Download Growth Hormone (GH) Insensitivity Syndrome with High Serum GH

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Complement component 4 wikipedia , lookup

Transcript
0021-972X/98/$03.00/0
Journal of Clinical Endocrinology and Metabolism
Copyright © 1998 by The Endocrine Society
Vol. 83, No. 2
Printed in U.S.A.
Growth Hormone (GH) Insensitivity Syndrome with
High Serum GH-Binding Protein Levels Caused by a
Heterozygous Splice Site Mutation of the GH Receptor
Gene Producing a Lack of Intracellular Domain*
KEIJI IIDA, YUTAKA TAKAHASHI, HIDESUKE KAJI, OSAMU NOSE,
YASUHIKO OKIMURA, HIROMI ABE, AND KAZUO CHIHARA
Third Division, Department of Medicine, Kobe University School of Medicine (K.I., Y.T., H.K., Y.O.,
H.A., K.C.), Kobe, Japan; and the Nose Clinic (O.N.), Osaka, Japan
ABSTRACT
Most of the GH receptor (GHR) gene abnormalities causing GH
insensitivity syndrome (GHIS) are located in the region coding the
extracellular domain, and serum GH-binding protein (GHBP) levels,
determined by ligand-mediated immunofunctional assay, are low in
most of the patients with GHIS. We present here a heterozygous point
mutation of the donor splice site in intron 9 of the GHR gene in two
Japanese siblings with GHIS, whose serum GHBP levels were high.
The same mutation was found in their mother as well. The analysis
of ribonucleic acid from the peripheral leukocytes revealed complete
skipping of exon 9 from one allele, but not the other, in the GHR
complementary DNA and appearance of a premature stop codon in
exon 10. The translated protein was truncated with deletion of 98%
of the intracellular domain of the GHR, including boxes 1 and 2, which
are critical for GH signal transduction and GHR internalization,
respectively. Recently, it was shown that the truncated GHR lacking
the intracellular domain was physiologically present in a minute
amount, served as a negative regulator for GH signaling, and possessed increased capacity to generate GHBP. Therefore, the mutation
found in our patients caused the pathogenetic production of the truncated GHR with a dominant negative effect on GH signaling, which
is probably responsible for their short stature and high serum GHBP
levels. (J Clin Endocrinol Metab 83: 531–537, 1998)
L
with GH and normal serum GHBP levels. Woods et al. (8)
demonstrated a donor splice site mutation resulting in the
complete deletion of exon 8, which codes for the transmembrane domain of the GHR and produced a truncated GHR
lacking both transmembrane and intracellular domains. This
truncated GHR is presumed to be unanchored in the cell
membrane and might be measurable in the serum as GHBP
if it is expressed. Recently, Ayling et al. (9) reported GHIS
caused by a truncated GHR consisting of 277 amino acids
[GHR-(1–277)] that formed heterodimers with wild-type fulllength GHR and inhibited the function of normal GHR in a
dominant negative fashion.
In this study we report a novel heterozygous mutation at
the donor splice site of intron 9 of the GHR gene in Japanese
siblings with GHIS. This mutation resulted in the complete
skipping of exon 9 from one allele and produced the truncated GHR-(1–277) lacking the intracellular domain, structurally identical to that of the case reported by Ayling et al.
(9). It is of interest, however, that our patients showed approximately 2-fold higher serum GHBP levels than the upper
limit of the normal range, supporting the previous in vitro
evidence.
ARON et al. (1) first reported several Oriental Jewish
families showing GH insensitivity syndrome (GHIS).
They showed severe postnatal growth failure with the typical
phenotype of GH deficiency. The biochemical characteristics
include a normal to high serum GH level and a low level of
both serum insulin-like growth factor I (IGF-I) and IGFbinding protein 3 (IGFBP-3), which fail to rise after exogenous GH administration (2). Although the genetic basis causing GHIS includes the mutation in the GH receptor (GHR),
the postreceptor signal transduction proteins, or the IGF-I
locus, defects in the GHR account for almost all reported
cases to date. Most abnormalities in the GHR gene are located
in the region encoding the extracellular domain of the GHR,
including deletion of exons, nonsense and missense mutations, a frame shift, and mutations affecting splicing (3–5).
