Download Function of E. coli RNA Polymerase Factor 70 in

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA replication wikipedia , lookup

Helicase wikipedia , lookup

DNA nanotechnology wikipedia , lookup

Microsatellite wikipedia , lookup

DNA polymerase wikipedia , lookup

Replisome wikipedia , lookup

Helitron (biology) wikipedia , lookup

Transcript
Cell, Vol. 86, 485–493, August 9, 1996, Copyright 1996 by Cell Press
Function of E. coli RNA Polymerase s Factor
s70 in Promoter-Proximal Pausing
Brian Z. Ring, William S. Yarnell,
and Jeffrey W. Roberts
Section of Biochemistry, Molecular and Cell Biology
Cornell University
Ithaca, New York 14853
Summary
The s factor s70 of E. coli RNA polymerase acts not only
in initiation, but also at an early stage of elongation to
induce a transcription pause, and simultaneously to
allow the phage l gene Q transcription antiterminator
to act. We identify the signal in DNA that induces early
pausing to be a version of the s70 210 promoter consensus, and we show that s70 is both necessary for
pausing and present in the paused transcription complex. Regions 2 and 3 of s70 suffice to induce pausing.
Since pausing is induced by the nontemplate DNA
strand of the open transcription bubble, we conclude
that RNA polymerase containing s70 carries out basespecific recognition of the nontemplate strand as single stranded DNA. We suggest that s70 remains bound
to core RNA polymerase when the 210 promoter contacts are broken, and then moves to the pause-inducing sequence.
Introduction
s factors of bacterial RNA polymerase mediate recognition of promoters, and possibly the opening of duplex
DNA, to allow initiation of RNA synthesis (Burgess et
al., 1969; Helmann and Chamberlin, 1988; Gross et al.,
1992). Essential elements of promoters reside upstream
of the initiation site; for the predominant E. coli s factor
s70, for example, these are sequences centered at 235
and at 210 (Figure 1) (McClure, 1985). A few nucleotides
of the transcript, usually no more than 10, are made
while the holoenzyme remains fixed to these recognition
sequences (McClure, 1985). At some juncture, the recognition sequences contacted at 235 and 210 by s in
holoenzyme are released, and the enzyme transitions
to a distinct elongation conformation (Carpousis and
Gralla, 1985; Straney and Crothers, 1987; Krummel and
Chamberlin, 1989). It is believed that s 70 separates entirely from core enzyme at some time during or after
this transition; it is at least true that s 70 usually can be
released in vitro after 5–10 nucleotides of RNA are made
(Hansen and McClure, 1980; Krummel and Chamberlin,
1989), and the remaining core enzyme then is competent
for elongation and termination of transcription.
We have found that s70 acts in an unexpected way
after RNA synthesis initiates at the bacteriophage l late
gene promoter: it mediates a transcription pause that
is related to the transcription antitermination activity of
the phage l gene Q protein. RNA polymerase pauses
both in vitro and in vivo for the order of a minute after
transcribing 16 and 17 nucleotides of the l late gene
transcript (Grayhack et al., 1985; Kainz and Roberts,
1992; Yarnell and Roberts, 1992). This pause is encoded
primarily in nontemplate strand bases of the transcription bubble, particularly at 12 and 16 (Ring and Roberts,
1994). Only the naturally paused complex has the correct
conformation or components to be modified in vitro by
the gene Q antiterminator, as assayed either by footprinting of Q protein bound in the complex or by transcription antitermination downstream; a complex made
of mutant DNA (e.g., mutant at 12 or 16), in which RNA
synthesis is stopped by lack of a nucleotide substrate at
the site of the wild-type pause, is competent for neither
modification (Yarnell and Roberts, 1992).
The transcribing complex paused at 116/17 has many
essential properties of an elongation complex. According to both MPE and exonuclease footprinting, the
RNA polymerase-s70 contact has been released from
the 235 segment, and, almost certainly, from the 210
segment as well, although some pause-specific interactions do occur near the 210 segment (Yarnell and Roberts, 1992). The length of the exonuclease footprint,
about 30–35 nucleotides, is typical of elongation complexes. The paused complex is stable to incubation and
to filtration, in contrast to complexes that contain abortive RNAs. RNA polymerase initiated at the late gene
promoter of a related lambdoid phage, phage 82, contains RNA paused at 125, even farther from the promoter (Yang et al., 1989; Guo, 1990).
These characteristics would give rise to the expectation that s 70 has been released at the 116/17 pause. In
contrast, we have found that s70 is present in the paused
complex—both at 116/17 for l and at 125 for phage
82—and that s70 is necessary for the pause to occur.
Furthermore, major elements of the sequence in the
early transcribed segment that induces the pause are
similar or identical to the s70 210 consensus. Thus it
appears that s 70 releases from the promoter and then
rebinds to the early transcribed segment, thereby inducing the pause. Since the pause is induced primarily by
the nontemplate DNA strand, an important implication
is that s 70 also makes base-specific contacts to nontemplate strand DNA of the 210 sequence in open promoter
complexes (Roberts and Roberts, 1996). We describe
here the evidence for s70 involvement in pausing, implications for s70 function and its release after the elongation complex forms, and possible relations to the activity
of the l gene Q antiterminator protein.
Results
Two major sequence determinants of pausing at 116/
117 of the l late gene promoter are an A at 12 and a
T at 16 of the nontemplate DNA strand (Figure 1), in
each of which mutation reduces pausing on the order of
10-fold (Yang, 1988; Kainz and Roberts, 1992; Roberts,
1992; Yarnell and Roberts, 1992). There is a similar sequence displaced 8 nucleotides farther downstream in
the phage 82 late gene promoter region, for which mutations of A and T at 110 and 114 strongly reduce pausing
at 125 (Guo, 1990). We have shown for l that changing
Cell
486
Figure 1. DNA Structures of Open and
Paused Promoter Complexes of the Phage l
Late Gene Promoter pR9
Melted regions of the open promoter were
determined by Kainz and Roberts (1992).
