Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
0021-972X/98/$03.00/0 Journal of Clinical Endocrinology and Metabolism Copyright © 1998 by The Endocrine Society Vol. 83, No. 2 Printed in U.S.A. Growth Hormone (GH) Insensitivity Syndrome with High Serum GH-Binding Protein Levels Caused by a Heterozygous Splice Site Mutation of the GH Receptor Gene Producing a Lack of Intracellular Domain* KEIJI IIDA, YUTAKA TAKAHASHI, HIDESUKE KAJI, OSAMU NOSE, YASUHIKO OKIMURA, HIROMI ABE, AND KAZUO CHIHARA Third Division, Department of Medicine, Kobe University School of Medicine (K.I., Y.T., H.K., Y.O., H.A., K.C.), Kobe, Japan; and the Nose Clinic (O.N.), Osaka, Japan ABSTRACT Most of the GH receptor (GHR) gene abnormalities causing GH insensitivity syndrome (GHIS) are located in the region coding the extracellular domain, and serum GH-binding protein (GHBP) levels, determined by ligand-mediated immunofunctional assay, are low in most of the patients with GHIS. We present here a heterozygous point mutation of the donor splice site in intron 9 of the GHR gene in two Japanese siblings with GHIS, whose serum GHBP levels were high. The same mutation was found in their mother as well. The analysis of ribonucleic acid from the peripheral leukocytes revealed complete skipping of exon 9 from one allele, but not the other, in the GHR complementary DNA and appearance of a premature stop codon in exon 10. The translated protein was truncated with deletion of 98% of the intracellular domain of the GHR, including boxes 1 and 2, which are critical for GH signal transduction and GHR internalization, respectively. Recently, it was shown that the truncated GHR lacking the intracellular domain was physiologically present in a minute amount, served as a negative regulator for GH signaling, and possessed increased capacity to generate GHBP. Therefore, the mutation found in our patients caused the pathogenetic production of the truncated GHR with a dominant negative effect on GH signaling, which is probably responsible for their short stature and high serum GHBP levels. (J Clin Endocrinol Metab 83: 531–537, 1998) L with GH and normal serum GHBP levels. Woods et al. (8) demonstrated a donor splice site mutation resulting in the complete deletion of exon 8, which codes for the transmembrane domain of the GHR and produced a truncated GHR lacking both transmembrane and intracellular domains. This truncated GHR is presumed to be unanchored in the cell membrane and might be measurable in the serum as GHBP if it is expressed. Recently, Ayling et al. (9) reported GHIS caused by a truncated GHR consisting of 277 amino acids [GHR-(1–277)] that formed heterodimers with wild-type fulllength GHR and inhibited the function of normal GHR in a dominant negative fashion. In this study we report a novel heterozygous mutation at the donor splice site of intron 9 of the GHR gene in Japanese siblings with GHIS. This mutation resulted in the complete skipping of exon 9 from one allele and produced the truncated GHR-(1–277) lacking the intracellular domain, structurally identical to that of the case reported by Ayling et al. (9). It is of interest, however, that our patients showed approximately 2-fold higher serum GHBP levels than the upper limit of the normal range, supporting the previous in vitro evidence. ARON et al. (1) first reported several Oriental Jewish families showing GH insensitivity syndrome (GHIS). They showed severe postnatal growth failure with the typical phenotype of GH deficiency. The biochemical characteristics include a normal to high serum GH level and a low level of both serum insulin-like growth factor I (IGF-I) and IGFbinding protein 3 (IGFBP-3), which fail to rise after exogenous GH administration (2). Although the genetic basis causing GHIS includes the mutation in the GH receptor (GHR), the postreceptor signal transduction proteins, or the IGF-I locus, defects in the GHR account for