Serum GHBP was either not detected or was extremely low
in most patients (3), but some patients demonstrated normal
to high levels of serum GHBP (6). Duquesnoy et al. (7) reported that the missense mutation of GHR (D152H) caused
a failure of receptor dimerization despite normal binding
Received July 9, 1997. Revision received October 22, 1997. Accepted
November 6, 1997.
Address all correspondence and requests for reprints to: Dr. K. Iida,
Third Division, Department of Medicine, Kobe University School of
Medicine, 7–5-1 Kusunoki-cho, Chuo-ku, Kobe 650, Japan.
* This work was supported in part by Grants-in-Aid for Scientific
Research 05807089, 06807082, and 07671138 from the Japanese Ministry
of Education, Science, Sports, and Culture and grants from the Japanese
Ministry of Health and Welfare, Novo Nordisk Growth, and Growth
Science Foundation 1995 and 1996.
Subjects and Methods
Patients
Patients 1 and 2 were Japanese siblings. Patient 1 was a 13.3-yr-old
boy showing the mild clinical phenotype associated with a lack of GH
action, including a prominent forehead and a saddle nose. Patient 2 was
a 9.2-yr-old girl with the same clinical phenotype as patient 1. Their
531
532
JCE & M • 1998
Vol 83 • No 2
IIDA ET AL.
parents were not related. Their father was 172 cm tall (within the normal
range) without clinical phenotypes of GH insensitivity. Their mother
was 147 cm tall (2.0 sd below the mean for age and sex) and also showed
a prominent forehead and a saddle nose. Her facial appearance seemed
to be more typical for the phenotype of GHIS than those of patients 1
and 2. The clinical characteristics and laboratory findings of patients 1
and 2 and their mother are shown in Table 1.
Hormone assays
Serum GH was measured by an immunoradiometric assay kit (Pharmacia, Uppsala, Sweden). Serum IGF-I and IGFBP-3 were measured by
RIAs (10). IGF-I was measured after extraction of the binding proteins.
Serum GHBP was determined by a ligand-mediated immunofunctional
assay, as described previously (11).
Genetic analysis
Genomic DNA was isolated from peripheral blood leukocytes of
patients 1 and 2, their mother, and a normal subject (12).
Each exon of the GHR gene was individually amplified by PCR with
the primer pairs shown in Table 2. Exon 10 was amplified with three
pairs of primers. M13 primer was attached to the 59-terminus of one of
each primer pairs to be used for direct sequencing. In exons 3, 7, 8, and
9, PCR amplification with each primer pair involved an initial period of
denaturation for 1 min at 94 C, followed by 35 cycles consisting of 1 min
of denaturation at 94 C, 30 s of annealing at 52 C, 30 s of extension at
72 C, and a final period of extension at 72 C for 7 min. In other exons,
the amplification involved an initial period of denaturation for 1 min at
94 C, followed by 35 cycles consisting of 1 min of denaturation at 94 C,
2 min of annealing at 52 C, 2 min of extension at 72 C, and a final period
of extension at 72 C for 7 min. The amplification products were purified
and analyzed by direct sequencing using a DNA sequencer (model 377,
Perkin-Elmer, Applied Biosystems, Foster, CA).
Restriction enzyme analysis
The PCR products of exon 9 of the GHR gene with patients 1 and 2
and their mother were digested with MaeIII (Boehringer Mannheim,
Mannheim, Germany). Digested fragments were separated on 3%
NuSieve agarose gel (FMC BioProducts, Rockland, ME) and visualized
by ethidium bromide staining.
