronic splice sites confirm the GT-AG rule. We have evaluated the 5'-untranslated region (Gen.Bank accession number) for consensus transcription fac tor binding sites. A consensus TATA-Box2 was found at position — 1.01 kb relative to the cDNA initiation site. In addition, 1 1 Spi 5 , -CTGGAGCTCCTAAACATAG- 6 5 , -GCGTGCATATACAGAGAAC-3' 5‘ -TTGCCCATGTGTGAGCAC -3' 5'-ACTTTGGCACCTACGCTG- 7a 5'-AGCGTAGGTGCCAAAGTG5 ,-AGTTCTTCACCAGGCTGG 7b 8 9 257 3@ 238 207 3' 3' 240 -3' 5‘ -CTGCAGTGCATCACATTGA- 3' 5 , -TAAGAAAGCAGCAGGCTG-3' 5'-AGATTCTGAATTGTTCCC-3' 5 , -GGCAATACTCAGTGAAGAG-3' 253 5, -TACCGTATAGGGAATGCC -3' 253 S‘ -AAAGACAAGGCAGGGCTC 10 208 -3' 5 II sites, 1 AP1 site, and 1 NFl consensus sites were identified in this 1.5-kb upstream region. Expression of an approximately 3.2-kb hRAD54 transcript was primarily detected in testis and thymus with low levels of expression in small intestines and colon mucosa (Fig. 3). In addition, low level expression was observed in breast and prostate (data not shown). To evaluate whether the hRAD54 gene was altered in tumors showing LOH at lp32, genomic DNAs from 17 breast tumor cell lines and 20 sporadic breast tumors were analyzed by SSCP. Table 2 summarizes the primers used for the amplification of each single exon. Exons 7 and 18 where divided into two segments to generate PCR products suitable for SSCP. A single heterozygous alteration in the pattern of the bands was found in exon 16 of the BT-20 breast tumor cell line. Length of product (bp) Exon 5‘ -CTGCCATCACTAGCTGTG5,-AAGGATTGGCCATGGATG- 231 -3' 3' 3' 5'-GCATGGCAATTTTACCAGC3' 259 I74 5' -TTCAGGAGCTAGGCTTTG- 3' 12 5'-ATCAAGGTGTTCTCAGAGG5 ,-TTGCTCACTCTCACAGAG 3' -3' 241 13 5‘ -CTAGTGAACACTGAAGTGG -3' 5' -GAAACAGGACAGCCCTAG- 3' 5‘ -AAGAAGCCTGGGCCATTG- 3' 5 , -AGACAGACAGTAGGGGAG-3' 258 14 15 5‘ -TCCCCCTAATCATTGAAGC-3' 5 ,-CTGATGATACTGCATTGG 16 17 l8a l8b 293 257 3' 5'-AGTGCCCTAACCATTATC- 3' 5' -TGGAAGACGAAGGTGATA- 3' 5'-CCACTGCACTGATAAGTG- 3' 5 ,-ATGCAGCCCTTCTTGATG- 176 -3' 5‘ -CAGGATCCCAGTTTAGGC -3' 5,-CTGAAGATCTCGTTCCATG -3' 5 ‘ -ATGGCTAAGCGCTGTATC -3' 5'-ACTGTGTGGGTAGCTTAG- 244 258 242 3' 2381 Downloaded from cancerres.aacrjournals.org on June 11, 2017. © 1997 American Association for Cancer Research. HUMAN HOMOLOGUE OF RAD54 pression pattern is generally typical of genes involved in DNA re combination and repair (45, 46). DNA helicases unwind duplex DNA, forming single-stranded DNA that is accessible for replication, recombination, and repair. They play pivotal roles in ensuring fidelity in the transmission of genetic infor mation. Indeed, mutations in genes with proven DNA helicase activity have been implicated in a variety of genetic disorders, including cancer-prone syndromes like xeroderma pigmentosum and Bloom syndrome. The hypothesis that loss of function of genes that safeguard genome stability accelerates the tumorigenic process through accu mulation of genetic alterations is supported by the finding that loss of MSH2 function in homozygous mice predisposes the animals to develop tumors (47—49). Several groups have identified deletions involving most or all of the short arm of chromosome I are the most frequent genetic alterations found in tumors of neural crest origin like pheochro mocytoma and medullary thyroid