Download Supplementary Methods (doc 62K)

Supplemental Methods:
Microarray Procedure
Total RNA (20ug for cell lines, 500 ng for primary samples) was amplified using GeneChip® 3’
IVT Express Kit (Affymetrix). Biotinylated cRNA was fragmented and added to Affymetrix
HG_U133 Plus 2.0 arrays, and after hybridization, arrays were washed and stained as described
in Gene Chip Expression Analysis Technical Manual. Arrays were scanned with an Affymetrix
3000 laser scanner. CEL files were normalized using gcRMA (PMID: 16108723), and
expression values were un-logged, and for the cell line data were scaled to a median target
intensity of 100. Copy number variation was assessed on the Affymetrix Genome-Wide Human
SNP Array 6.0 (Santa Clara, CA) at Expression Analysis Inc. (Durham, NC) using standard
procedures.
Primary lung tumor samples, cell culture and antibodies
Primary human lung tumor and matched normal tissue samples were obtained from Asterand
(Detroit, MI), appropriate informed consent was obtained from patients by Asterand and had
approval from the appropriate institutional review boards (IRB). The samples were handled and
maintained according to protocols approved by the IRB of the Genomics Institute of the Novartis
Research Foundation (GNF). All cell lines were purchased from ATCC or RIKEN, immediately
frozen down in liquid nitrogen and maintained for less than 6 months in culture before thawing a
new population. Cells lines were authenticated by the cell banks; methods include karyotyping
as well as STR analysis and as further described on the respective websites. All cells were
maintained following recommended conditions. The cell lines included H226, H1573, H1650,
H1651, H1793, H2228, H2347, H2444, LL47, LC-1/sq-SF, U937, NL-20 and 293T. Spheroid
cultures were generated as described (1). Briefly, spheroid cultures were generated by plating single
cells from monolayer at low density (200 cells/cm2) in low attachment plates (Corning) in MEGM media
(serum-free MEBM media supplemented with 20 ng/ml EGF (Peprotech), 20 ng/ml bFGF (Peprotech), 4
ug/ml heparin, 1X B-27 supplement (Gibco), and 20 ug/ml insulin). Transfections were done using
standard procedures [(Lipofectamine 2000) Invitrogen]. Antibodies used included anti-TRIB2 [Atlas
Antibodies and Abnova (M04)], anti-C/EBPalpha [Santa Cruz (SC-61); Cell Signaling (2295)],
anti-beta-actin (Biolegend), and anti-TRIM21 [Abnova (AO1)], anti-prosurfactant A [Santa Cruz
(6F10)]; aquaporin 5 [Santa Cruz (C-19)] and clara cell secretory protein (Chemicon). Beta-actin
is referred to in the text as actin.
Constructs and Lentiviruses
A 1032 bp fragment encoding the entire human TRIB2 cDNA was subcloned into
pcDNA3.1/V5/HIS (Invitrogen) and pHAGE/CMV/MCS/IRES/ZSgreen vectors. The lentiviral
vector pHAGE has been described previously (2). To create pHAGE/TRIB2-ZsGreen, an IRES
ZsGreen fusion was cloned into BamH I and Cla I restriction sites located between the promoter
and WPRE (Woodchuck hepatitis posttranscriptional regulatory element). To generate the
Trib2m mutant, silent mutations (GCGTTTCTTGTATCGGGAAA
GCGTCAGCTGCATTGGAAAA) of the TRIB2 sh2 binding region were introduced by sitedirected mutagenesis using the QuickChange kit (Stratagene). A full length C/EBPalpha
fragment was cloned into a modified MSCV/MCS/IRES/GFP vector, and confirmed by
sequencing. Lentiviral vectors expressing shRNA sequences directed against human TRIB2
(sh1-4) were obtained from Sigma, as well as a control non-targeting construct (shNT). The
C/EBPalpha luciferase reporter vector has been previously described (3). Lentiviral supernatants
were concentrated, titered, and used to infect lung cancer cell lines at an MOI of 0.5-2.0.