Matches to consensus of promoter elements
in the 235 and 210 regions are shown. This
“extended 210” sequence contains the most
important bases for promoter function (Kumar et al., 1993); its match to the pauseinducing sequence is also shown.
the base in these positions in the nontemplate strand
of DNA strongly affects pausing, whereas changing the
template strand base has relatively little effect (Ring and
Roberts, 1994). A comparison of the disposition of these
bases in the paused complex and the bases of the conserved 210 consensus in the open complex (Figure 1)
shows a striking similarity: the A at 12 and T at 16 are
congruent with the most highly conserved A and T of the
210 consensus (underlined here), TATAAT. This relation
holds among five examples of pause-inducing sequences in lambdoid phages (Figure 2) and involves
presumptive matches to other strongly conserved elements of the “extended 210” consensus: T-TG-TATAAT
(Keilty and Rosenberg, 1987; Kumar et al., 1993), which
includes an additional 59 segment. The best match to
this consensus, 7/9 bases including the highly conserved A and T, occurs in DNA that induces the pause
most distant from the start site, that for the phage 82
late gene transcript at 125.
There also exist important elements of these pauseinducing sequences that are not part of the 210 consensus, including particularly a G/C rich segment after the
final T (Ring and Roberts, 1994); we discuss these sequences further below.
Figure 2. Match of Lambdoid Bacteriophage Late Gene Promoter
Pause-Inducing Sequences to Important Elements of the Extended
210 Consensus
Pause sites and DNA sequences for l, 21, and phage 82 were
described (Grayhack et al., 1985; Goliger and Roberts, 1989; Guo,
1990; Guo et al., 1990); the DNA sequence for phage 80 was determined by L. Matthews, D. Kadosh, and J. W. R. (unpublished data),
and its features were surmised by analogy with l. The initiation site
is designated by the arrow, and the pause site is underlined.
A Consensus 210 Sequence Induces
Efficient Pausing
If the pause-inducing sequence includes a reiteration
(although possibly a variant) of the 210 consensus sequence, then substitution of the full consensus for an
otherwise weak pause-inducing signal should increase
pausing. To test this, we used a derivative of the wildtype l sequence in which pausing is greatly weakened
by displacement of the pause-inducing sequences
downstream by means of a 10 bp insertion at 11 (template X10#1); we consider below why the pausing is
weaker in this DNA. Figure 3 shows that the pause is
displaced downstream in transcription from [X10#1] to
127/28, an amount consistent with the insert length,
and is very weak relative to wild type. The template
X10#1CON has 5 nucleotides of the X10#1 sequence
changed to bring the pausing sequences to full extended 210 consensus; in contrast to X10#1, it supports
efficient pausing at the displaced position (see also Figure 6).
s70 Is Required for Pausing
The apparent equivalence of the pause-inducing and
s70 210 consensus sequences naturally suggests, but
does not demand, that s70 must be present for pausing
to occur at 116/17. A contrary possibility, for example,
is that a site in core enzyme at least partly forms the
base-specific contacts mediated during promoter recognition by s70 , and this site can bind the nontemplate
DNA strand to induce pausing even in the absence of
s70 . To test this possibility, we used the discovery that
core enzyme initiates accurately, if bidirectionally, from
the edge of a 12 base heteroduplex bubble extending
from 210 to the start site (Aiyar et al., 1994). Holoenzyme
also initiates accurately from the bubble (Aiyar et al.,
1994), allowing initiation to occur with or without s70 , so
that the effect of s 70 on pausing can be tested.
We constructed two bubble heteroduplex templates
in which an arbitrary but completely variant sequence
replaced DNA of either strand from 212 to 11. Figure
4 shows that transcription of both templates by either
core or s70 holoenzyme yields a distinct runoff, z100
s Factor Induces a Transcription Pause
487
Figure 3. Effect of the Extended 210 Sequence on Pausing at 10
bp Displacement
The autoradiogram shows a gel resolution of transcripts of l1 pR9
DNA, a l pR9 variant with 10 bp of extraneous DNA introduced just
before the site of the first transcribed base (X10#1), and a further
variant in which the 10 bp insert DNA is modified to match the
extended 210 consensus in the region that induces pausing (X10#1
con). In addition to changes made to match the consensus T-TGTATAAT, there is a change to pyrimidine at 210 (Kumar et al., 1993)
and an irrelevant change at 15. Matches to the extended 210 sequence are shown by bullets. RNAs below the 116/17 pause RNAs
are abortive initiation products, which vary in pattern and intensity
with different initial transcribed sequences.
nucleotides in length. Although Aiyar et al. (1994) reported bidirectional transcription from bubbles, we find
accumulation mostly of the 100 nucleotide rightward
transcript with or without s 70, from either bubble; conceivably, upstream sequences recognized by the a subunit of RNA polymerase (Ross et al., 1993) orient the
synthesis. The important result is that both core and
holoenzyme make runoff transcripts, whereas only holoenzyme yields transcripts at a significant level at the
site of pausing. On the wild-type template strand bubble
holoenzyme makes two strong transcripts at 116/117,
exactly coinciding with the natural paused RNAs,
whereas core enzyme gives only a faint background
of short products. The template strand mutant bubble
produces a pair of transcripts about a nucleotide
shorter, presumably corresponding to its shorter runoff
transcript. (Whereas runoff synthesis with wild type template strand bubble exactly matches that of homoduplex
DNA, runoff from the mutant template strand bubble is
slightly shorter, possibly because the enzyme seeks the
first convenient template site for its preferred purine
initiation base, at 12 of the wild-type sequence.) Thus
core initiates accurately from the bubble, but fails to
recognize the pause-inducing 210 consensus in the
early transcribed segment: s70 is required for the pauseinducing sequence to be recognized.
Transcription of bubbles does not exactly replicate
that of natural DNA. First, it was difficult to determine if
the prominent transcripts at 116/117 are paused rather
than arrested permanently, because the inactivity of the
initiation inhibitor rifampcin in blocking synthesis from
bubbles prevented single round synthesis (Ring, 1995).