Ribonucleic acid (RNA) analysis
Peripheral lymphocytes of patient 2, her mother, and a normal subject
were separated using mono-poly resolving medium (Flow Laboratories,
Costa Mesa, CA), and total RNA was isolated as described previously
(13). Total RNA (0.8 mg) was transcribed into complementary DNA
(cDNA) using 200 U Moloney murine leukemia virus reverse transcriptase (Life Technologies, Grand Island, NY) in 20 mL reaction solution containing 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3
mmol/L MgCl2, 10 mmol/L dithiothreitol, 0.5 mmol/L deoxy-NTPs, 10
ng oligo(deoxythymidine)12–18, and 10 mg ribonuclease inhibitor. Then,
the reaction mixtures were incubated for 60 min at 37 C and inactivated
for 5 min at 95 C. The synthesized cDNA was amplified by PCR with
primer pairs of GHRS-7 and GHRAS-10 shown in Table 2 and Fig. 4. The
amplification by PCR involved an initial period of denaturation at 94 C
for 1 min, followed by 35 cycles consisting of 1 min of denaturation at
94 C, 30 s of annealing at 52 C, 30 s of extension at 72 C, and a final period
of extension at 72 C for 7 min. The PCR products were separated on 2%
Agarose S gel (Nippon Gene Co., Toyama, Japan) and visualized by
ethidium bromide staining. The amplification products consisting of
two distinct bands were individually purified and sequenced using the
DNA sequencer (model 377, Perkin-Elmer, Applied Biosystems).
Results
Endocrinological findings
In both patients 1 and 2 and their mother, serum GH levels
ranged from normal to high in the baseline as well as the
stimulated peaks (unknown in the mother); conversely, serum IGF-I and IGFBP-3 levels were both significantly low
(Table 1). IGF-I generation tests in the siblings revealed only
a minimal rise in serum IGF-I levels after exogenous GH
administration. These findings were compatible with the
data in GHIS. A unique finding in this family was that their
serum GHBP levels were 2-fold higher than the upper limits
of the normal range.
TABLE 1. Clinical and laboratory findings of the patients with GH insensitivity syndrome and their mother
Sex
Ht (cm)
BW (kg)
Bone age (yr)
Ht at birth (cm)
BW at birth (kg)
Serum GH (mg/L)
Basal
Peak after provocation by
Arginine (0.5 g/kg, iv)
Clonidine (0.15 mg, orally)
Levodopa (500 mg, orally)
Serum IGF-I (mg/L)
Serum IGFBP-3 (mg/mL)
Serum GHBP (pmol/L)
Total
Complex
Before and after IGF-I generation testc
Serum IGF-I (mg/L)
Serum IGFBP-3 (mg/mL)
Patient 1
Patient 2
Mother
Male
134.0 (23.0)a
36.8
12.5
46.0 (21.0)
2.8 (21.0)
Female
111.3 (23.5)
23.2
7.5
51.0 (average)
3.2 (average)
Female
147.0 (22.0)
45.0
Unknown
Unknown
Unknown
1.0 – 40.4
0.5–38.3
1.2
23.8
47.4
31.7
53.7
(286.8 –799.7)b
2.28 (2.99 –5.00)
36.1
48.1
23.4
31.0
(186.0 – 893.0)
1.42 (2.33– 4.91)
NT
NT
NT
37.0
(121.0 – 436.0)
1.52 (2.17– 4.05)
896 (65– 408)
20.1
871 (65– 408)
20.1
813 (65– 408)
23.8
108 and 146
3.16 and 2.78
39.7 and 60.4
2.28 and 2.67
NT
NT
NT, Not tested.
a
The SD from the mean for age and sex is in brackets.
b
The normal limits of each parameter are in parentheses.
c
A daily sc injection of recombinant human GH (0.1 IU/kg z day) for 3 days.
GHIS WITH HIGH SERUM GHBP LEVELS
533
TABLE 2. Primer pairs for analysis of GHR gene and GHR cDNA
Exon 2: M13-2F
Exon 3: M13-3F
Exon 4: M13-4F
Exon 5: 5F
Exon 6: M13-6F
Exon 7: M13-7F
Exon 8: M13-8F
Exon 9: 9F
Exon 10:
M13-10.1F
10.2F
M13-10.3F
TGTAAAAGCACGGCCAGTTGGTCTGCTTTTAATTGCTG
2R GAATACAGTTCAGTGTTGTT
TGTAAAACGACGGCCAGTGCCTTCCTCTTTCTGTTTCA
3R GGATAGTAGCTTAATTACAC
TGTAAAACGACGGCCAGTAGGATCACATATGACTCACC
4R AGGAAAATCAGAAAGGCATG
ACTTAAGCTACAACATGATT M13-5R TGTAAAACGACGGCCAGTGCTTCCCCATTTATTTAGTC
TGTAAAACGACGGCCAGTATTGTGTCTGTCTGTGTACT
6R GTCAAAGTGTAAGGTGTAGC
TGTAAAACGACGGCCAGTTAGTGTTCATTGGCATTGAG
7R ACAAAAGCCAGGTTAGCTAC
TGTAAAACGACGGCCAGTAACTGTGCTTCAACTAGTCG
8R TGGCAAGGTCTAACACAACT
TATGTAGCTTTTAAGATGTC M13-9R TGTAAAACGACGGCCAGTGACAGGAGTCTTCAGGTGTT
GHR cDNA:
TGTAAAACGACGGCCAGTGATCTTCATTTTCTTTCTAT
10.1R CTACCTGCTGGTGTAATGTC
CATCGACTTTTATTGCCCAGG M13-10.2R TGTAAAACGACGGCCAGTATGAATGGAGGTATAGTCTGG
TGTAAAACGACGGCCAGTCATGTTCCAGGTTCTGAGAT
10.3R GGTTTAAACATTGTTTTGGC
GHRS 7 ACACTTCCTCAGATGAGC
GHRAS10 CACTGTGGAATTCGGGTTTA
Underlines indicate the nucleotide sequence of the M13 primer.