almost all reported cases to date. Most abnormalities in the GHR gene are located in the region encoding the extracellular domain of the GHR, including deletion of exons, nonsense and missense mutations, a frame shift, and mutations affecting splicing (3–5). Serum GHBP was either not detected or was extremely low in most patients (3), but some patients demonstrated normal to high levels of serum GHBP (6). Duquesnoy et al. (7) reported that the missense mutation of GHR (D152H) caused a failure of receptor dimerization despite normal binding Received July 9, 1997. Revision received October 22, 1997. Accepted November 6, 1997. Address all correspondence and requests for reprints to: Dr. K. Iida, Third Division, Department of Medicine, Kobe University School of Medicine, 7–5-1 Kusunoki-cho, Chuo-ku, Kobe 650, Japan. * This work was supported in part by Grants-in-Aid for Scientific Research 05807089, 06807082, and 07671138 from the Japanese Ministry of Education, Science, Sports, and Culture and grants from the Japanese Ministry of Health and Welfare, Novo Nordisk Growth, and Growth Science Foundation 1995 and 1996. Subjects and Methods Patients Patients 1 and 2 were Japanese siblings. Patient 1 was a 13.3-yr-old boy showing the mild clinical phenotype associated with a lack of GH action, including a prominent forehead and a saddle nose. Patient 2 was a 9.2-yr-old girl with the same clinical phenotype as patient 1. Their 531 532 JCE & M • 1998 Vol 83 • No 2 IIDA ET AL. parents were not related. Their father was 172 cm tall (within the normal range) without clinical phenotypes of GH insensitivity. Their mother was 147 cm tall (2.0 sd below the mean for age and sex) and also showed a prominent forehead and a saddle nose. Her facial appearance seemed to be more typical for the phenotype of GHIS than those of patients 1 and 2. The clinical characteristics and laboratory findings of patients 1 and 2 and their mother are shown in Table 1. Hormone assays Serum GH was measured by an immunoradiometric assay kit (Pharmacia, Uppsala, Sweden). Serum IGF-I and IGFBP-3 were measured by RIAs (10). IGF-I was measured after extraction of the binding proteins. Serum GHBP was determined by a ligand-mediated immunofunctional assay, as described previously (11). Genetic analysis Genomic DNA was isolated from peripheral blood leukocytes of patients 1 and 2, their mother, and a normal subject (12). Each exon of the GHR gene was individually amplified by PCR with the primer pairs shown in Table 2. Exon 10 was amplified with three pairs of primers. M13 primer was attached to the 59-terminus of one of each primer pairs to be used for direct sequencing. In exons 3, 7, 8, and 9, PCR amplification with each primer pair involved an initial period of denaturation for 1 min at 94 C, followed by 35 cycles consisting of 1 min of denaturation at 94 C, 30 s of annealing at 52 C, 30 s of extension at 72 C, and a final period of extension at 72 C for 7 min. In other exons, the amplification involved an initial period of denaturation for 1 min at 94 C, followed by 35 cycles consisting of 1 min of denaturation at 94 C, 2 min of annealing at 52 C, 2 min of extension at 72 C, and a final period of extension at 72 C for 7 min. The amplification products were purified and analyzed by direct sequencing using a DNA sequencer (model 377, Perkin-Elmer, Applied Biosystems, Foster, CA). Restriction enzyme analysis The PCR products of exon 9 of the GHR gene with patients 1 and 2 and their mother were digested with MaeIII (Boehringer Mannheim, Mannheim, Germany). Digested fragments were separated on 3% NuSieve agarose gel (FMC BioProducts, Rockland, ME) and visualized by ethidium bromide staining. Ribonucleic acid (RNA) analysis Peripheral lymphocytes of patient 2, her mother, and a normal subject were separated using mono-poly resolving medium (Flow Laboratories, Costa Mesa, CA), and total RNA was isolated as described