Cellular assays
To assess cell proliferation, cells were seeded at 5000 cells/well in 96 well tissue culture plates
and analyzed using CellTiterGlo (Promega). Assessement of spheroid growth upon knockdown
of TRIB2 was done as follows: spheroid cells were dissociated, infected at an MOI of 0.5-1 with
the appropriate lentivirus and plated in low attachment plates in MEGM media. Infected cells
were puromycin selected, and after 5-14 days wells were scored for the presence or absence of
spheroid colonies. Apoptosis assays were performed using the Annexin V-FITC Apoptosis Kit
following manufacturer’s directions (Biovision, Inc.) using an LSRII flow cytometer (BectonDickinson). Luciferase reporter activity was assessed by addition of BrightGlo (Promega) 24
hours after transfection of 293T cells with the indicated constructs (CEBPA reporter, pcDNA 3.1
Trib2 and CEBPA). For the reporter assays, the total amount of DNA transfected was held
constant for each treatment. For analysis of C/EBPalpha target genes, U937 cells were infected
on day 0 with shNT or sh1 at an MOI of 2. The following day, day 1, a subset of cells was
collected to examine baseline expression levels of TRIB2, GCSFR and NE2. The remaining
cells were selected for infection by shRNA constructs by addition of 1 μg/ml puromycin.
Additionally, GCSF (50ng/ml) or all-trans retinoic acid (ATRA, 50nM) was added to the culture
media to induce differentiation of the transduced cells. Cells surviving selection were collected
on day 4, and used to make RNA. Cells treated with GCSF were used to analyze levels of NE2,
while cells treated with ATRA were used to analyze levels of GCSFR.
Immunohistochemistry and immunofluorescence
Tumor tissue from primary human lung tumor and matched normal tissue samples were formalin
fixed, paraffin-embedded and sectioned. Tissue slides were stained with hematoxylin and eosin,
or immunohistochemically stained with antibodies specific for TRIB2. For assessment of lung
cancer differentiation capacity following TRIB2 knockdown, cells were plated on fibronectioncoated coverslips and allowed to differentiate for 7 days. After 7 days, cells were fixed with
10% formalin, permeabilized, and non-specific staining blocked using 5% bovine serum albumin
(BSA) then incubated with all three primary antibodies for 2 hours at room temperature.
Antibodies are described above and were used at a 1:1000 dilution in 5% BSA. Secondary
antibodies are as follows: anti-mouse Alexafluor 488 (SP-A), anti-rabbit Alexafluor 546 (CC-10)
and anti-goat Alexafluor 647 (AQP5) and were used at a 1:1000 dilution in 5% BSA for one
hour at room temperature in the dark. Cells were counterstained using DAPI and mounted using
VECTASHIELD mounting media (Vector Laboratories). Images were obtained using an
Ultraview Confocal Microscope.