carcinoma (30—31). Further more, the loss of genetic material at lp32—pter is detected in meningiomas (32, 34), and this loss appears correlated to tumor progression. In breast cancer, four discrete regions of allelic im balance have been defined, suggesting the presence of several genes involved in tumor development. One of these regions is located at chromosomal band lp32, where LOH was detected in 47% of the tumors analyzed. We tested whether hRAD54 was altered in breast tumors because we found it to be located in one of the most common regions of LOH in this tumor type. We found no clearly identifiable alterations of hRAD54 coding or intron/exon sequence. These results appear to exclude the involvement of hRAD54 in the pathogenesis of sporadic breast cancer. However, we cannot exclude the possibility that there are alterations in the 5'-untranslated region that result in altered expression of hRAD54. The role of hRAD54 in other tumors with deletions at lp32 remains still to be defined. In conclusion, we have cloned the human homologue of the RAD54 gene and mapped it to a region of importance in a variety of solid tumors. The structural characterization of its genomic locus will help in under standing its possible involvement in malignancies in the attempt to link repair pathways with tumor development and progression. Note Added in Proof Lynch, J. F., and Cavalieri, J. Hereditary colorectal cancer. Semin. Oncol., 18: 337—366, 1991. 9. Bishop. T. D., and Thomas, H. The genetics of colorectal cancer. Cancer Sun,., 9: 585—604, 1990. 10. Lynch, H. T., Smyrk, T. C., Watson, P., Lanspa, S. J., Lynch, J. F., Lynch, P. M., Cavalieri, R. J., and Boland, C. R. Genetics, natural history, tumor spectrum, and pathology of hereditary nonpolyposis colorectal cancer: an updated review. Gastro enterology, 104: 1535—1549,1993. I 1. Siegel, E. C., and Bryson, V. Mutator gene of Escherichia coli B. J. Bacteriol., 94: 38—47, 1967. I 2. Reenan, R. A. 0., and Kolodner, R. D. Characterization of insertion mutations in the Saccharomyces cerevisiae MSHI and MSH2 genes: evidence for separate mitochon drial and nuclear functions. Genetics, 132: 975—985,1992. 13. Bhattacharyya. N. P., Skandalis, A., Ganesh, A., Groden, J., and Meuth, M. Mutator phenotype in human colorectal carcinoma cell lines. Proc. Natl. Acad. Sci. USA, 91: 6319—6323, 1994. 14. Pilot, H. C., Goldsworthy, T., and Moran, S. The natural history of carcinogenesis: implications of experimental carcinogenesis in the genesis of human cancer. J. Supramol. Struct. Cell. Biochem., 17: 133—146,1981. 15. Balaban, G. B., Herlyn, M., Clark, W. H., Jr., and Nowell, P. C. Karyotypic evolution in human malignant melanoma. Cancer Genet. Cytogenet., 19: 113—122,1986. 16. Croce, C. M. Role of chromosome translocations in human neoplasia. Cell, 49: 155—156, 1987. 17. Hartwell, L. H., and Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science (Washington DC), 246: 629—634, 1989. 18. Cheng. K. C., and Loeb, L. A. Genomic Instability and Tumor Progression: Mech anistic Considerations, Vol. 60, p. 121—156.San Diego, CA: Academic Press, Inc., 1993. 19. Friedberg, E. C., Walker, G. C., and Siede, W. DNA Repair and Mutagenesis. Washington, DC: American Society for Microbiology, 1995. 