FIG. 1. Direct sequencing from genomic DNA of the exon/intron junction of exon 9 of the GHR gene. Compared with a normal subject, patient
1 was heterozygous for a G to A transition at the 11 position of the 59-donor splice site of intron 9.
Identification of a heterozygous mutation in the GHR gene
Sequencing of the GHR gene of patients 1 and 2 and their
mother revealed a heterozygous G to A transition at the 11
position of the 59-donor splice site of intron 9 (Fig. 1). No
additional abnormalities were detected in their GHR genes.
Unfortunately, we could not examine their father’s genotype.
The pedigree and genotype of the family members are shown
in Fig. 2.
Restriction enzyme analysis
The sequence of the wild-type GHR gene contains a recognition site for the restriction enzyme MaeIII. In contrast, the
G to A transition at the 11 position of the 59-donor splice site
of intron 9 disrupts this recognition site. In control subjects,
the digestion with MaeIII of the amplified 180-bp fragment
of exon 9 yields both 120- and 60-bp fragments, whereas in
affected individuals the 180-bp fragment would be not digested with MaeIII. As shown in Fig. 3, the restriction enzyme
analysis of both patients and their mother revealed the presence of three bands of 180-, 120-, and 60-bp fragments, indicating a heterozygous mutation.
cDNA analysis
The site in which we found the G to A transition was a
conserved nucleotide of the donor splice site critical for the
normal splicing (14). It is presumed that this G to A transition
could result in a splicing abnormality, i.e. the skipping of
exon 9. To elucidate the splicing abnormality, the sequencing
of GHR cDNA of the patient was required. We obtained the
fragments of GHR cDNAs of patient 2 and her mother from
peripheral lymphocytes and compared them with those of a
normal subject.
534
JCE & M • 1998
Vol 83 • No 2
IIDA ET AL.
The amplification of cDNA using primers GHRS-7 and
GHRAS-10 in a normal subject produced a band of 267 bp,
as predicted (Fig. 4). Amplification of the cDNAs of patient
2 and her mother produced distinct two bands, 267 and 197
bp in size (Fig. 4). Direct sequencing of the amplification
products of 197 bp revealed that exon 9 was completely
skipped in the GHR messenger RNA (mRNA) of patient 2
FIG. 2. Pedigree and genotype of the family members. A heterozygous transition was detected in patients 1 and 2 and their mother.
N.D, Not determined.
FIG. 3. Restriction enzyme analysis of
PCR products from patients 1 and 2,
their mother, and a normal subject. A
180-bp fragment was amplified by PCR
using oligonucleotide primers 9F and
M13-9R from the genomic DNA in both
patients, their mother, and a normal
subject. The wild-type PCR products
contained a MaeIII site (underlined)
and produced two fragments of 120 and
60 bp by digestion with MaeIII, whereas
the transition (asterisk) disrupted this
MaeIII site and was uncut by MaeIII.
After digestion with MaeIII for 1 h,
DNA fragments were separated on 3%
NuSieve agarose gel and visualized by
ethidium bromide staining. Patients 1
(P1) and 2 (P2) and their mother (M)
showed three bands of 180-, 120-, and
60-bp fragments, indicating their heterozygosity for this mutation, whereas
a normal subject (C) showed two bands
of 120- and 60-bp fragments. Mk, Molecular size marker.