But pausing and arrest are closely related in any event,
since a few sequence changes in the early transcribed
segment, particularly just after the final T, can convert
a 210 consensus-induced pause at 125 of phage 82 to
an arrested complex (Yarnell and Roberts, unpublished
data). Second, there is a background of short transcripts
extending to about 118 that is not made by holoenzyme
on natural DNA. Since the 116/117 RNAs made from
bubble templates are within this background, it could
be argued that they arise in some way unrelated to
pausing. We thus performed two further analyses. First,
we used a bubble template in which a consensus pauseinducing sequence is displaced downstream 6 nucleotides relative to the wild-type sequence; both core and
holoenzyme again yield runoff, and in this case the
pause is 6–7 nucleotides farther downstream at 123,
away from the background, and again is dependent
upon s 70 (Figure 4B). Second, we used a mutation at
16 (A to G of the nontemplate strand) which prevents
pausing in natural DNA; 16G also prevents appearance
of the 116/117 RNAs from the bubble template in the
presence of s70 (Figure 4B). Thus it is clear that s70dependent RNAs made from bubble template do also
require the pause-inducing sequence that acts on natural DNA templates.
s70 Fragments Containing Region 2 Induce Pausing
Since s 70 is not required for initiation of RNA synthesis
on bubble templates, fragments of the 613 amino acid
s70 protein that are inactive for initiation can be assayed
for recognition of the pause-inducing sequence. We
tested three s70 fragments that lack major portions of the
polypeptide but contain region 2 (amino acids 384–453),
which is required for recognition of the 210 promoter
segment (Kenney et al., 1989; Siegele et al., 1989; Zuber
et al., 1989; Waldburger et al., 1990). GST[360–528] is a
constructed fragment that contains both region 2 and
region 3, thought to be involved in binding of s 70 to core
enzyme, fused to glutathione-S-transferase; it binds
DNA containing the 210 consensus in vitro, but no other
activities have been reported (Dombroski et al., 1992).
Fragments [104–448] and [114–448] are tryptic portions
of s70 that contain most of region 2, but are known only to
be active in core binding (Severinova et al., submitted).
Cell
488
Figure 4. The 116/17 Pause Transcript Depends upon the Presence of s 70, and upon the Pause-Inducing Sequence, in Transcription from
Bubble Templates
Templates were PCR products made and transcribed as described. The substituent sequence was ATCTCGACTGAGT in place of the wildtype TAAATTTGACTCA in positions 212 to 11 of the nontemplate strand mutant bubble, or ACTCAGTCGAGAT in place of the wild-type
TGAGTCAAATTTA in the template strand mutant bubble.
(A) Transcripts of both bubbles by RNA polymerase holoenzyme (1s70) and core (2s70), compared with pause transcripts of wild-type DNA.
The prominent runoff derives from rightward initiation at the bubble; a larger leftward transcript (not shown) is present at <20% of this level.
(B) Transcripts of nontemplate strand altered 13 bp bubbles, as above, but with the (double-stranded) pausing sequence displaced downstream
by a 6 bp insertion, and converted to consensus 210 sequence (in these bubbles TTATGCTATAAT—with consensus elements underlined—
replaces nucleotides 11 to 16 of the wild-type sequence); and a bubble with a 16 T to G change in the nontemplate strand of the early
transcribed segment. This single base heteroduplex at 16 of the nontemplate strand is expected to express the nonpausing mutant phenotype
(Ring and Roberts, 1994).
(C) Effect of s 70 fragments on pausing at 116/117 in the wild-type configuration, and at 123 in the extended 210 sequence with 6 bp insert.
Numbers at top designate amino acids present in s70 fragments; the 360–528 fragment also contains GST fused to its N-terminus (Dombroski
et al., 1992).
None of the fragments contain region 4, which binds
the 235 consensus (Gross et al., 1992), and thus none
should be active in normal initiation from duplex templates. All three fragments induce pausing from the bubble template (Figure 4C). High concentrations of the
tryptic fragments are required, possibly because they
bind core less well than fragments containing region 3.
Thus region 360–448 of s70 contains elements that induce pausing, although adjacent regions may be required for efficient initiation function.
s70 Is Present in Paused Complexes
The requirement for s70 to induce pausing at the l 116/
17 site and its variants suggested that s70 might be
detectable physically in these complexes in vitro, if its
association is strong enough. Analyses of isolated complexes made from other promoters, and containing
RNAs as long as 115, show that s 70 has been released,
whereas s70 may be present if RNAs are shorter (<z10
nucleotides); in these cases footprinting shows that the
235 region is still occupied when s 70 is present and
vacated when s 70 is released (Krummel and Chamberlin,
1989); recall that the 235 region is vacated in the l
paused complex. We tested complexes from the l and
phage 82 promoters, made from both wild-type DNA
and from mutants that strongly reduce pausing. For convenience we used the l 115 complex, which is made
easily by nucleotide deprivation; it has the essential
properties of the 116/17 complexes (Yarnell and Roberts, 1992). The 82 complex is stopped by nucleotide
deprivation at 125, exactly the site of the natural pause.
Complexes were made from DNAs fixed to magnetic
beads; excess proteins were washed from the beads
and remaining proteins analyzed by SDS gel and silver
staining. Figure 5 shows that s 70 survives washing in
substantial amount from the wild type, but not from
the nonpausing variants of these promoters. To reduce
potential background due to released s70 or RNA polymerase adhering nonspecifically to beads, we released
the l complexes from beads by restriction enzyme digestion; although there is a new background of polypeptides from the restriction enzyme preparation, it is clear
that the s70 content of the released mutant complexes
is even less than that of unreleased mutant complexes.
Possibly some s70 remains in the complexes because
the mutations do not completely destroy the binding
sequence. We conclude that s 70 is fixed in the paused
complex through the pause-inducing sequence.