previously (13). Total RNA (0.8 mg) was transcribed into complementary DNA (cDNA) using 200 U Moloney murine leukemia virus reverse transcriptase (Life Technologies, Grand Island, NY) in 20 mL reaction solution containing 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L MgCl2, 10 mmol/L dithiothreitol, 0.5 mmol/L deoxy-NTPs, 10 ng oligo(deoxythymidine)12–18, and 10 mg ribonuclease inhibitor. Then, the reaction mixtures were incubated for 60 min at 37 C and inactivated for 5 min at 95 C. The synthesized cDNA was amplified by PCR with primer pairs of GHRS-7 and GHRAS-10 shown in Table 2 and Fig. 4. The amplification by PCR involved an initial period of denaturation at 94 C for 1 min, followed by 35 cycles consisting of 1 min of denaturation at 94 C, 30 s of annealing at 52 C, 30 s of extension at 72 C, and a final period of extension at 72 C for 7 min. The PCR products were separated on 2% Agarose S gel (Nippon Gene Co., Toyama, Japan) and visualized by ethidium bromide staining. The amplification products consisting of two distinct bands were individually purified and sequenced using the DNA sequencer (model 377, Perkin-Elmer, Applied Biosystems). Results Endocrinological findings In both patients 1 and 2 and their mother, serum GH levels ranged from normal to high in the baseline as well as the stimulated peaks (unknown in the mother); conversely, serum IGF-I and IGFBP-3 levels were both significantly low (Table 1). IGF-I generation tests in the siblings revealed only a minimal rise in serum IGF-I levels after exogenous GH administration. These findings were compatible with the data in GHIS. A unique finding in this family was that their serum GHBP levels were 2-fold higher than the upper limits of the normal range. TABLE 1. Clinical and laboratory findings of the patients with GH insensitivity syndrome and their mother Sex Ht (cm) BW (kg) Bone age (yr) Ht at birth (cm) BW at birth (kg) Serum GH (mg/L) Basal Peak after provocation by Arginine (0.5 g/kg, iv) Clonidine (0.15 mg, orally) Levodopa (500 mg, orally) Serum IGF-I (mg/L) Serum IGFBP-3 (mg/mL) Serum GHBP (pmol/L) Total Complex Before and after IGF-I generation testc Serum IGF-I (mg/L) Serum IGFBP-3 (mg/mL) Patient 1 Patient 2 Mother Male 134.0 (23.0)a 36.8 12.5 46.0 (21.0) 2.8 (21.0) Female 111.3 (23.5) 23.2 7.5 51.0 (average) 3.2 (average) Female 147.0 (22.0) 45.0 Unknown Unknown Unknown 1.0 – 40.4 0.5–38.3 1.2 23.8 47.4 31.7 53.7 (286.8 –799.7)b 2.28 (2.99 –5.00) 36.1 48.1 23.4 31.0 (186.0 – 893.0) 1.42 (2.33– 4.91) NT NT NT 37.0 (121.0 – 436.0) 1.52 (2.17– 4.05) 896 (65– 408) 20.1 871 (65– 408) 20.1 813 (65– 408) 23.8 108 and 146 3.16 and 2.78 39.7 and 60.4 2.28 and 2.67 NT NT NT, Not tested. a The SD from the mean for age and sex is in brackets. b The normal limits of each parameter are in parentheses. c A daily sc injection of recombinant human GH (0.1 IU/kg z day) for 3 days. GHIS WITH HIGH SERUM GHBP LEVELS 533 TABLE 2. Primer pairs for analysis of GHR gene and GHR cDNA Exon 2: M13-2F Exon 3: M13-3F Exon 4: M13-4F Exon 5: 5F Exon 6: M13-6F Exon 7: M13-7F Exon 8: M13-8F Exon 9: 9F Exon 10: M13-10.1F 10.2F M13-10.3F TGTAAAAGCACGGCCAGTTGGTCTGCTTTTAATTGCTG 2R GAATACAGTTCAGTGTTGTT TGTAAAACGACGGCCAGTGCCTTCCTCTTTCTGTTTCA 3R GGATAGTAGCTTAATTACAC TGTAAAACGACGGCCAGTAGGATCACATATGACTCACC 4R AGGAAAATCAGAAAGGCATG ACTTAAGCTACAACATGATT M13-5R TGTAAAACGACGGCCAGTGCTTCCCCATTTATTTAGTC TGTAAAACGACGGCCAGTATTGTGTCTGTCTGTGTACT 6R GTCAAAGTGTAAGGTGTAGC TGTAAAACGACGGCCAGTTAGTGTTCATTGGCATTGAG 7R ACAAAAGCCAGGTTAGCTAC TGTAAAACGACGGCCAGTAACTGTGCTTCAACTAGTCG 8R TGGCAAGGTCTAACACAACT TATGTAGCTTTTAAGATGTC M13-9R TGTAAAACGACGGCCAGTGACAGGAGTCTTCAGGTGTT GHR cDNA: TGTAAAACGACGGCCAGTGATCTTCATTTTCTTTCTAT 10.1R CTACCTGCTGGTGTAATGTC CATCGACTTTTATTGCCCAGG M13-10.2R TGTAAAACGACGGCCAGTATGAATGGAGGTATAGTCTGG TGTAAAACGACGGCCAGTCATGTTCCAGGTTCTGAGAT 10.3R GGTTTAAACATTGTTTTGGC GHRS 7 ACACTTCCTCAGATGAGC GHRAS10 CACTGTGGAATTCGGGTTTA Underlines