(Fig. 5). This splicing abnormality caused a frame shift in
translation and the appearance of a premature stop codon,
resulting in the production of truncated GHR whose intracellular domain consisted of only seven amino acids (Fig. 6).
Discussion
We present here a unique case of Japanese short siblings.
The clinical features of the patients were characterized by a
partial response to exogenous GH and high serum GHBP
levels, which differed from the findings in most of the reported patients with GHR gene abnormalities. A novel heterozygous mutation in the GHR gene was identified in the
patients. This mutation was located at the 11 position of the
donor splice site of intron 9, which was a conserved and
critical site for normal splicing (14), consequently resulting in
a complete skipping of exon 9 from one allele. Exon 9 of the
GHR consists of 70 nucleotides, and it was supposed that the
deletion of exon 9 from the GHR mRNA would cause a frame
shift in its translation and a premature termination at codon
278. The truncated GHR [GHR-(1–277)] from the mRNA
lacking exon 9 contained only seven amino acids in the
intracellular domain, but the extracellular and transmembrane domains of GHR-(1–277) were identical to those of
normal GHR.
Signal transduction of GH is initiated by binding of a
single GH molecule to its receptor (GHR), followed by GHR
dimerization (15). In vitro experiments revealed the critical
amino acids for ligand binding and receptor dimerization
located at the extracellular domain of the GHR (16). In the
cytoplasmic domain, GHR shares two motifs with other cytokine receptor superfamilies. The proline-rich motif, referred to as box 1, consisted of ILPPVPVP in GHR. The
GHIS WITH HIGH SERUM GHBP LEVELS
535
FIG. 4. The effect of the mutation on
splicing of the GHR gene. The amplification products of cDNA from patient 2,
her mother, and a normal subject by
PCR using oligonucleotide primers
GHRS-7 and GHRAS-10, the sequences
of which are listed in Table 2, were separated on 2% Agarose S gel and visualized by ethidium bromide staining. In
a normal subject (C), only a 267-bp fragment was obtained, as predicted,
whereas in patient 2 (P2) and her
mother (M), another 197-bp fragment
was obtained in addition to the 267-bp
fragment, in agreement with complete
skipping of the 70-bp exon 9. Mk, Molecular size marker. The asterisk denotes the mutation site.
second motif, called box 2, is located approximately 30 amino
acids distant from the carboxyl-terminal of box 1 and spans
about 15 amino acids (17). In a process of GH signal transduction, the dimerization of GHR activates the GHR-associated JAK2 tyrosine kinase, and it is followed by tyrosyl
phosphorylation of both GHR and JAK2 (18). The studies
using truncated and mutated GHR revealed that the box 1 is
a critical region for GH-dependent JAK2 association with
GHR and for tyrosyl phosphorylation and activation of JAK2
(19 –22). As GHR-(1–277) lacks both boxes 1 and 2, it is simply
supposed that this truncated GHR would be unable to transduce the GH signal. However, it remains unclear why the
patients showed the partial resistance to exogenous GH and
high GHBP levels. The mutation found in our patients was
heterozygous, so wild-type GHR would be expressed as well.
It is of interest that the short isoforms of human GHR were
recently reported to be physiologically produced by alternative splicing of the common transcript (23, 24). One of the
short GHR isoforms was produced by splicing at an alternative 39 acceptor splice site 26 bp downstream in exon 9,
resulting in the formation of the truncated GHR consisting of
279 amino acids [GHR-(1–279)] (23, 24). Another short isoform was produced by skipping exon 9, resulting in the
truncated GHR consisting of 277 amino acids [GHR-(1–277)]
(24). The latter was identical to that found in our patients.
GHR-(1–279) has only nine amino acids in the cytoplasmic
domain and lacks both boxes 1 and 2. Ribonuclease protection experiments using IM-9 cells and human liver revealed
that the proportion of alternative splice to full-length GHR
was 1–10% for GHR-(1–279) and less than 1% for GHR(1–277) (24). As the short isoforms of GHR are expressed in
only a small amount, their physiological significance remains
to be clarified. In our patients, however, at least a half of the
expressed GHR seemed to correspond to GHR-(1–277) when
assessed from the amplified cDNA products of peripheral
lymphocytes using GHRS-7 and GHRAS-10.