Pausing Decreases as the Pause-Inducing
Sequence Is Moved from the Promoter
To determine if s70-induced pausing requires a particular
relation to the promoter—e.g., distance or angular orientation around the DNA—we moved sequences inducing
s Factor Induces a Transcription Pause
489
Figure 5. s 70 Is Present in Complexes Stopped at the Pausing Site
of l and 82 Promoter Segments, But Reduced in Amount about
5-fold when the Pause-Inducing Sequence Is Altered
Figure 6. Effect of Displacing the Pause-Inducing Sequence of the
l pR9 Promoter Downstream, and Replacing Displaced Sequences
with the Extended 210 Consensus
Complexes were made and analyzed as described; a photograph
of a silver-stained SDS gel is shown. The s 70 content relative to RNA
polymerase holoenzyme standard is shown. The l sequences have
been described (Yarnell and Roberts, 1992). The phage 82 sequence
is a variant with transcript cytidines removed up to 125, so that
complexes stopped at the pause site can be constructed. Mutants
of this variant are a deletion at 111, which removes the highly
conserved T at 114 of the natural transcript (see Figure 2), and a
110G change of this site; both are defective in pausing (W. S. Y.
and J. W. R., unpublished data).
Insertions of 2 to 11 bp in insertion series #1 contain successive
segments from the 59 end of the sequence ATTGGTAGTGA inserted
before 11 of the wild-type sequence; the 1 bp insertion of series
#1 has T inserted between 11 and 12. The variant 8 bp insertion
is AATTACTC placed before 11, and two variant 10 bp insertions
are GGAATTACTC (#2) and AAGGTTACTC (#3), both placed before
11. The 16 extended 210 consensus insertion contains TTATGCTA
TAAT replacing the wild-type sequence from 11 to 16; the 110
extended 210 consensus insertion (template X10#1con) is described in Figure 3; the 120 extended 210 consensus insertion
contains ATTGGTAGTGAATTATATGCTATAAT, substituted for the
wild-type pR9 sequence from 11 to 16. Templates were PCR copies
made with the primers described for synthesis of heteroduplex bubble templates. The “fraction RNA polymerase paused per minute”
is the sum for all sampled times (0.59, 19, 29, 59, 109) of the mole
fraction of transcripts at the pause site, divided by the total time of
the reaction; it is an arbitrary measure that gives weight to both the
fraction captured at the pause and the half-time of the pause. A
substantially similar view is obtained by plotting the fraction that
decays between 0.5 min and 5 min, or the fraction initially captured
at 0.5 min. Error bars indicate variance over several experiments.
the l 116/17 pause downstream, by inserting between
21 and 11 arbitrary segments that contain no elements
of the extended 210 sequence. All bases of the original
pause-inducing segment that match the extended 210
sequence (i.e. 12, 15, and 16) are included in the segment displaced downstream. We characterized these
templates by measuring pausing in vitro and plotted for
each a measure of pausing efficiency, as described in
Figure 6 (legend); measuring pause half-life instead of
occupancy gave a similar result. The major effect is that
pausing drops off abruptly as the segment is displaced:
the one base insertion reduces pausing somewhat, and
pausing on insertions of 2 through 11 nucleotides fluctuates around 10%–20% of the wild-type level. Several
different 8 and 10 base pair insertions give similar levels
of pausing. We considered that pausing might recur with
a periodicity related to the repeat of the DNA helix, but
there is no trace of this. Previous results correlated the
ability of Ql to antiterminate with the strength of the
natural pause; this correlation holds for the insertions
as well, since Ql acts about half as well on the 11
insertion as on wild type, slightly on the 12 insertion,
and not at all on the longer insertions (B. Z. R. and
J. W. R., unpublished data). We conclude that the natural
l sequence induces efficient pausing only in close vicinity to the promoter.
As described above and shown again in Figure 6,
changing the l sequence to full consensus (T-TGTATATT) does provide efficient pausing at the 110 displacement, and even more efficient pausing at 16 displacement; the consensus insert also supports pausing
at 120 displacement, although the latter is little or no
stronger than the remaining pause displayed by insertions of 3–10 nucleotides of the natural l sequence. We
conclude that failure of the natural sequence to induce
efficient pausing at extensions of 16 and 110 is not
due to the novel position per se, but instead to the
incomplete match of the natural sequence to the 210
consensus: this region is accessible to s 70, but s70 can
bind only if the site is strong. Even with the consensus
sequence, pausing is strongly diminished by a displacement of 20 nucleotides from the natural pause site.
Elements besides the 210 Consensus
Contribute to Pausing
The slight remaining pause made from DNAs in which
the l sequence is displaced 3 or more base pairs from
its natural site appears to reflect a component of the
pause-inducing signal different from the 210 consensus
sequence. To determine if elements of the consensus
affect pausing at 10 or 20 bp displacement, we changed
the highly conserved T originally at 16 of the natural
sequence (and thus at 116 of the displaced sequence)
to G; although this change reduces pausing at the natural position at least 10-fold (Ring and Roberts, 1994;
Cell
490
Ring, 1995), it has little or no effect on the weak but
distinct pause at the 10 or 20 bp displaced position
(B. Z. R. and J. W. R., unpublished data). Therefore,
the remaining pause appears not to be induced by s 70
recognition of the 210 consensus. Loci distinct from
the 210 consensus also affect pausing at the natural
position in l and phage 82, including sequences at the
pause site itself, other positions within the bubble, and,
particularly, a G/C rich segment just downstream of the
final T of the 210 consensus (Goliger and Roberts, 1989;
Guo, 1990; Ring and Roberts, 1994). Some or all of these
elements may encode the remnant pause seen when
the 210 consensus sequence is mutated. However, it is
nonetheless possible that the presence of s70 is required
even if the 210 consensus does not act, because we
observed no (i.e. much less than the remnant level) pausing in synthesis initiated by core enzyme on bubble
templates (see Figure 4B). Further work should resolve
this.
Discussion
We have shown that the s 70 initiation subunit of E. coli
RNA polymerase also can act on RNA polymerase during
an early step of elongation, through binding a second
copy of the 210 consensus at sites as much as 20 base
pairs downstream of the 210 sequence that acts in
promoter recognition and opening. This interaction has
at least two consequences: there is a pause in transcription in vivo and in vitro, and RNA polymerase becomes
sensitive to modification by the l gene Q antiterminator
protein.