indicate the nucleotide sequence of the M13 primer. FIG. 1. Direct sequencing from genomic DNA of the exon/intron junction of exon 9 of the GHR gene. Compared with a normal subject, patient 1 was heterozygous for a G to A transition at the 11 position of the 59-donor splice site of intron 9. Identification of a heterozygous mutation in the GHR gene Sequencing of the GHR gene of patients 1 and 2 and their mother revealed a heterozygous G to A transition at the 11 position of the 59-donor splice site of intron 9 (Fig. 1). No additional abnormalities were detected in their GHR genes. Unfortunately, we could not examine their father’s genotype. The pedigree and genotype of the family members are shown in Fig. 2. Restriction enzyme analysis The sequence of the wild-type GHR gene contains a recognition site for the restriction enzyme MaeIII. In contrast, the G to A transition at the 11 position of the 59-donor splice site of intron 9 disrupts this recognition site. In control subjects, the digestion with MaeIII of the amplified 180-bp fragment of exon 9 yields both 120- and 60-bp fragments, whereas in affected individuals the 180-bp fragment would be not digested with MaeIII. As shown in Fig. 3, the restriction enzyme analysis of both patients and their mother revealed the presence of three bands of 180-, 120-, and 60-bp fragments, indicating a heterozygous mutation. cDNA analysis The site in which we found the G to A transition was a conserved nucleotide of the donor splice site critical for the normal splicing (14). It is presumed that this G to A transition could result in a splicing abnormality, i.e. the skipping of exon 9. To elucidate the splicing abnormality, the sequencing of GHR cDNA of the patient was required. We obtained the fragments of GHR cDNAs of patient 2 and her mother from peripheral lymphocytes and compared them with those of a normal subject. 534 JCE & M • 1998 Vol 83 • No 2 IIDA ET AL. The amplification of cDNA using primers GHRS-7 and GHRAS-10 in a normal subject produced a band of 267 bp, as predicted (Fig. 4). Amplification of the cDNAs of patient 2 and her mother produced distinct two bands, 267 and 197 bp in size (Fig. 4). Direct sequencing of the amplification products of 197 bp revealed that exon 9 was completely skipped in the GHR messenger RNA (mRNA) of patient 2 FIG. 2. Pedigree and genotype of the family members. A heterozygous transition was detected in patients 1 and 2 and their mother. N.D, Not determined. FIG. 3. Restriction enzyme analysis of PCR products from patients 1 and 2, their mother, and a normal subject. A 180-bp fragment was amplified by PCR using oligonucleotide primers 9F and M13-9R from the genomic DNA in both patients, their mother, and a normal subject. The wild-type PCR products contained a MaeIII site (underlined) and produced two fragments of 120 and 60 bp by digestion with MaeIII, whereas the transition (asterisk) disrupted this MaeIII site and was uncut by MaeIII. After digestion with MaeIII for 1 h, DNA fragments were separated on 3% NuSieve agarose gel and visualized by ethidium bromide staining. Patients 1 (P1) and 2 (P2) and their mother (M) showed three bands of 180-, 120-, and 60-bp fragments, indicating their heterozygosity for this mutation, whereas a normal subject (C) showed two bands of 120- and 60-bp fragments. Mk, Molecular size marker. (Fig. 5). This splicing abnormality caused a frame shift in translation and the appearance of a premature stop codon, resulting in the production of truncated GHR whose intracellular domain consisted of only seven amino acids (Fig. 6). Discussion We present here a unique case of Japanese short siblings. The clinical features of the patients were characterized by a partial response to exogenous GH and high serum GHBP levels, which differed from the findings in most of the reported patients with GHR gene abnormalities. A novel heterozygous mutation in the GHR gene was