Download Functional Characterization of Truncated Growth Hormone (GH

0021-972X/99/$03.00/0
The Journal of Clinical Endocrinology & Metabolism
Copyright © 1999 by The Endocrine Society
Vol. 84, No. 3
Printed in U.S.A.
Functional Characterization of Truncated Growth
Hormone (GH) Receptor-(1–277) Causing Partial GH
Insensitivity Syndrome with High GH-Binding Protein*
KEIJI IIDA, YUTAKA TAKAHASHI, HIDESUKE KAJI,
MICHIKO OKAZAKI TAKAHASHI, YASUHIKO OKIMURA, OSAMU NOSE,
HIROMI ABE, AND KAZUO CHIHARA
Third Division Department of Medicine, Kobe University School of Medicine (K.I., Y.T., H.K., M.O.T.,
Y.O., H.A., K.C.), 7–5-1 Kusunoki-cho, Chuo-ku, Kobe; and Nose Clinic (O.N.), Osaka, Japan
ABSTRACT
We have previously reported a novel heterozygous donor splice site
mutation in intron 9 of the GH receptor (GHR) gene in Japanese
siblings who showed partial GH insensitivity and high serum GHbinding protein (GHBP) levels. This mutation caused the splicing
abnormality and produced the truncated GHR consisting of 277 amino
acids (GHR-277), which lacked most of the intracellular domain of
GHR, including both boxes 1 and 2. In this study, we have characterized the function of GHR-277 expression in COS-7 and CHO cells
in vitro. Scatchard analysis revealed that GHR-277 possessed approximately 1.5 times higher affinity to GH and twice the number of
binding sites compared to wild-type full-length GHR (GHR-fl). The
G
H INSENSITIVITY syndrome (GHIS) is an autosomal
recessive disorder, first reported by Laron et al. in 1966
(1). Several genetic abnormalities in the GH receptor (GHR)
gene in GHIS have been reported to date, most of which were
located in the region coding for the extracellular domain of
the GHR and were homozygous or compound heterozygous
mutations (2). Serum GH-binding protein (GHBP) was not
detected or was extremely low in most patients because of the
GHR defect or the failure of ligand binding to the GHR (2),
but some patients demonstrated normal to high levels of
serum GHBP (3, 4, 4a). The missense mutation D152H caused
a failure of receptor dimerization despite normal GH binding
and normal serum GHBP levels (3). Splice site mutations
resulting in complete skipping of exon 8, which codes for the
transmembrane domain of the GHR, were reported in patients with GHIS and high serum GHBP levels (4, 4a). This
truncated GHR is presumed to be unanchored in the cell
membrane and to be measurable in serum as GHBP. In addition, Goddard et al. reported heterozygous mutations of the
GHR gene in idiopathic short stature with partial GH insensitivity and low serum GHBP levels (5). These case reports
Received August 14, 1998. Revision received November 24, 1998.
Accepted December 11, 1998.
Address all correspondence and requests for reprints to: Dr. K. Iida,
Third Division, Department of Medicine, Kobe University School of
Medicine, 7–5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan.
* This work was supported in part by Grants-in-Aid for Scientific
Research 06807082, 07671138, and 09470221 from the Japanese Ministry
of Education, Science, Sports, and Culture and grants from the Japanese
Ministry of Health and Welfare, Novo Nordisk A/S Growth, and
Growth Science Foundation, 1996 and 1997.
GHBP level in culture medium of GHR-277-expressing cells was approximately 3 times higher than that in GHR-fl-expressing cells.
Interestingly, the ligand-induced internalization of GHR-277 was
significantly reduced compared with that of GHR-fl. Moreover, in
GH-induced tyrosine phosphorylation of signal transducer and activator of transcription-5 (STAT5), GHR-277 exerted a dominant negative effect when GHR-277 and GHR-fl were cotransfected. These in
vitro data would well explain the clinical characteristics in our patients showing high serum GHBP levels and development of short
stature despite a heterozygous mutation of the GHR gene. (J Clin
Endocrinol Metab 84: 1011–1016, 1999)
suggest that the clinical characteristics of GHIS, that is the
severity of GH insensitivity as well as the serum GHBP
levels, are highly variable and more heterogeneous than we
thought in classical Laron syndrome. Recently, we reported
a novel heterozygous donor splice site mutation of intron 9
of the GHR gene in two Japanese siblings who showed partial
GH insensitivity and high serum GHBP levels (6). This mutation resulted in complete skipping of exon 9 from one allele
and production of the truncated GHR consisting of 277
amino acids (GHR-277), which was structurally identical to
that of the case reported by Ayling et al. (7). Moreover, it is
of interest that GHR-277 is one of the physiological GHR
isoforms produced in a minute amount by alternative splicing of the common GHR transcript (8), suggesting that GHR277 may play a role in physiological regulation of GH action.