20. Game, J., and Mortimer, R. K. A genetic study of X-ray sensitivity in mutants in yeast. Mutat. Res., 24: 281—292,1974. 21. Saeki, T., Machida, I., and Nakai, S. Genetic control of diploid recovery after y-irradiation in the yeast Saccharomyces cerevisiae. Mutat. Res., 73: 251—265, 1980. 22. Malone, R. E., and Esposito, R. E. The ra452 gene is required for homothallic interconversion of mating types and spontaneous mitotic recombination in yeast. Proc. Nat. Acad. Sci. USA, 77: 503—507,1980. 23. White, C. I., and Haber, J. E. Intermediates of recombination during mating type switching in Saccharomyces cerevisiae. EMBO J., 9: 663—673, 1990. 24. Game, J. C. DNA double-strand breaks and the RAD5O-R.AD57 genes in Saccharo myces. Cancer Biol., 4: 73—83,1993. Thaler, D. S., and Stahl, F. W. DNA double-chain breaks in recombination of phage Biol., 6: 828, 1996), and a knockout mouse 113—154, 1996. 27. Bieche, I., Champeme, M-H., Matifas, F., Cropp, C. S., Callahan, R., and Lidereau, in the R.4D54-deficient 28. has been generated (Bezzubova et a!., Cell, 89: 185, 1997). No evidence for enhanced has been reported D., Seldin, M. F., van Roy. N., and Vance, J. Report of the second international workshop on human chromosome I mapping 1995. Cytogenet. Cell Genet., 72: R. Two distinct regions involved in ip deletion in human primary breast cancer. The human and mouse homologues of the RADS4gene have been described tumorigenesis instability and mutation analysis of hMSH2 and hMLHI in patients with sporadic, familial and hereditary colorectal cancer. Hum. Mol. Genet., 5: 1245—1252,1996. 7. Fishel, R., and Kolodner. R. D. Identification of mismatch repair genes and their role in the development of cancer. Curr. Opin. Genet. Dev., 5: 382—395,1995. 8. Lynch, H. T., Smyrk, T., Watson, P., Lanspa, S. J., Boman, B. M., Lynch, P. M., 1 and of yeast. Ann. Rev. Genet., 22: 169—197,1988. 26. Weith, A., Brodeur, G. M., Bruns, G. A. P., Matise, T. C., Mischke, D., Nizetic, We thank Dr. Christoph Schmutte for help with the preparation of figures. et a!. (Curr. 55: 242—248,1995. 6. Moslem, G., Tester, D. J., Lindor, N. M., Honchel, R., Cunningham, J. M., French, A. J., Hailing, K. C., Schwab, M., Goretzki, P., and Thibodeau, S. N. Microsatellite 25. Acknowledgments by Kanaar MUll locus and analysis of a largeHNPCC kindred for mlhi mutations. Cancer Res., 29. mouse. 30. References I . Loeb, L. A. Mutator phenotype may be required for multistage carcinogenesis. Cancer 31. Res.,51: 3075—3079.1991. 2. Fishel, R. A., Lescoe, M. K., Rao, M. R. S., Copland, N., Jenkins, N., Garber, J., Kane, M., and Kolodner, R. The human mutator gene homolog MSH2 and its association with hereditary nonpolyposis colon cancer. Cell, 75: 1027—1038, 1993. 3. Bronner, C. E., Baker, S. M., Morrison, P. T., Warren, G., Smith, L. G., Lescoe, M. K., Kane, M., Earabino, C., Lipford. J., Lindblom, A., Tannergard, P., Bollag, R. J., Godwin. A. R., Ward, D. C., Nordenskjold, M., Fishel, R., Kolodner, R., and Liskay, R. M. Mutation in the DNA mismatch repair gene homologue hMLIi1 is associated with hereditary nonpolyposis colon cancer. Nature (Land.). 