identified in the patients. This mutation was located at the 11 position of the donor splice site of intron 9, which was a conserved and critical site for normal splicing (14), consequently resulting in a complete skipping of exon 9 from one allele. Exon 9 of the GHR consists of 70 nucleotides, and it was supposed that the deletion of exon 9 from the GHR mRNA would cause a frame shift in its translation and a premature termination at codon 278. The truncated GHR [GHR-(1–277)] from the mRNA lacking exon 9 contained only seven amino acids in the intracellular domain, but the extracellular and transmembrane domains of GHR-(1–277) were identical to those of normal GHR. Signal transduction of GH is initiated by binding of a single GH molecule to its receptor (GHR), followed by GHR dimerization (15). In vitro experiments revealed the critical amino acids for ligand binding and receptor dimerization located at the extracellular domain of the GHR (16). In the cytoplasmic domain, GHR shares two motifs with other cytokine receptor superfamilies. The proline-rich motif, referred to as box 1, consisted of ILPPVPVP in GHR. The GHIS WITH HIGH SERUM GHBP LEVELS 535 FIG. 4. The effect of the mutation on splicing of the GHR gene. The amplification products of cDNA from patient 2, her mother, and a normal subject by PCR using oligonucleotide primers GHRS-7 and GHRAS-10, the sequences of which are listed in Table 2, were separated on 2% Agarose S gel and visualized by ethidium bromide staining. In a normal subject (C), only a 267-bp fragment was obtained, as predicted, whereas in patient 2 (P2) and her mother (M), another 197-bp fragment was obtained in addition to the 267-bp fragment, in agreement with complete skipping of the 70-bp exon 9. Mk, Molecular size marker. The asterisk denotes the mutation site. second motif, called box 2, is located approximately 30 amino acids distant from the carboxyl-terminal of box 1 and spans about 15 amino acids (17). In a process of GH signal transduction, the dimerization of GHR activates the GHR-associated JAK2 tyrosine kinase, and it is followed by tyrosyl phosphorylation of both GHR and JAK2 (18). The studies using truncated and mutated GHR revealed that the box 1 is a critical region for GH-dependent JAK2 association with GHR and for tyrosyl phosphorylation and activation of JAK2 (19 –22). As GHR-(1–277) lacks both boxes 1 and 2, it is simply supposed that this truncated GHR would be unable to transduce the GH signal. However, it remains unclear why the patients showed the partial resistance to exogenous GH and high GHBP levels. The mutation found in our patients was heterozygous, so wild-type GHR would be expressed as well. It is of interest that the short isoforms of human GHR were recently reported to be physiologically produced by alternative splicing of the common transcript (23, 24). One of the short GHR isoforms was produced by splicing at an alternative 39 acceptor splice site 26 bp downstream in exon 9, resulting in the formation of the truncated GHR consisting of 279 amino acids [GHR-(1–279)] (23, 24). Another short isoform was produced by skipping exon 9, resulting in the truncated GHR consisting of 277 amino acids [GHR-(1–277)] (24). The latter was identical to that found in our patients. GHR-(1–279) has only nine amino acids in the cytoplasmic domain and lacks both boxes 1 and 2. Ribonuclease protection experiments using IM-9 cells and human liver revealed that the proportion of alternative splice to full-length GHR was 1–10% for GHR-(1–279) and less than 1% for GHR(1–277) (24). As the short isoforms of GHR are expressed in only a small amount, their physiological significance remains to be clarified. In our patients, however, at least a half of the expressed GHR seemed to correspond to GHR-(1–277) when assessed from the amplified cDNA products of peripheral lymphocytes using GHRS-7 and GHRAS-10. Immunoprecipitation and Western