This study aimed at characterizing the function of this
GHR-277 to elucidate clinical characteristics of our patients,
that is their high serum GHBP levels and short stature despite the heterozygous mutation, and also to clarify the physiological role of GHR-277 in GH signal transduction and
GHBP production.
Subjects and Methods
Patients
The profiles of the patients were reported previously (6). Briefly,
patients 1 and 2 were siblings, a 13.3-yr-old boy and a 9.2-yr-old girl, both
of whom showed the mild clinical phenotypes associated with a lack of
GH action. Their parents were not related. The clinical and biochemical
characteristics of patients 1 and 2 and their mother are shown in
Table 1. Their father was 172 cm tall (within normal range) without the
clinical phenotype of GH insensitivity.
1011
1012
JCE & M • 1999
Vol 84 • No 3
IIDA ET AL.
Construction of wild-type full-length GHR (GHR-fl) and
GHR-277 expression vectors
The pUC119 vector containing the full-length GHR complementary (c) DNA (pUC119-GHR) (10), provided by Genentech, Inc. (South
San Francisco, CA), was subcloned into the expression vector pcDNAI (Invitrogen Corp., Leek, Netherlands) using the BamHI and SphI
restriction sites. The amplification fragment, including from exon 7
to exon 10 of the GHR cDNA from the patient’s lymphocytes by
RT-PCR (Fig. 1), was subcloned into the pT7 Blue T-vector (Novagen,
Inc., Madison, WI) and digested with restriction enzymes NcoI and
EcoRI, then inserted into the pUC119-GHR using NcoI-EcoRI restriction sites and subcloned into the pcDNAI vector using the BamHI and
SphI sites to produce GHR-277 (primer sets for RT-PCR are as follows:
sense primer, ACACTTCCTCAGATGAGC; antisense primer, CACTGTGGAATTCGGGTTTA). The accuracy of construction of GHR-277
cDNA was confirmed by sequencing. The cDNA fragment from exon
7 to exon 10 coding for GHR-277 and the deduced amino acid structure of GHR-277 are shown in Fig. 1.
Cell cultures and transfections
COS-7 cells were grown in DMEM (Life Technologies, Inc., Grand
Island, NY) containing 10% FBS (BioWhittaker, Walkersville, MD), penicillin, and kanamycin at 37 C in 5% CO2. CHO cells were grown in
DMEM/Ham’s F-12 (Life Technologies) containing 10% FBS, penicillin,
and kanamycin at 37 C in 5% CO2. Transfections were performed at 70%
confluence using LipofectAce reagent (Life Technologies, Inc., Gaithersburg, MD) with 3.0 mg plasmid containing GHR-fl or GHR-277
cDNAs and 2.0 mg pSV-b-control vector (Promega Corp., Madison, WI).
The b-galactosidase activities were measured as an internal control of
transfections using an enzyme assay system kit (Promega Corp.) according to the manufacturer’s instructions.
Scatchard plots of [125I]human (h) GH binding to GHR-fl
and GHR-277
Forty-eight hours after transfection, COS-7 cells expressing GHR-fl
and GHR-277 were starved for serum for 2 h, [125I]hGH (0.4 mCi/mL;
NEX-100, DuPont, Wilmington, DE) was added to the serum-free culture
medium containing 0.1% BSA with increasing concentrations of unlabeled hGH and incubated for 90 min. The cells were washed three times
with phosphate-buffered saline and solubilized with 0.1 n NaOH. The
cell-associated radioactivity was counted using a g-counter (Pharmacia
Biotech, Piscataway, NJ) and corrected for b-galactosidase activities. All
experiments were performed in triplicate.