368: 258—261. Cancer Res., 53: 1990—1994, 1993. Munn. K. E., Walker, R. A., and Varley, J. M. Frequent alterations of chromosome I in ductal carcinoma in situ of the breast. Oncogene, 10: 1653—1657,1995. Hoggard, N., Brintnell, B., Howell, A., Weissenbach, J., and Varley, J. Allelic imbalance on chromosome I in human breast cancer. II. Microsatellite repeat anal ysis. Genes Chromosomes Cancer, 12: 24—31,1995. Moley, J. F., Brother, M. B., Fong, C-T., White, P. 5., Baylin, S. B., Nelkin, B., Wells. S. A., and Brodeur, G. M. Consistent association of lp loss of heterozygosity with pheochromocytomas from patients with multiple endocrine neoplasia type-2 syndromes. Cancer Res., 52: 770—774, 1992. Mulligan, L. M., Gardner, E., Smith, B. A., Mathew, C. G., and Ponder, B. A. Genetic events in tumor initiation and progression in multiple endocrine neoplasia type 2. Genes Chromosomes Cancer, 6: 166—177,1993. 32. Bello, M. J., de Campos, J. M., Kusak, M. E., Vaquero, J., Sarasa, J. L., Pestana, A., and Rey, J. A. Allelic loss at lp is associated with tumor progression of meningiomas. Genes Chromosomes Cancer, 9: 296—298, 1994. 33. Bello, M. J., Vaquero. J., de Campos, J. M., Kusak, M. E., Sarasa, J. L., Castresana, J., Pestana, A., and Rey, J. A. Molecular analysis of chromosome 1 abnormalities in human gliomas reveals frequent loss of lp in oligodendroglial tumors. mt. J. Cancer. 57: 172—175. 1994. 34. Simon, M., von Deimling, A., Larson, J. J., Wellenreuther, 1994. 4. Kolodner, R. D., Hall, N. R., Lipford, J., Kane, M. F., Rao, M. R. S., Morrison, P., Wirth, L., Finan, P. J., Burn. J., Chapman, P., Earabino. C., Merchant, E., and Bishop, T. Structure of the human MSH2 locus and analysis of two Muir-Torre kindreds for msh2 mutations. Genomics, 24: 516—526,1994. 5. Kolodner, R. D., Hall, N. R., Lipford, J., Kane, M. F., Morrison, P., Finan, P. J., Bum, J., Chapman, P., Erabino, C., Merchant, E., and Bishop, D. T. Structure of the human R., Kaskel, P., Waha, A., Warnick, R. E., Tew, J. M., Jr., and Menon, A. G. Allelic losses on chromosomes 14, 10, and I in atypical and malignant meningiomas: a genetic model of meningioma progression. Cancer Res., 55: 4696—4701, 1995. 35. Matson, S. W., and Kaiser-Rogers, K. A. DNA helicases. Annu. Rev. Biochem., 59: 289—329, 1990. 36. Weeda, G., van Ham, R. C., Vermeulen, W., Bootsma, D., van der Eb, A. J., and 2382 Downloaded from cancerres.aacrjournals.org on June 11, 2017. © 1997 American Association for Cancer Research. HUMAN HOMOLOGUE OF RAD54 Hoeijmakers, J. H. A presumed DNA helicase encoded by ERCC-3 is involved in the Xiao, H., Mcml, C. R., Wu, A., Olde, B., Moreno, R. F., et al. Complementary DNA humanrepairdisordersxerodermapigmentosumandCockayne'ssyndrome.Cell,62: sequencing: expressed sequence tags and human genome project. Science (Washing 777—791,1990. 37. Weber, C. A., Salazar, E. P., Stewart, S. A., and Thompson, L. H. ERCC2: eDNA cloning and molecular characterization of a human nucleotide excision repair gene with high homology to yeast RAD3. EMBO J., 9: 1437—1447,1990. ton DC), 252: 1651—1656, 1991. 44. Troelstra, C.. van Gool, A., de Wit. J., vermeulen, 38. Sung, P., Bailly, V., Weber, C., Thompson, L. H., Prakash, L., and Prakash, S. Human xerodermapigmentosum W., Bootsma, D., and Hoeijmakers,J. H. ERCC6,a memberof a subfamilyof putativehelicases,is group D gene encodes a DNA helicase. Nature (Land.), 365: 852—855,1993. 