A model that describes the structure of this paused
complex and its origin after RNA synthesis initiates at
the open promoter complex is shown in Figure 7. We
note first that s70 carries out base-specific recognition
of the nontemplate strand as single-stranded DNA, both
in the open promoter complex and the paused complex
(Ring and Roberts, 1994; Roberts and Roberts, 1996).
This strand selectivity has been shown for positions
212, 211, 28, and 27 in the open promoter complex
and/or the comparable sites in the paused complex.
Es70 first binds the promoter specifically in a closed,
duplex complex (Figure 7, row 1), which then is reconfigured into the melted open complex (Figure 7, row 2)
(McClure, 1985); the high affinity of Es70 for bases of
nontemplate strand DNA in single-stranded form may
be important in its activity to melt the promoter region.
Region 2 of s 70 carries specificity for 210 recognition,
whereas region 4 of s70 is thought to bind the 235 segment (Gross et al., 1992); both interactions occur in the
context of the holoenzyme Es70 , so that the core could
contribute to the binding. RNAs of 10 or more nucleotides can be polymerized while Es70 remains fixed in the
open complex, and these frequently dissociate from the
complex (“abortive initiation”), forcing RNA synthesis to
begin again (Johnston and McClure, 1976). Elongation
succeeds when the 235 and 210 associations are broken and the RNA chain continues beyond the initial region. However, elongation is interrupted if s70 can associate with the pause-inducing sequence (Figure 7, row
3). Presumably, pausing reflects some of the same
Figure 7. Model of s 70 Function in Promoter Opening and Pausing,
and the Interaction l Q Protein with the Paused Complex
Details are described in the text. (A), (B), and (C) represent formation
of closed promoter complex, open promoter complex, and paused
complex; (D) represents the interaction of l Q protein with the
paused complex. Region 2 of s70 is placed to bind the upstream
end of the extended 210 consensus as duplex DNA, in agreement
with KMnO4 mapping (Kainz and Roberts, 1992). A pronounced
stop in upstream exonuclease digestion characteristic of complex
containing the wild-type pause sequence (Yarnell and Roberts,
1992) could reflect such a structure.
forces between s70, DNA, and core enzyme that restrain
the enzyme in the open promoter complex. We have no
information where region 4 of s70 resides during the
pause, although it no longer occupies 235 segment
DNA and, as we have shown, is not necessary to induce
pausing. (There is a near reiteration of the 235 sequence
beginning at 227 in l [Figure 1], but changing this sequence does not affect pausing.)
s70 might reach the pause-inducing sequence either
by an internal pathway, whereby it transits (“hops”) from
the 210 promoter sequence, or externally, through rebinding of released s70 to core at the pause site. There
are several arguments that the former is more likely,
although none are definitive. First, we attempted to increase pausing by adding a 35-fold excess of s 70 during
in vitro transcription of either wild-type l or the consensus extended 210 sequence displaced to 120 relative
to wild-type l (see Figure 6); there was no increase in
pausing (Ring and Roberts, 1994). Second, the affinity
of s 70 for elongating complexes has been measured directly and found to be orders of magnitude lower than for
core RNA polymerase (Gill et al., 1991). Third, it appears
plausible that s70 binding to core might persist after s 70
s Factor Induces a Transcription Pause
491
releases promoter contacts, so that a newly presented
DNA site of high affinity (especially the melted nontemplate strand) would again fix s 70 in the complex.
We envision the following: in the l open complex
(Figure 7, row 2), extension of the transcription bubble
a few bases downstream during the beginning of RNA
synthesis exposes single-stranded nontemplate DNA
containing the binding sequence, to which s70 jumps as
it is released from the promoter 210 sequence (Figure
7, row 3). Even for a pause at around 125, for which
the s70 binding segment is in the region 110 through
115, the initial part of this sequence might be unwound
before s70 is released from the promoter 210 sequence.
Whatever the interval in time and space, however, the
hopping model proposes that s 70 remains bound to core
between sites, and that s 70 can carry out a significant
interaction with core after initiation and after the promoter 210 sequence bonds are broken.
The discovery that s 70 can interact with core after
initiation but independently of the promoter contacts
begs the question when s70 actually is released in vivo
when there is no pause. It is clear that s70 can be released
in vitro after 10 nucleotides of RNA are made. However,
most such measurements involve complexes stopped
for at least minutes, whereas elongation through hundreds of base pairs requires only seconds. One measurement found that s70 release is time and not position
dependent, occurring with a half-time of 5 s (Shimamoto
et al., 1986). We suggest that the ability of the consensus
extended 210 sequence to invoke pausing at a 10 base
pair displacement, where the natural l sequence does
not invoke pausing, implies that s70 is present but unable
to grasp the weaker binding sequence in the displaced
position. The fact that even the consensus sequence
fails at greater extensions could mean that s70 is not
there, or that other influences prevent the interaction;
in fact, it is worth considering that s70 might not be
released in some conditions in the cell, and that it might
have other roles in transcription elongation.
A number of eukaryotic genes also have associated
promoter-proximal pause sites, including Drosophila
heat shock genes (Rougvie and Lis, 1990), the human
c-myc gene (Krumm et al., 1995), and possibly the HIV-1
LTR promoter (Cullen, 1990). The heat shock and c-myc
associated pauses are affected by mutations removing
various promoter elements (Krumm et al., 1995; Lee et
al., 1992), suggesting that promoter bound factors are
important for pausing by polII. We directly demonstrate
here that a promoter element binding factor of E. coli
RNA polymerase, s70 , can induce promoter-proximal
pausing. It is interesting that similar mechanisms may
govern a common regulatory step in both prokaryotes
and eukaryotes.