Measurement of GHBP in the medium
Twenty-four hours after transfection, the media of COS-7 cells expressing GHR-fl and GHR-277 were exchanged, and the cells were
incubated for another 24 h. The media were collected, and aliquots of the
media were incubated at 4 C for 16 h in a total volume of 250 mL
containing [125I]hGH (0.8 mCi/mL) and anti-GHR mouse monoclonal
antibody (mAb263, Agen, Brisbane, Australia). Twenty-five microliters
of 10% antimouse IgG, 25 mL 1% normal mouse serum, and 300 mL 5%
polyethylene glycol were then added. The reaction mixture was incubated for an additional 4 h at 4 C and centrifuged. The radioactivity of
the pellets was counted and corrected for b-galactosidase activities. All
experiments were performed in triplicate.
GH-induced internalization of GHR
The COS-7 cells expressing GHR-fl and GHR-277 were incubated
in serum-free DMEM; the media were collected 0, 15, 30, and 60 min
after the addition of [125I]hGH (0.8 mCi/mL), then the cells were
washed with cold phosphate-buffered saline and treated at 4 C for 5
min with 0.2 mol/L acetic acid and 0.5 mol/L NaCl, pH 2.5. The
radioactivity extracted by this acid-salt solution was considered to be
[125I]hGH still bound on the cell surface, whereas the radioactivity
remaining in the cells after acid-salt washing was considered to be
internalized (11). Nonspecific binding was determined in parallel
cultures containing more than a 100-fold excess of unlabeled hGH,
and the rate of internalization was calculated as the ratio of the
percentage of the specific internalized radioactivity to the specific
total bound radioactivity.
GH-dependent tyrosine phosphorylation of signal
transducer and activator of transcription-5b (STAT5b) in
GHR-expressing CHO cells
CHO cells were cotransfected with 3.0 mg expression vectors containing GHR-fl cDNA (pcDNA1/GHR-fl) and increasing amounts of
those containing GHR-277 cDNA (pcDNA1/GHR-277; 0, 0.3, 1.5, and 3.0
mg) or were transfected with 3.0 mg pcDNA1/GHR-277 alone. The
transfected cells were stimulated by 100 ng/mL hGH for 15 min and
lysed. GH-induced tyrosine phosphorylation of STAT5b in the cells
coexpressed with both GHR-fl and GHR-277 was determined by Western blotting as described previously (12). Specific antibody for STAT5b
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and antiphosphotyrosine antibody (RC20H, Transduction Laboratories, Inc., Lexington,
KY) were used for immunoprecipitation and immunoblotting, respectively. Antibody binding was detected using an enhanced chemiluminescence kit (Amersham Corp., Arlington Heights, IL).
Statistical analysis
Statistical significance between the different values was determined
using Student’s t test.
Results
Analysis of hGH binding in COS-7 cells expressing either
GHR-fl or GHR-277
Scatchard analysis revealed that GHR-277 possessed a
slightly higher binding affinity to hGH than GHR-fl. The
TABLE 1. Clinical and biochemical characteristics of the patients and their mother (ref. 6)
Sex
Ht (cm)
BW (kg)
Bone age (yr)
Serum GH (mg/L)
Serum IGF-I (mg/L)
Serum IGFBP-3 (mg/mL)
Serum GHBP (pmol/L)
Before and after IGF-I generation testb
IGF-I
IGFBP-3
Patient 1
Patient 2
Mother
Male
134.0 [23.0 SD]
36.8
12.5
1.0 – 40.4
53.7 (286.8 –799.7)a
2.28 (2.99 –5.00)
896 (65– 408)
Female
111.3 [23.5 SD]
23.2
7.5
0.5–38.3
31.0 (186.0 – 893.0)
1.42 (2.33– 4.91)
871 (65– 408)
Female
147.0 [22.0 SD]
45.0
Unknown
1.2
37.0 (121.0 – 436.0)
1.52 (2.17– 4.05)
813 (65– 408)
108 and 146
3.16 and 2.78
39.7 and 60.4
2.28 and 2.67
NT
NT
NT, Not tested.
a
The normal limits of each parameter are in parentheses.
b
A daily sc injection of recombinant human GH (0.1 U/kgzday) for 3 days.