Immunoprecipitation and Western blotting experiments
of cells transfected with GHR-(1–279) and/or full-length
GHR revealed that GHR-(1–279) and full-length GHR could
form heterodimers, and GHR-(1–279) could only be internalized when complexed with full-length GHR (24). Functional studies using a reporter gene containing the STAT5
(signal transducer and activator of transcription-5)-binding
element demonstrated that GHR-(1–279) could suppress the
action of full-length GHR even when the ratio of the cDNA
transfected was 1:10 for GHR-(1–279) to full-length GHR,
suggesting a dominant negative effect of GHR-(1–279) (24).
Very recently, Ayling et al. (9) reported a short child with
GHIS due to a heterozygous mutation at the 21 position of
intron 8 of the GHR gene, resulting in the complete skipping
of exon 9 and the production of truncated GHR-(1–277). The
truncated GHR produced by mutation of the GHR gene in
our patients was structurally identical to that described by
Ayling et al. (9), but the mutation site and high serum GHBP
levels found in our patients were different from those in the
case reported by Ayling et al. (9). In vitro experiments revealed that GHR-(1–277) could form heterodimers with fulllength GHR and completely inhibit the function of fulllength GHR if the ratio of the cDNA transfected was equal
(9). Based on these findings, it is likely that GHR-(1–277)
behaves like GHR-(1–279).
Furthermore, the expression studies of the truncated GHR(1–279) revealed that the binding affinity of GHR-(1–279) to
GH was twice that of the wild-type GHR (23). In contrast,
another study showed that GHR-(1–279) had a 2-fold lower
affinity and increased binding capacity compared to the full-
536
IIDA ET AL.
JCE & M • 1998
Vol 83 • No 2
FIG. 5. Sequencing analysis of the 197-bp PCR product from the cDNA in patient 2 and of the 267-bp PCR product from a normal subject. These
findings confirmed the complete skipping of exon 9 in the GHR cDNA of patient 2 by which exon 8 was directly united with exon 10, whereas
normal splicing caused a combination of exon 8 into exon 9 in a normal subject. The sequence analysis of her mother led to the same results.
FIG. 6. Deduced sequences of translated products of the wild-type
and truncated GHR. The boundary between the transmembrane and
intracellular domains is marked by a slash. The intracellular domain
of the truncated GHR contained only seven amino acids, including
three novel amino acids in the C-terminus, lacking both box 1 and box
2 regions.
length wild-type GHR (24). The increase in the binding capacity for expressed GHR-(1–279) vs. wild-type GHR is consistent with that previously reported for the truncated rabbit
GHR (21). The studies of the short isoforms of the rat GHR
revealed that the increase in binding sites correlates with an
impaired internalization of the GHR (25). Critical amino acid
residues for internalization of the rat GHR are known to be
located within box 2 in a cytoplasmic domain (25), which is
absent in GHR-(1–279), GHR-(1–277), or the truncated rabbit
GHR. As a result of the reduced internalization, increased
amounts of the truncated GHR could be sustained at the cell
surface and become the source of GHBP. Actually, it was
reported that the medium of COS-7 cells transfected with
GHR-(1–279) produced 4.5-fold more GHBP than that transfected with full-length wild-type GHR (23), and the medium
of 293 cells transfected with GHR-(1–279) contained 20-fold
more GHBP than that transfected with full-length GHR (24).
The results of these transfection studies are consistent with
the clinical in vivo data of our patients, in whom serum GHBP
levels were 2-fold higher than the upper limit of the normal
range, although the patients reported by Ayling et al. (9)
showed normal serum GHBP levels. The discrepancy in serum GHBP levels between the patients of Ayling et al. and
ours remains to be elucidated, but it may simply reflect a
methodological difference. Ayling et al. determined serum
GHBP levels by the radiolabeled human GH assay, which
might be less sensitive than the ligand-mediated immunofunctional assay we used.
In general, it was reported that serum GHBP levels were
not detected or were extremely low in most patients with
GHR gene abnormalities (3), but some patients demonstrated
normal to high levels of serum GHBP (7, 8). Our patients also
showed high serum GHBP levels. Therefore, we would insist
that the measurement of serum GHBP levels in a patient with
idiopathic short stature is useful not only for distinction from
classical GHR gene abnormalities but also for presumption
of the mutation site in the GHR gene.