There are important elements of the pause-inducing
sequence besides the 210 promoter consensus. Mutation of any one of the three G/C base pairs following
the 210 consensus in l reduces pausing severalfold
(Yang, 1988); like the 210 consensus bases, these sites
act primarily through the nontemplate strand (Ring and
Roberts, 1994). Although it is not part of the derived
210 consensus, this region is the site of the “discriminator” (de Boer et al., 1979; Travers, 1980), thought to be
important in the stringent regulation of promoter function by the nucleotide ppGpp; G/C richness is associated with inhibition of promoter function by ppGpp,
whereas A/T richness is associated with stimulation
(Cashel and Rudd, 1987; Riggs et al., 1986). Conceivably
the interaction by which this promoter segment influences pausing also is involved in mediating the stringent
response.
A single mutation such as 16G that prevents pausing
and s70 incorporation into the complex also blocks l
gene Q antiterminator binding and function, even if RNA
polymerase is stalled at the nucleotide where pausing
would occur (Yarnell and Roberts, 1992). This finding
suggests strongly that s70 is directly required for Q function. We thus show (Figure 7, row 4) a new view of the
paused complex, with Q and RNA polymerase placed on
the linear DNA sequence according to DNA protection
analysis. When Q binds, it alters the DNA footprint in
the early transcribed region where s 70 region 2 binds
(Yarnell and Roberts, 1992). This change could reflect
a direct s70 –Q interaction or an indirect effect of s 70 in
providing a favorable conformation of RNA polymerase
for the interaction. Whichever is true, it is clear that the
influence of s 70 in this incipient elongation complex is
essential to allow its modification by Q to the antiterminating form.
Experimental Procedures
Proteins and DNA
RNA Polymerase holoenzyme was purified as described (Hager et
al., 1990). Core RNA polymerase was prepared from holoenzyme
by phosphocellulose chromatography as described (Burgess, 1969).
s 70 was purified as described (Dombroski et al., 1992) as a fusion
to glutathione-S-transferase at amino acid 8, the plasmid source of
which was a gift from C. Gross. Holoenzyme made by reconstitution
of core RNA polymerase with a 10-fold excess of GST-s70 at 08C for
10 min behaved identically to purified holoenzyme. The 110–448
and 114–448 fragments of s70 were gifts of E. Severinova, K. Severinov, and S. Darst. Other enzymes were obtained from New England BioLabs.
For experiments except that of Figure 5, the plasmid source for
the l late promoter and 16G mutant was pXY306 and its mutant
derivative (Yang, 1988; Kainz and Roberts, 1992). All insertion/deletion mutations of the l late promoter region were produced by
polymerase chain reaction (PCR) overlap mutagenesis. In brief, an
oligonucleotide containing the mutant sequence was combined with
a downstream oligonucleotide in a PCR templated by pXY306, or
an appropriate derivative, to produce a right-half PCR fragment. An
oppositely oriented oligonucleotide matching 15 bp of the end of
the mutagenic oligonucleotide was combined with an upstream oligonucleotide in a PCR templated by pXY306 or a derivative to produce a left-half PCR product. Hybrid was produced by combining
the right and left half fragments in equimolar amounts and exposing
them to five primer extension cycles in the presence of dXTP’s, with
critical ramp speeds and annealing temperature as follows: 948C to
358C at a ramp of 10 s/8C, and then from 358C to 728C at 2 s/8C. A
restriction fragment of the resulting hybrid was cloned into the parent plasmid of pXY306 and DNA prepared as described; or the
hybrid was used as template for further PCR and the product used
as transcription template after purification with glass milk (National
Scientific).
For the experiment of Figure 5, l DNAs were BamHI–EcoRI fragments of pBY300 and pBY301 (Yarnell and Roberts, 1992) that contain l DNA from 2282 to 183 relative to the pR9 start site. Phage
82 DNAs were HinDIII–SalI fragments of pBY400 (wild-type), pBY402
(111 deletion), and pBY405 (110G), which contain phage 82 DNA
from 297 to 1141 relative to the phage late gene promoter. Phage
Cell
492
82 “WT” DNA of Figure 5 is from pBY40u, a derivative of true wildtype made by PCR mutagenesis that allows stopped complexes to
be formed at the 125 pause site in a single step, through introduction
of encoded cytidine at 12 and 126 and removal of encoded cytidine
at 15, 116, and 117. Initiation at the 82 late promoter on pBY40u
produces transcribing complexes that are partially arrested at 125,
are released by GreB, and are fully modified by Q protein. “111
deletion” and “110G” templates are derivatives of pBY40u and do
not produce arrested complexes.
Heteroduplex Promoter Bubble Templates
Heteroduplex templates were made by denaturing and reannealing
mixed PCR products of mutant and wild-type DNAs, in which the
template strand of the mutant template and the nontemplate strand
of the wild-type template were biotinylated by synthesis with a biotinylated primer; heteroduplexes then were separated from homoduplexes and from each other by differential bandshift with streptavidin
(C. Roberts and J. W. R., unpublished data). One heteroduplex (nontemplate strand mutant and template strand wild type) does not
bind streptavidin and is not shifted; the homoduplex fragments are
biotinylated on one strand and shift singly; and the other heteroduplex is biotinylated on both strands and shifts doubly. The mutation used in heteroduplex bubble templates was 212ATCTCGACTG
AGT11 in the template strand, replacing the wild-type sequence of
212TAAATTTGACTCA11. The upstream primer for PCR was AAGG
ATGCCAGCAAGC, which begins in l DNA at bp 44,344, 243 bp
upstream of the pR9 start site in pXY306; the downstream primer
was CACCACAGAAAGGTCG, which ends 100 bp downstream of
the pR9 start site in pXY306 DNA. DNAs to be reannealed were
combined in equimolar amounts, supplemented with 5 mM EDTA,
heated 10 min at 958C, annealed 10 min at 658C, and chilled. Streptavidin was then added to a concentration of 0.5 mg/ml and the
shifted and unshifted DNAs separated on a 1% agarose gel. DNA
was removed in agarose and purified with glass milk.