CHARACTERIZATION OF THE TRUNCATED GHR
1013
FIG. 1. The structures of a part of the cDNA (a) and of deduced amino acids (b) found in our patients (6). The cDNAs of our patients, lacking
exon 9, resulted in a frame shift, a premature stop codon in exon 10, and production of truncated GHR consisting of 277 amino acids. The arrows
denote the positions of primers used for PCR. The asterisk denotes the mutation site.
representative data are shown in Fig. 2. The association
constant (Ka) for GHR-fl is 0.49 3 109 mol/L21, and that
for GHR-277 is 0.61 3 109 mol/L21 (Fig. 2). Triplicate
experiments revealed that GHR-277 demonstrated 1.5 6
0.4 times higher binding affinity to hGH than GHR-fl. The
binding sites of cells expressing GHR-fl and GHR-277
were 70 6 15 and 147 6 26 fmol/106 cells, respectively,
indicating that GHR-277-expressing cells possessed approximately twice as many binding sites as GHR-flexpressing cells.
GHBP levels in the culture medium of GHR-fl- and GHR277-expressing COS-7 cells
Table 2 showed the relative GHBP levels in the culture
medium of the COS-7 cells transfected with either pcDNA1/
GHR-fl or pcDNA1/GHR-277. The radioactivity was 1079 6
70 vs. 3299 6 131 cpm (GHR-fl vs. GHR-277), indicating that
the amount of GHBP cleaved from GHR-277-expressing cells
was approximately 3 times higher than that from GHR-fl
expressing cells.
FIG. 2. Scatchard plots of [125I]hGH binding to GHR-fl and GHR-277
in COS-7 cells. The representative data showed that GHR-277 demonstrated slightly higher binding affinity (Ka 5 0.61 3 109 mol/L21)
to hGH than GHR-fl (Ka 5 0.49 3 109 mol/L21).
1014
JCE & M • 1999
Vol 84 • No 3
IIDA ET AL.
TABLE 2. Relative abundance of GHBP in the culture medium of
GHR-fl- and GHR-277-expressing cells
Expression vectors
pcDNA1
pcDNA1/
GHR-fl
pcDNA1/
GHR-277
Radioactivity (cpm)
Relative abundance
to GHR-fl (fold)
84 6 13
0.08 6 0.02
1079 6 70
1
3299 6 131
3.08 6 0.20
FIG. 3. GH-induced internalization of GHR-fl and GHR-277. The internalization of GHR-277 was markedly reduced compared with that
of GHR-fl. The asterisk denotes P , 0.05 vs. corresponding GHR-fl.
Time course of GH-induced internalization of GHR-fl
and GHR-277
Critical amino acid residues for internalization of the GHR
are located within box 2 in the cytoplasmic domain (9), which
is absent in GHR-277. As a result of impaired internalization,
a large amount of truncated GHR-277 might be sustained at
the cell surface and become the source of GHBP. To clarify
this hypothesis, we have examined the time course of ligandinduced internalization of GHR-277 compared with that of
GHR-fl. In GHR-fl-expressing COS-7 cells, added [125I]hGH
was time dependently internalized; the rates of internalized
ligand to the total specific binding were 24.4 6 1.5%, 53.7 6
0.1%, and 75.6 6 4.2% at 15, 30, and 60 min after addition,
respectively. In contrast, in GHR-277-expressing cells, only
20% of the total specific binding was internalized 15 min after
the addition of GH, and this was sustained throughout the
study (17.5 6 2.0%, 14.1 6 0.5%, and 16.6 6 1.4% at 15, 30,
and 60 min after addition, respectively), as shown in Fig. 3.
Dominant negative effect of GHR-277 in GH
signal transduction
GH-induced tyrosine phosphorylation of STAT5b was
compared in CHO cells coexpressing GHR-277 and GHR-fl.
When increasing amounts of pcDNA1/GHR-277 (from 0.3–
3.0 mg) were cotransfected with 3.0 mg pcDNA1/GHR-fl,
GH-induced tyrosine phosphorylation of STAT5b was dose
dependently inhibited (Fig. 4). When the vectors of both
pcDNA1/GHR-fl and pcDNA1/GHR-277 were cotransfected in equal amounts, GH-induced tyrosine phosphorylation of STAT5b was significantly reduced compared with
that transfected with pcDNA1/GHR-fl alone, indicating a
dominant negative effect of GHR-277 on GH signal transduction.