As the mutation in the GHR gene was heterozygous in our
patients, three different types of GHR dimerization were
hypothesized, as shown in Fig. 7. The homodimers of two
full-length wild-type GHR would be normally internalized
and transduce the GH signal into cells. In contrast, the homodimers of two GHR-(1–277) were not internalized, were
sustained at the cell surface, and generated GHBP by proteolytic cleavage. The inhibition of full-length GHR signaling
GHIS WITH HIGH SERUM GHBP LEVELS
3.
4.
5.
6.
7.
FIG. 7. A schema of the proposed GH-signaling mechanism in the
patients. As the mutations in the patients were heterozygous, three
different types of GHR dimerization are theoretically proposed:
namely, the homodimers of two wild-type GHR (left), the homodimers
of two truncated GHR mutants (right), and the heterodimers of wildtype GHR and truncated GHR mutant (center). The homodimers
formed by two wild-type GHR would transduce the GH signal, but the
homodimers formed by two mutant GHR would not transduce the GH
signal. The function of the heterodimers remains to be clarified. The
ability of a mutant GHR to bind to a wild-type GHR and prevent signal
transduction and the abundance of a mutant GHR at the cell surface
due to the reduced internalization both would be responsible for a
dominant negative phenomenon. W, Wild-type GHR; M, truncated
GHR mutant.
by the short form of GHR is known to depend upon the
concentration of human GH (23). Therefore, the inhibition by
GHR-(1–277) of wild-type GHR could be due to a competition between GHR-(1–277) and wild-type GHR for binding
of GH. Some proportion of GHR-(1–277) might be internalized through heterodimerization with full-length GHR, although the extent of heterodimers remains to be clarified.
Also, it remains unknown whether the heterodimerization of
GHR-(1–277) and full-length GHR could transduce the GH
signal into cells. In fact, our patients showed a partial IGF-I
response to exogenous GH administration in an IGF-I generation test. As the mutation in the GHR gene was heterozygous in our patients, wild-type GHR would be expressed on
the cells in an amount sufficient to induce partial IGF-I production (Fig. 7).
In conclusion, we have demonstrated a novel heterozygous donor splice site mutation of the GHR gene in Japanese
GHIS siblings. This mutation resulted in the complete skipping of exon 9 from one allele and the production of truncated GHR lacking the intracellular domain. The mutant
GHR was supposed to inhibit the effect of the normal GHR
in a dominant negative fashion and to produce a large
amount of GHBP.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Acknowledgment
We thank Miss Chika Ogata for excellent technical assistance.
24.
References
1. Laron Z, Pertzelan A, Mannheimer S. 1966 Genetic pituitary dwarfism with
high serum concentration of growth hormone-a new inborn error of metabolism? Isr J Med Sci. 2:152–155.
2. Savage MO, Blum WF, Ranke MB, et al. 1993 Clinical features and endocrine
25.
537
status in patients with growth hormone insensitivity (Laron syndrome). J Clin
Endocrinol Metab. 77:1465–1471.
Rosenfeld RG, Rosenbloom AL, Guevara-Aguirre J. 1994 Growth hormone
(GH) insensitivity due to primary GH receptor deficiency. Endocr Rev.
15:369 –390.
Sobrier M-L, Dastot F, Duquesnoy P, et al. 1997 Nine novel growth hormone
receptor gene mutations in patients with Laron syndrome. J Clin Endocrinol
Metab. 82:435– 437.
Baumbach L, Schiavi A, Bartlett R, et al. 1997 Clinical, biochemical, and
molecular investigations of a genetic isolate of growth hormone insensitivity
(Laron syndrome). J Clin Endocrinol Metab. 82:444 – 451.
Buchanan CR, Maheshwari HG, Norman MR, Morrell DJ, Preece MA. 1991
Laron-type dwarfism with apparently normal high affinity serum growth
hormone-binding protein. Clin Endocrinol (Oxf). 35:179 –185.
Duquesnoy P, Sobrier M-L, Duriez B, et al. 1994 A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH)
receptor confers familial GH resistance (Laron syndrome) with positive GHbinding activity by abolishing receptor homodimerization. EMBO J.