In Vitro Transcription
Transcripts were made by preincubating 1 nM DNA template and
15 nM holoenzyme, or core enzyme, or core enzyme and s or s
fragment, for 15 min at 378C in 20 mM Tris–Cl (pH 8.0), 0.1 mM
EDTA, 1.0 mM DTT, 50 mM KCl, 200 mM ATP, CTP, and GTP, 50
mM UTP, and 0.5 mCi/ml [a-32P]UTP in a volume of 25 ml. RNA
synthesis was initiated by addition of 2.5 ml of 40 mM MgCl 2 and
100 mg/ml rifampicin. RNA was processed and analyzed by denaturing gel electrophoresis and autoradiography as described (Grayhack et al., 1985). Dried gels were also analyzed on a Betascope or
phosphorimager.
s70 Content of Stopped Transcription Complexes
DNA templates purified from plasmid DNA were labeled upstream
of the promoter with 32P (top strand) and biotin (bottom strand),
using T4 polynucleotide kinase and Klenow fragment, respectively.
Stopped transcription complexes were formed on DNA templates
attached to streptavidin-coated paramagnetic beads (Promega) by
incubation of stoichiometric amounts of RNA polymerase and DNA
in transcription buffer (TB; 20 mM Tris–HCl [pH 7.9], 0.1 mM EDTA,
1.0 mM dithiothreitol, 50 mM KCl, 2% glycerol, 0.04 mg/ml bovine
serum albumin, and 4 mM MgCl2) for 12 min at 378C followed by
initiation of transcription with 25 mM ATP, 25 mM GTP, 25 mM UTP,
0.4 mCi/ml [a-32P]UTP, and 50 mM initiating nucleotide (ApApC or
ApC) for 8 min. Residual open promoter complexes and free RNA
polymerase were removed by 08C incubation with 350 mM KCl and
0.2 mg/ml poly(dA-dT) for 5 min followed by five rinses with buffer
(TB; 0.1 mg/ml BSA, 0.02 mg/ml poly[dA-dT]) and resuspension in
TB. Aliquots were removed for analysis of protein subunits (2.5 pmol
complexes) and nascent RNA (0.2 pmol complexes; >90% of RNAs
were the desired stopped product) as well as for estimation of contaminating open promoter complexes by Exonuclease III digestion
(0.3 pmol complexes; open complexes represented <2% of total
complexes). Additional l DNA complexes (2.5 pmol) were released
and separated from beads by 10 min digestion with 40 U MseI,
which cuts upstream of the promoter, for analysis of protein subunits. Samples for protein subunit analysis were separated on SDS–
polyacrylamide gel (7%), silver stained, photographed on a Fotodyne imager, and quanititated using Fuji MacBas software. RNA
and DNA were analyzed by sequencing gels and phosphorimager.
Acknowledgments
We thank J. Lis and members of the laboratory for reading the
manuscript; J. Helmann for advice and for use of bubble templates;
C. Gross for a gift of plasmids; E. Severinova, K. Severinov, and S.
Darst for providing s70 fragments and suggesting they be tested in
the bubble pausing assay; and the National Institutes of Health for
support (grant 21941).
Received May 16, 1996; revised June 25, 1996.
References
Aiyar, S.E., Helmann, J.D., and deHaseth, P.L. (1994). A mismatch
bubble in double-stranded DNA suffices to direct precise transcription initiation by Escherichia coli RNA polymerase. J. Biol. Chem.
269, 13179–13184.
Burgess, R.R. (1969). A new method for the large scale purification of
Escherichia coli deoxyribonucleic acid-dependent ribonucleic acid
polymerase. J. Biol. Chem. 244, 6160–6167.
Burgess, R.R., Travers, A.A., Dunn, J.J., and Bautz, E.K.F. (1969).
Factor stimulating transcription by RNA polymerase. Nature 221,
43–46.
Carpousis, A., and Gralla, J. (1985). Interaction of RNA polymerase
with the lacUV5 promoter DNA during mRNA initiation and elongation: footprinting, methylation, and rifampicin-sensitivity changes
accompanying transcription initiation. J. Mol. Biol. 183, 165–177.
Cashel, M., and Rudd, K.E. (1987). The stringent response. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, F. Neidhardt, J. Ingraham, B. Low, B. Magasanik, M.
Schaechter, and H. Umbarger, eds. (Washington, D.C.: Am. Soc.
Microbiol.), pp. 1410–1438.
Cullen, B.R. (1990). The HIV-1 Tat protein: an RNA sequence-specific
processivity factor? Cell 63, 655–657.
de Boer, H.A., Gilbert, S.F., and Nomura, M. (1979). DNA sequences
of promoter regions for rRNA operons rrnE and rrnA in E. coli. Cell
17, 201–209.
Dombroski, A.J., Walter, W.A., Record, M.T.J., Siegele, D.A., and
Gross, C.A. (1992). Polypeptides containing highly conserved regions of transcription initiation factor Sigma-70 exhibit specificity
of binding to promoter DNA. Cell 70, 501–512.
Gill, S.C., Weitzel, S.E., and von Hippel, P.H. (1991). Escherichia coli
sigma 70 and NusA proteins. I. Binding interactions with core RNA
polymerase in solution and within the transcription complex. J. Mol.
Biol. 220, 307–324.
Goliger, J.A., and Roberts, J.W. (1989). Sequences required for antitermination by phage 82 Q protein. J. Mol. Biol. 210, 461–471.
Grayhack, E.J., Yang, X., Lau, L.F., and Roberts, J.W. (1985). Phage
lambda gene Q antiterminator recognizes RNA polymerase near the
promoter and accelerates it through a pause site. Cell 42, 259–270.
Gross, C., Lonetto, M., and Losick, R. (1992). Bacterial sigma factors.
In Transcriptional Regulation, S. McKnight and K. Yamamoto, eds.
(Cold Spring Harbor, New York: Cold Spring Harbor Laboratory
Press), pp. 129–176.
Guo, H.-C. (1990). Mutational analysis of transcription antitermination mediated by lambdoid phage gene Q products. Ph.D. thesis,
Cornell University, Ithaca, New York.
Guo, H.-C., Kainz, M., and Roberts, J.W. (1990). Characterization
of the late gene regulatory region of phage 21. J. Bacteriol. 173,
1554–1560.