FIG. 4. GH-induced tyrosine phosphorylation of STAT5b in CHO
cells coexpressing both GHR-fl and GHR-277. Transfected CHO cells
were stimulated by 100 ng/mL hGH for 15 min and lysed. Cell lysates
were immunoprecipitated with anti-STAT5b antibody and analyzed
by Western blotting using antiphosphotyrosine antibody (upper panel). Tyrosine phosphorylation of STAT5b was reduced when the
weight of transfected pcDNA1 containing GHR-277 cDNA was increased. In contrast (lower panel), when immunoprecipitated and
blotted with anti-STAT5b antibody alone, the amount of STAT5b was
equal in each lane, indicating that the difference in tyrosine phosphorylation of STAT5b was not due to the amount of STAT5b. These
results showed the dominant negative effect of GHR-277 in GH signal
transduction.
Discussion
We previously reported a family of short siblings with
partial GHIS showing high serum GHBP levels, in whom we
found a novel heterozygous donor splice site mutation in
intron 9 of the GHR gene (6). To clarify whether the heterozygous point mutation of the GHR gene is responsible for
the clinical characteristics of the patients, we characterized
the function of the truncated GHR in vitro using recombinant
GHR-277.
The clinical features of the patients were similar to those
of the patient reported by Woods et al. (4) and Silbergeld et
al. (4a), who showed GH resistance and high serum GHBP
levels. In their patient, truncated GHR lacking both transmembrane and intracellular domains is produced by a splice
site mutation of exon 8 of the GHR gene and complete deletion of exon 8. This truncated GHR is presumed to be
unanchored in the cell membrane and released into the serum as mutated GHBP. In contrast, in our patients, the extracellular and transmembrane domains of GHR-277 are
identical to those of wild-type full-length GHR, but the intracellular domain of GHR-277 consists of only seven amino
acids, lacking both boxes 1 and 2. One of the clinical characteristics shared by patient reported by Woods et al. and our
patients is a high serum GHBP level. The present in vitro
studies revealed that GHBP levels in the medium from GHR277-expressing cells were approximately 3 times higher than
those from GHR-fl-expressing cells, in good agreement with
clinical findings observed in our patients. Since GHR-277
could be anchored on the cell surface, the mechanism for
increased production of GHBP seemed to be different from
that in the case reported by Woods et al. (4) and Silbergeld
et al. (4a). Scatchard analysis confirmed that GHR-277 was
apparently expressed on the cell surface of COS-7 cells transfected with pcDNA1/GHR-277. There were twice as many
GH-binding sites on GHR-277-expressing cells as on GHR-
CHARACTERIZATION OF THE TRUNCATED GHR
fl-expressing cells, which is consistent with previous reports
(15–17). Furthermore, GHR-277 possessed 1.5 6 0.4 times
greater binding affinity to hGH than GHR-fl. There are conflicting data regarding the binding affinity of truncated GHR
to GH. Ross et al. showed that the truncated GHR consisting
of 279 amino acids (GHR-279) have about half the binding
affinity to hGH as GHR-fl (8), whereas Dastot et al. reported
that GHR-279 possesses about 2 times higher affinity than
GHR-fl (18). Our data using GHR-277 are consistent with the
findings by Dastot et al. Although the reasons why the truncated GHR including GHR-277 showed higher binding affinity than GHR-fl were unclear, the conformational change
due to the lack of an intracellular domain might influence
binding with the ligand. Increased binding sites in GHR277-expressing cells might be explained by impaired internalization of GHR-277. The GH-induced internalization of
GHR-277 was significantly reduced compared with that of
GHR-fl (Fig. 3), probably because GHR-277 lacked critical
amino acid residues for ligand-mediated internalization of
the GHR (9). As a result of reduced internalization, increased
amounts of GHR-277 would be sustained at the cell surface
and become the source of soluble GHBP in serum/medium
through the proteolytic cleavage of the membrane-anchored
GHR. The possibility of an increased number of GHR-277 in
the cell membrane was proved by an actual increase in binding sites for the GH ligand in GHR-277-expressing COS-7
cells. Interestingly, despite a 2-fold increase in the number of
GH-binding sites on the cell surface of GHR-277-expressing
cells, the GHBP levels in culture media were approximately
3 times higher than those in GHR-fl-expressing cells, suggesting the necessity of considering additional factors, such
as the change in the turnover rate of GHR, the sensitivity of
GHR to enzymatic cleavage, etc.