39. Ellis, N. A., Groden, J., Ye, T. Z., Straughen, J., Lennon, D. J., Ciocci, S., Proytcheva, M.. and German, J. The Bloom's syndrome gene product is homologous to RecQ heicases. Cell, 83: 655—666, 1995. 40. Yu, C. E., Oshima. J., Fu, Y. H., Wijsman, E. M., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Goals, S., Martin, G. M., Mulligan. J., and Schellenberg, G. D. Positional cloning of the Werner's syndrome gene. Science (Washington DC), 272: 258—262,1996. 41. Gibbons, R. J., Pickeus, D. 3., Villard, L., and Higgs, D. R. Mutations in a putative global transcriptional regulator cause X-linked mental retardation with a-thalassemia (ATR-X Syndrome). Cell, 80: 837—845, 1995. 42. Stayton, C. L., Dabovic, B., Gulisano, M., Gecz, J., Broccoli, V., Giovanazzi, S., Bossolasco, M., Monaco, L., Rastan, S., Boncinelli, E., Bianchi, M. E., and Consalez, G. 0. Cloning and characterization of a new human Xq13 gene, encoding a putative helicase. Hum. Mol. Genet., 3: 1957—1964,1994. involved in Cockayne's syndrome and preferential repair of active genes. Cell, 71: 939—953, 1992. 45. Wilson, T. M., Ewel, A., Duguid. J. R., Eble. J. N., Lescoe, M. K., Fishel, R., and Kelley, M. R. Differential cellular expression of the human MSH2 repair protein in small and large intestine. Cancer Res., 55: 5 146—5150, I995. 46. Acharya. S., Wilson, T., Gradia, S., Kane, M. F., Guerrette, S., Marsischky, G. T., Kolodner, R., and Fishel, R. hMSH2 forms specific mispair-binding complexes with hMSH3 and hMSH6. Proc. Nat. Acad. Sci. USA, in press, 1996. 47. de Wind, N., Dekker, M., Berns, A., Radman, M., and te Ride, H. Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination and predisposition to cancer. Cell, 82: 321—330,1995. 48. Reitmair, A. H., Scmits, R., Ewel, A., Bapat, B., Redston, M., Mitri, A., Waterhouse, P., Miurucker, H-W., Wakeman, A., Liu, B., Thomason, A., Griesser, H., Gallinger, S., Ballhausen, W. G., Fishel, R., and Mak, T. W. MSH2 deficient mice are viable and susceptible to lymphoid tumours. Nat. Genet., Ii: 64—70, 1995. 49. Reitmair, A. H., Redston, M., Cai, J. C., Chuang, T. Y. C., Bjerknes. M., Cheng, H., 43. Adams, M. D., Kelley, J. M., Gocayne, J. D., Dubnick, M., Polymeropoulos, M. H., Hay, K., Gallinger, S., Bapat, B., and Mak, T. W. Spontaneous intestinal carcinomas and skin neoplasms in MSH2-deficient mice. Cancer Rca., 56: 3842—3849,1996. 2383 Downloaded from cancerres.aacrjournals.org on June 11, 2017. © 1997 American Association for Cancer Research. Characterization of the Human Homologue of RAD54: A Gene Located on Chromosome 1p32 at a Region of High Loss of Heterozygosity in Breast Tumors Debora Rasio, Yoshiki Murakumo, David Robbins, et al. Cancer Res 1997;57:2378-2383. Updated version E-mail alerts Reprints and Subscriptions Permissions Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/57/12/2378 Sign up to receive free email-alerts related to this article or journal. To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at [email protected]. To request permission to re-use all or part of this article, contact the AACR Publications Department at [email protected]. Downloaded from cancerres.aacrjournals.org on June 11, 2017. © 1997 American Association for Cancer Research.