blotting experiments of cells transfected with GHR-(1–279) and/or full-length GHR revealed that GHR-(1–279) and full-length GHR could form heterodimers, and GHR-(1–279) could only be internalized when complexed with full-length GHR (24). Functional studies using a reporter gene containing the STAT5 (signal transducer and activator of transcription-5)-binding element demonstrated that GHR-(1–279) could suppress the action of full-length GHR even when the ratio of the cDNA transfected was 1:10 for GHR-(1–279) to full-length GHR, suggesting a dominant negative effect of GHR-(1–279) (24). Very recently, Ayling et al. (9) reported a short child with GHIS due to a heterozygous mutation at the 21 position of intron 8 of the GHR gene, resulting in the complete skipping of exon 9 and the production of truncated GHR-(1–277). The truncated GHR produced by mutation of the GHR gene in our patients was structurally identical to that described by Ayling et al. (9), but the mutation site and high serum GHBP levels found in our patients were different from those in the case reported by Ayling et al. (9). In vitro experiments revealed that GHR-(1–277) could form heterodimers with fulllength GHR and completely inhibit the function of fulllength GHR if the ratio of the cDNA transfected was equal (9). Based on these findings, it is likely that GHR-(1–277) behaves like GHR-(1–279). Furthermore, the expression studies of the truncated GHR(1–279) revealed that the binding affinity of GHR-(1–279) to GH was twice that of the wild-type GHR (23). In contrast, another study showed that GHR-(1–279) had a 2-fold lower affinity and increased binding capacity compared to the full- 536 IIDA ET AL. JCE & M • 1998 Vol 83 • No 2 FIG. 5. Sequencing analysis of the 197-bp PCR product from the cDNA in patient 2 and of the 267-bp PCR product from a normal subject. These findings confirmed the complete skipping of exon 9 in the GHR cDNA of patient 2 by which exon 8 was directly united with exon 10, whereas normal splicing caused a combination of exon 8 into exon 9 in a normal subject. The sequence analysis of her mother led to the same results. FIG. 6. Deduced sequences of translated products of the wild-type and truncated GHR. The boundary between the transmembrane and intracellular domains is marked by a slash. The intracellular domain of the truncated GHR contained only seven amino acids, including three novel amino acids in the C-terminus, lacking both box 1 and box 2 regions. length wild-type GHR (24). The increase in the binding capacity for expressed GHR-(1–279) vs. wild-type GHR is consistent with that previously reported for the truncated rabbit GHR (21). The studies of the short isoforms of the rat GHR revealed that the increase in binding sites correlates with an impaired internalization of the GHR (25). Critical amino acid residues for internalization of the rat GHR are known to be located within box 2 in a cytoplasmic domain (25), which is absent in GHR-(1–279), GHR-(1–277), or the truncated rabbit GHR. As a result of the reduced internalization, increased amounts of the truncated GHR could be sustained at the cell surface and become the source of GHBP. Actually, it was reported that the medium of COS-7 cells transfected with GHR-(1–279) produced 4.5-fold more GHBP than that transfected with full-length wild-type GHR (23), and the medium of 293 cells transfected with GHR-(1–279) contained 20-fold more GHBP than that transfected with full-length GHR (24). The results of these transfection studies are consistent with the clinical in vivo data of our patients, in whom serum GHBP levels were 2-fold higher than the upper limit of the normal range, although the patients reported by Ayling et al. (9) showed normal serum GHBP levels. The discrepancy in serum GHBP levels between the patients of Ayling et al. and ours remains to be elucidated, but it may simply reflect a methodological difference. Ayling