Another interesting characteristic of our patients was the
development of the partial insensitivity to GH despite the
heterozygous mutation. In GH signal transduction, the
dimerization of GHR causes tyrosyl phosphorylation of both
GHR and Janus kinase-2 (JAK2) (19), in the process of which
the box 1 motif of GHR is required for association with JAK2
(20). As the mutations of GHR in our patients were heterozygous, three different types of GHR dimerization are
theoretically proposed: namely, the homodimers of two
GHR-fl, the heterodimers of GHR-fl and GHR-277, and the
homodimers of two GHR-277. It was recently demonstrated
that GHR-277 could form the heterodimer with GHR-fl (7).
The homodimers of two GHR-fl could transduce the GH
signal. However, as GHR-277 lacks box 1 motif, the homodimers of two GHR-277 and probably the heterodimers of
GHR-277 and GHR-fl could not transduce the GH signal. As
demonstrated in this study, the number of GHR-277 receptors at the cell surface and the binding affinity of GHR-277
to GH were both greater than those of GHR-fl. Therefore,
GHR-277 would bind many more GH molecules than GHR-fl
even if equal amounts of receptor proteins are produced from
each allele of the GHR gene. In consequence, normal GH
signaling would attenuate when GHR-277 and GHR-fl are
coexpressed, indicating the new type of mechanism exerting
a dominant negative action. The dominant negative effect of
GHR-277 on GH signal transduction was clearly verified in
in vitro experiments showing that tyrosine phosphorylation
1015
of STAT5b was obviously reduced when the same amounts
of cDNAs of GHR-277 and GHR-fl were cotransfected.
It is of interest that GHR-279 and GHR-277 are both
physiologically produced isoforms of GHR by alternative
splicing of the common transcript of GHR gene (8, 18).
GHR-279 possesses not only an increased capability to
produce GHBP, but also shows impaired internalization
and down-regulation (21). These truncated isoforms of
GHR may play a role as a negative regulator of GH signal
transduction and a source of GHBP production in the
tissues or cells expressing the truncated GHR isoforms.
However, the physiological significance of these truncated
GHR isoforms remains unclear, as there are little data
regarding regional distribution and amounts of the truncated GHR in normal tissues.
In conclusion, we have characterized the function of GHR277 in vitro that was generated in a family with partial GH
insensitivity and high serum GHBP levels. The biological
characteristics of GHR-277 in vitro could well explain the
clinical features of the patients.
Acknowledgments
We thank Miss Chika Ogata for excellent technical assistance, Dr. F.
Kurimoto (Mitsubishi Kagaku Bio-Clinical Labs, Tokyo, Japan) for measurement of GHBP, and Dr. W. I. Wood (Genentech, Inc.) for providing
full-length GHR cDNA.
References
1. Laron Z, Pertzelan A, Mannheimer S. 1966 Genetic pituitary dwarfism with
high serum concentration of growth hormone–a new inborn error of metabolism? Isr J Med Sci. 2:152–155.
2. Rosenbloom AL, Rosenfeld RG, Guevara-Aguirre J. 1997 Growth hormone
insensitivity. Pediatr Clin North Am. 44:423– 442.
3. Duquesnoy P, Sobrier M-L, Duriez B, et al. 1994 A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH)
receptor confers familial GH resistance (Laron syndrome) with positive GHbinding activity by abolishing receptor homodimerization. EMBO J.
13:1386 –1395.
4. Woods KA, Fraser NC, Postel-Vinay M-C, Savage MO, Clark AJL. 1996 A
homozygous splice site mutation affecting the intracellular domain of the
growth hormone (GH) receptor resulting in Laron syndrome with elevated
GH-binding protein. J Clin Endocrinol Metab. 81:1686 –1690.
4a.Silbergeld A, Dastot F, Klinger B, et al. 1997 Intronic mutation in the growth
hormone (GH) receptor gene from a girl with Laron syndrome and extremely
high serum GH binding protein: extended phenotypic study in a very large
pedigree. J Pediatr Endocrinol Metab. 10:265–274.
5. Goddard AD, Covello R, Luoh S, et al. 1995 Mutations of the growth
hormone receptor in children with idiopathic short stature. N Engl J Med.
333:1093–1098.