Hager, D.A., Jin, D.J., and Burgess, R.R. (1990). Use of mono Q
high-resolution ion-exchange chromatography to obtain highly pure
and active Escherichia coli RNA polymerase. Biochemistry 29, 7890–
7894.
Hansen, H.M., and McClure, W.R. (1980). Role of the s subunit of
s Factor Induces a Transcription Pause
493
Escherichia coli RNA polymerase in initiation. II. Release of s from
ternary complexes. J. Biol. Chem. 255, 9564–9570.
Yang, X. (1988). Transcription antitermination mediated by lambdoid
phage Q proteins. Ph.D. thesis, Cornell University, Ithaca, New York.
Helmann, J.D., and Chamberlin, M.J. (1988). Structure and function
of bacterial sigma factors. Annu. Rev. Biochem. 57, 839–872.
Yang, X., Goliger, J.A., and Roberts, J.W. (1989). Specificity and
mechanism of antitermination by Q proteins of bacteriophages l
and 82. J. Mol. Biol. 210, 453–460.
Johnston, D.E., and McClure, W.R. (1976). Abortive initiation of in
vitro RNA synthesis on bacteriophage lambda DNA. In RNA Polymerase, R.R. Losick and M.J. Chamberlin, eds. (Cold Spring Harbor,
New York: Cold Spring Harbor Laboratory), pp. 413–428.
Kainz, M., and Roberts, J.W. (1992). Structure of transcription elongation complexes in vivo. Science 255, 838–841.
Keilty, S., and Rosenberg, M. (1987). Constitutive function of a positively regulated promoter reveals new sequences essential for activity. J. Biol. Chem. 262, 6389–6395.
Kenney, T.J., York, K., Youngman, P., and Moran, C.P.J. (1989).
Genetic evidence that RNA polymerase associated with sA uses a
sporulation-specific promoter in Bacillus subtilis. Proc. Natl. Acad.
Sci. USA 86, 9109–9113.
Krumm, A., Hickey, L.B., and Groudine, M. (1995). Promoter-proximal pausing of RNA polymerase II defines a general rate-limiting
step after transcriptional initiation. Genes Dev. 9, 559–572.
Krummel, B., and Chamberlin, M.J. (1989). RNA chain initiation by
Escherichia coli RNA polymerase. Structural transitions of the enzyme in early ternary complexes. Biochemistry 28, 7829–7842.
Kumar, A., Malloch, R.A., Fujita, N., Smillie, D.A., Ishihama, A., and
Hayward, R.S. (1993). The 235 recognition region of Escherichia
coli sigma 70 is inessential for initiation of transcription at an “extended 210” promoter. J. Mol. Biol. 232, 406–418.
Lee, H.S., Kraus, K.W., Wolfner, M.F., and Lis, J.T. (1992). DNA
sequence requirements for generating paused polymerase at the
start of HSP70. Genes Dev. 6, 284–295.
McClure, W.R. (1985). Mechanism and control of transcription initiation in prokaryotes. Annu. Rev. Biochem. 54, 171–204.
Riggs, D.L., Mueller, R.D., Kwan, H.-S., and Artz, S.W. (1986). Promoter domain mediates guanosine tetraphosphate activation of the
histidine operon. Proc. Natl. Acad. Sci. USA 83, 9333–9337.
Ring, B.Z. (1995). Roles for the nontranscribed DNA strand and
sigma-70 initiation factor in E. coli RNA polymerase pausing. Ph.D.
thesis, Cornell University, Ithaca, New York.
Ring, B.Z., and Roberts, J.W. (1994). Function of a nontranscribed
DNA strand site in transcription elongation. Cell 78, 317–324.
Roberts, J. (1992). Antitermination and the control of transcription
elongation. In Transcriptional Regulation, S. McKnight and K. Yamamoto, eds. (Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory), pp. 389–406.
Roberts, C.W., and Roberts, J.W. (1996). Base-specific recognition
of the nontemplate strand of promoter DNA by E. coli RNA polymerase. Cell, this issue.
Ross, W., Gosink, K.K., Salomon, J., Igarashi, K., Zou, C., Ishihama,
A., Severinov, K., and Gourse, R.L. (1993). A third recognition element in bacterial promoters: DNA binding by the a subunit of RNA
polymerase. Science 262, 1407–1413.
Rougvie, A., and Lis, J. (1990). Postinitiation transcriptional control
in Drosophila melanogaster. Mol. Cell. Biol. 10, 6041–6045.
Shimamoto, N., Kamigochi, T., and Utiyama, H. (1986). Release of the
sigma subunit of Escherichia coli DNA-dependent RNA polymerase
depends mainly on time elapsed after the start of initiation, not on
length of product RNA. J. Biol. Chem. 261, 11859–11865.
Siegele, D.A., Hu, J.C., Walter, W.A., and Gross, C.A. (1989). Altered
promoter recognition by mutant forms of the sigma-70 subunit of
Escherichia-coli RNA polymerase. J. Mol. Biol. 206, 591–604.
Straney, D.C., and Crothers, D.M. (1987). A stressed intermediate
in the formation of stably initiated RNA chains at the Escherichia
coli lac UV5 promoter. J. Mol. Biol. 193, 279–292.
Travers, A.A. (1980). Promoter sequence for stringent control of
bacterial ribosomal RNA synthesis. J. Bact. 141, 973–976.
Waldburger, C., Gardella, T., Wong, R., and Susskind, M.M. (1990).
Changes in the conserved region 2 of Escherichia coli s 70 subunit
affecting promoter recognition. J. Mol. Biol. 215, 267–276.
Yarnell, W.S., and Roberts, J.W. (1992). The phage lambda gene Q
transcription antiterminator binds DNA in the late gene promoter as
it modifies RNA polymerase. Cell 69, 1181–1189.
Zuber, P., Healy, J., Carter, H.L.I., Cutting, S., Moran, C.P.J., and
Losick, R. (1989). Mutation changing the specificity of an RNA polymerase sigma factor. J. Mol. Biol. 206, 605–614.