13:1386 –1395.
Woods KA, Fraser NC, Postel-Vinay M-C, Savage MO, Clark AJL. 1996 A
homozygous splice site mutation affecting the intracellular domain of the
growth hormone (GH) receptor resulting in Laron syndrome with elevated
GH-binding protein. J Clin Endocrinol Metab. 81:1686 –1690.
Ayling RM, Ross R, Towner P, et al. 1997 A dominant-negative mutation of
the growth hormone receptor causes familial short stature. Nat Genet.
16:13–14.
Baxter RC, Martin JL. 1986 Radioimmunoassay of growth hormone-dependent insulin-like growth factor binding protein in human plasma. J Clin Invest.
78:1504 –1512.
Carlsson LMS, Rosberg S, Vitangcol RV, Wong WLT, Albertsson-Wikland
K. 1993 Analysis of 24-hour plasma profiles of growth hormone (GH)-binding
protein, GH/GH-binding protein complex, and GH in healthy children. J Clin
Endocrinol Metab. 77:356 –361.
Gross-Bellard M, Oudet P, Chambon P. 1973 Isolation of high-molecularweight DNA from mammalian cells. Eur J Biochem. 36:32–38.
Maniatis T, Fritsch EF, Sambrook J. 1982 Molecular cloning: a laboratory
manual. Cold Spring Harbor: Cold Spring Harbor Laboratory.
Krawczak M, Reiss J, Cooper DN. 1992 The mutational spectrum of single
base-pair substitutions in mRNA splice junctions of human genes: causes and
consequences. Hum Genet. 90:41–54.
Cunningham BC, Ultsch M, De Vos AM, Mulkerrin MG, Clauser KR, Wells
JA. 1991 Dimerization of the extracellular domain of the human growth hormone receptor by a single hormone molecule. Science. 254:821– 825.
Chen C, Brinkworth R, Waters MJ. 1997 The role of receptor dimerization
domain residues in growth hormone signaling. J Biol Chem. 272:5133–5140.
DaSilva L, Howard OMZ, Rui H, Kirken RA, Farrar WL. 1994 Growth signaling and JAK2 association mediated by membrane-proximal cytoplasmic
regions of prolactin receptors. J Biol Chem. 269:18267–18270.
Argetsinger LS, Campbell GS, Yang X, et al. 1993 Identification of JAK2 as
a growth hormone receptor-associated tyrosine kinase. Cell. 74:237–244.
Wang Y-D, Wood WI. 1995 Amino acids of the human growth hormone
receptor that are required for proliferation and JAK-STAT signaling. Mol
Endocrinol. 9:303–307.
Frank SJ, Gilliland G, Kraft AS, Arnold CS. 1994 Interaction of the growth
hormone receptor cytoplasmic domain with the JAK2 tyrosine kinase. Endocrinology. 135:2228 –2239.
Sotiropoulos A, Perrot-Applanat M, Dinerstein H, Pallier A, Postel-Vinay
M-C. 1994 Distinct cytoplasmic regions of the growth hormone receptor are
required for activation of JAK2, mitogen-activated protein kinase, and transcription. Endocrinology. 135:1292–1298.
VanderKuur JA, Wang X, Zang L, Campbell GS, et al. 1994 Domains of the
growth hormone receptor required for association and activation of JAK2
tyrosine kinase. J Biol Chem. 269:21709 –21717.
Dastot F, Sobrier ML, Duquesnoy P, Duriez B, Goossens M, Amselem S. 1996
Alternatively spliced forms in the cytoplasmic domain of the human growth
hormone (GH) receptor regulate its ability to generate a soluble GH-binding
protein. Proc Natl Acad Sci USA. 93:10723–10728.
Ross RJM, Esposito N, Shen XY, et al. 1997 A short isoform of the human
growth hormone receptor functions as a dominant negative inhibitor of the
full-length receptor and generates large amounts of binding protein. Mol
Endocrinol. 11:265–273.
Allevato G, Billestrup N, Goujin L, et al. 1995 Identification of phenylalanine
346 in the rat growth hormone receptor as being critical for ligand-mediated
internalization and down-regulation. J Biol Chem. 270:17210 –17214.