6. Iida K, Takahashi Y, Kaji H, et al. 1998 Growth hormone (GH) insensitivity
syndrome with high serum GH-binding protein levels caused by a heterozygous splice site mutation of the GH receptor gene producing a lack of intracellular domain. J Clin Endocrinol Metab. 83:531–537.
7. Ayling RM, Ross R, Towner P, et al. 1997 A dominant-negative mutation of
the growth hormone receptor causes familial short stature. Nat Genet.
16:13–14.
8. Ross RJM, Esposito N, Shen XY, et al. 1997 A short isoform of the human
growth hormone receptor functions as a dominant negative inhibitor of the
full-length receptor and generates large amounts of binding protein. Mol
Endocrinol. 11:265–273.
9. Allevato G, Billestrup N, Goujin L, et al. 1995 Identification of phenylalanine
346 in the rat growth hormone receptor as being critical for ligand-mediated
internalization and down-regulation. J Biol Chem. 270:17210 –17214.
10. Wang Y, Wood WI. 1995 Amino acids of the human growth hormone receptor
that are required for proliferation and Jak-STAT signaling. Mol Endocrinol.
9:303–311.
11. Kaji H, Casnellie JE, Hinkle PM. 1988 Thyrotropin releasing hormone action
in pituitary cells. J Biol Chem. 263:13588 –13593.
12. Takahashi Y, Shirono H, Arisaka O, et al. 1997 Biologically inactive growth
hormone caused by an amino acid substitution. J Clin Invest. 100:1159 –1165.
13. Deleted in proof.
1016
IIDA ET AL.
14. Deleted in proof.
15. Colosi P, Wong K, Leong SR, Wood WI. 1993 Mutational analysis of the
intracellular domain of the human growth hormone receptor. J Biol Chem.
268:12617–12623.
16. Sotiropoulos A, Perrot-Applanat M, Dinerstein H, et al. 1994 Distinct cytoplasmic regions of the growth hormone receptor are required for activation of
JAK2, mitogen-activated protein kinase, and transcription. Endocrinology.
135:1292–1298.
17. Wang X, Souza SC, Kelder B, Cioffi JA, Kopchick JJ. 1995 A 40-amino acid
segment of the growth hormone receptor cytoplasmic domain is essential for
GH-induced tyrosine phosphorylated cytosolic proteins. J Biol Chem.
270:6261– 6266.
18. Dastot F, Sobrier ML, Duquesnoy P, Duriez B, Goossens M, Amselem S. 1996
Alternative spliced forms in the cytoplasmic domain of the human growth
hormone (GH) receptor regulate its ability to generate a soluble GH-binding
protein. Proc Natl Acad Sci USA. 93:10723–10728.
19. Argetsinger LS, Campbell GS, Yang X, et al. 1993 Identification of JAK2 as
a growth hormone receptor-associated tyrosine kinase. Cell. 74:237–244.
20. Tanner JW, Chen W, Young RL, Longmore GD, Shaw AS. 1995 The conserved
box 1 motif of cytokine receptors is required for association with JAK kinases.
J Biol Chem. 270:6523– 6530.
21. Amit T, Bergman T, Dastot F, Youdim MBH, Amselem S, Hochberg Z. 1997
A membrane-fixed, truncated isoform of the human growth hormone receptor.
J Clin Endocrinol Metab. 82:3813–3817.
27th European Symposium on Calcified Tissues
May 6 –10, 2000
Tampere, Finland
Hosted by the Finnish Bone Society and organized in cooperation with the European Calcified Tissues
Society, the program for the 27th European Symposium on Calcified Tissues will discuss the most recent research
and clinical applications of the skeletal diseases. Main sessions will include:
1.
2.
3.
4.
5.
6.
7.
8.
9.
JCE & M • 1999
Vol 84 • No 3
Mechanisms of action of bisphosphonates
Biology and function of osteocytes
Osteoblasts, and osteclasts
Tissue engineering; including bone, teeth, and cartilage
SERMS
Osteoporosis: pathogenesis, treatment
Male osteoporosis
Physical loading of skeleton
HOT STUFF—most recent and important topics in the area of mineralized tissues
For further information, view our website at www.congcreator.com/ects-2000 or contact the Congress Secretariat, E-mail: [email protected]; fax: 1358 9 4542 1930; or write CongCreator CC, P.O. Box 762,
FIN-00101 Helsinki, Finland.