et al. determined serum GHBP levels by the radiolabeled human GH assay, which might be less sensitive than the ligand-mediated immunofunctional assay we used. In general, it was reported that serum GHBP levels were not detected or were extremely low in most patients with GHR gene abnormalities (3), but some patients demonstrated normal to high levels of serum GHBP (7, 8). Our patients also showed high serum GHBP levels. Therefore, we would insist that the measurement of serum GHBP levels in a patient with idiopathic short stature is useful not only for distinction from classical GHR gene abnormalities but also for presumption of the mutation site in the GHR gene. As the mutation in the GHR gene was heterozygous in our patients, three different types of GHR dimerization were hypothesized, as shown in Fig. 7. The homodimers of two full-length wild-type GHR would be normally internalized and transduce the GH signal into cells. In contrast, the homodimers of two GHR-(1–277) were not internalized, were sustained at the cell surface, and generated GHBP by proteolytic cleavage. The inhibition of full-length GHR signaling GHIS WITH HIGH SERUM GHBP LEVELS 3. 4. 5. 6. 7. FIG. 7. A schema of the proposed GH-signaling mechanism in the patients. As the mutations in the patients were heterozygous, three different types of GHR dimerization are theoretically proposed: namely, the homodimers of two wild-type GHR (left), the homodimers of two truncated GHR mutants (right), and the heterodimers of wildtype GHR and truncated GHR mutant (center). The homodimers formed by two wild-type GHR would transduce the GH signal, but the homodimers formed by two mutant GHR would not transduce the GH signal. The function of the heterodimers remains to be clarified. The ability of a mutant GHR to bind to a wild-type GHR and prevent signal transduction and the abundance of a mutant GHR at the cell surface due to the reduced internalization both would be responsible for a dominant negative phenomenon. W, Wild-type GHR; M, truncated GHR mutant. by the short form of GHR is known to depend upon the concentration of human GH (23). Therefore, the inhibition by GHR-(1–277) of wild-type GHR could be due to a competition between GHR-(1–277) and wild-type GHR for binding of GH. Some proportion of GHR-(1–277) might be internalized through heterodimerization with full-length GHR, although the extent of heterodimers remains to be clarified. Also, it remains unknown whether the heterodimerization of GHR-(1–277) and full-length GHR could transduce the GH signal into cells. In fact, our patients showed a partial IGF-I response to exogenous GH administration in an IGF-I generation test. As the mutation in the GHR gene was heterozygous in our patients, wild-type GHR would be expressed on the cells in an amount sufficient to induce partial IGF-I production (Fig. 7). In conclusion, we have demonstrated a novel heterozygous donor splice site mutation of the GHR gene in Japanese GHIS siblings. This mutation resulted in the complete skipping of exon 9 from one allele and the production of truncated GHR lacking the intracellular domain. The mutant GHR was supposed to inhibit the effect of the normal GHR in a dominant negative fashion and to produce a large amount of GHBP. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. Acknowledgment We thank Miss Chika Ogata for excellent technical assistance. 24. References 1. Laron Z, Pertzelan A, Mannheimer S. 1966 Genetic pituitary dwarfism with high serum concentration of growth hormone-a new inborn error of metabolism? Isr J Med Sci. 2:152–155. 2. Savage MO, Blum WF, Ranke MB, et al. 1993 Clinical features and endocrine 25. 537 status in patients with growth hormone insensitivity (Laron syndrome). J Clin Endocrinol Metab. 77:1465–1471. Rosenfeld RG, Rosenbloom AL, Guevara-Aguirre J. 1994 Growth hormone (GH) insensitivity due to primary GH receptor deficiency. Endocr Rev. 15:369 –390. Sobrier M-L, Dastot F, Duquesnoy P, et al. 1997 Nine novel growth hormone receptor gene mutations in patients with Laron syndrome. J Clin Endocrinol Metab. 82:435– 437. Baumbach L, Schiavi A, Bartlett R, et al. 1997 Clinical, biochemical, and molecular investigations of a genetic isolate of growth hormone insensitivity (Laron syndrome). J Clin Endocrinol Metab. 82:444 – 451. Buchanan CR, Maheshwari HG, Norman MR, Morrell DJ, Preece MA. 1991 Laron-type dwarfism with apparently normal high affinity serum growth hormone-binding protein. Clin Endocrinol (Oxf). 35:179 –185. Duquesnoy P, Sobrier M-L, Duriez B, et al. 1994 A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GHbinding activity by abolishing receptor homodimerization. EMBO J. 13:1386 –1395. Woods KA, Fraser NC, Postel-Vinay M-C, Savage MO, Clark AJL. 1996 A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab. 81:1686 –1690. Ayling RM, Ross R, Towner P, et al. 1997 A dominant-negative mutation of the growth hormone receptor causes familial short stature. Nat Genet. 16:13–14. Baxter RC, Martin JL. 1986 Radioimmunoassay of growth hormone-dependent insulin-like growth factor binding protein in human plasma. J Clin Invest. 78:1504 –1512. Carlsson LMS, Rosberg S, Vitangcol RV, Wong WLT, Albertsson-Wikland K. 1993 Analysis of 24-hour plasma profiles of growth hormone (GH)-binding protein, GH/GH-binding protein complex, and GH in healthy children. J Clin Endocrinol Metab. 77:356 –361. Gross-Bellard M, Oudet P, Chambon P. 1973 Isolation of high-molecularweight DNA from mammalian cells. Eur J Biochem. 36:32–38. Maniatis T, Fritsch EF, Sambrook J. 1982 Molecular cloning: a laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory. Krawczak M, Reiss J, Cooper DN. 1992 The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet. 90:41–54. Cunningham BC, Ultsch M, De Vos AM, Mulkerrin MG, Clauser KR, Wells JA. 1991 Dimerization of the extracellular domain of the human growth hormone receptor by a single hormone molecule. Science. 254:821– 825. Chen C, Brinkworth R, Waters MJ. 1997 The role of receptor dimerization domain residues in growth hormone signaling. J Biol Chem. 272:5133–5140. DaSilva L, Howard OMZ, Rui H, Kirken RA, Farrar WL. 1994 Growth signaling and JAK2 association mediated by membrane-proximal cytoplasmic regions of prolactin receptors. J Biol Chem. 269:18267–18270. Argetsinger LS, Campbell GS, Yang X, et al. 1993 Identification of JAK2 as a growth hormone receptor-associated tyrosine kinase. Cell. 74:237–244. Wang Y-D, Wood WI. 1995 Amino acids of the human growth hormone receptor that are required for proliferation and JAK-STAT signaling. Mol Endocrinol. 9:303–307. Frank SJ, Gilliland G, Kraft AS, Arnold CS. 1994 Interaction of the growth hormone receptor cytoplasmic domain with the JAK2 tyrosine kinase. Endocrinology. 135:2228 –2239. Sotiropoulos A, Perrot-Applanat M, Dinerstein H, Pallier A, Postel-Vinay M-C. 1994 Distinct cytoplasmic regions of the growth hormone receptor are required for activation of JAK2, mitogen-activated protein kinase, and transcription. Endocrinology. 135:1292–1298. VanderKuur JA, Wang X, Zang L, Campbell GS, et al. 1994 Domains of the growth hormone receptor required for association and activation of JAK2 tyrosine kinase. J Biol Chem. 269:21709 –21717. Dastot F, Sobrier ML, Duquesnoy P, Duriez B, Goossens M, Amselem S. 1996 Alternatively spliced forms in the cytoplasmic domain of the human growth hormone (GH) receptor regulate its ability to generate a soluble GH-binding protein. Proc Natl Acad Sci USA. 93:10723–10728. Ross RJM, Esposito N, Shen XY, et al. 1997 A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Mol Endocrinol. 11:265–273. Allevato G, Billestrup N, Goujin L, et al. 1995 Identification of phenylalanine 346 in the rat growth hormone receptor as being critical for ligand-mediated internalization and down-regulation. J Biol Chem. 270:17210 –17214.