Expression analysis and immunoprecipitations
Total RNA was extracted from tumor and normal tissue samples using TriZol (Invitrogen) followed by
purification on RNeasy columns (Qiagen). RNA was purified from cell lines using the RNeasy kit
(Qiagen). After DNAse digestion, cDNA was synthesized from total RNA using the High Capacity
cDNA Archive Kit (Applied Biosystems), Verso cDNA kit (Thermo Fisher) or was purchased from
Origene (TissueScan Lung Cancer Tissue qPCR Panel I). Validated human primer/probe Taqman
chemistry was used for qRT-PCR with the Taqman Universal PCR master Mix (Applied
Biosystems) for the following genes: TRIB2; CEBPA, ACTB, CSF3, and NE2. Reactions were
run and analyzed on an ABI Prism 7900 Sequence Detection System (Applied Biosystems). Cells to be
analyzed by western blotting were lysed in modified RIPA buffer (50 mM Tric-HCl, pH 7.4, 150
mM NaCl, 0.25% deoxycholate, 1% NP-40, 10 mM EDTA) containing 1 mM PMSF, protease
inhibitors (Complete EDTA-free; Roche) and phosphatase inhibitors (Phosphatase inhibitor
cocktails 1 and 2; Sigma). Western blotting was performed on cleared lysates according to
standard procedures. For nickel resin precipitation of TRIB2 binding proteins, stably transduced
H226 cells were lysed using cytoplasmic lysis buffer [50 mM Tris, pH 7.4; 150 mM NaCl; and
0.1% (v/v) IGEPAL CA-630] containing Complete EDTA-free protease inhibitor cocktail
(Roche). Lysates were subjected to sonication, centrifugation, and then lysates collected and
incubated with washed Ni-NTA resin (Qiagen) for 1 hour rotating at 4° C. After imidazole
elution (300 mM in lysis buffer), precipitated proteins were run on a Western blot as above.
Gene copy number analysis
DNA was extracted from primary lung tumor and matched normal samples using the DNeasy
blood and tissue kit (Qiagen). Signals obtained using a custom Taqman probe for the second
intron of TRIB2 were normalized to signals obtained using a Taqman probe for RNAse P, then
compared to the normalized signals from corresponding normal tissue. Primer/probe sequence
for TRIB2 available upon request. Custom FISH probes were ordered from Enzo Life Sciences
(clone # RP11-333O1; dye Green 496), as well as a centromeric probe to chromosome 2 (Abbott
Molecular). Hybridizations were done as specified by the manufacturer.
in vivo tumorigenicity
NOD/SCID mice were obtained from Jackson Laboratories. Experiments were performed
according to National Institutes of Health guidelines with an approved protocol from the GNF
committee. Cells were suspended in collagen or matrigel at the desired density and injected subcutaneously into NOD/SCID mice. Animals were monitored bi-weekly for tumor formation.
Animals were euthanized once tumor volume reached 2000 mm3, and tumors were removed for
analysis.
Cloning and generation of stable cell lines
A DNA sequence encoding a multi-cloning site and three affinity tags (6His, Strep-2, and
3xFlag) was cloned into the HpaI-EcoRI sites of a retroviral vector, pMSCVpuro (Clonetech), to
generate the vector pMSCV-puro-CTT. The Trib2 gene was amplified and cloned into this vector
such that the affinity tags were at the 3’ end of the gene and in-frame. The resultant construct
was stably transduced into H1650 cells using retroviral gene transfer, and transduced cells were
selected for puromycin resistance. Similarly, a construct containing a stop codon between the
Trib2 gene and the affinity tags was also generated and transduced to obtain a stable line for use
as a negative control.
Tandem affinity purification
5x108 cells were grown and kept frozen until needed. Cells were resuspended in 16mL of lysis
buffer (50mM Tris-HCl (pH 7.4), 150mM NaCl, 0.1% Igepal CA-630) containing a cocktail of
protease and phosphatase inhibitors, lysed by brief sonication (2 x 30 seconds), and centrifuged
to remove debris.
The lysate was split into two equal aliquots for performing duplicate
purifications. A protein lysate aliquot was incubated with 100µL of Talon resin (Clonetech) for
one hour and then washed 3x with 1mL of lysis buffer supplemented with 10mM imidazole,
followed by elution with 2mL of 150mM imidazole in lysis buffer. The eluate was incubated
with anti-Flag M2 antibody resin (Sigma) for one hour, washed with lysis buffer, and then eluted
with 1.5mL lysis buffer containing
precipitated with trichloroacetic acid, washed with acetone, dissolved in SDS sample buffer, and
resolved by one dimensional SDS-PAGE. Each resolved lane was cut into 24 equal gel slices
that were analyzed separately by mass spectrometry.
Mass spectrometry and data analysis
Excised gel bands were subjected to in-gel digestion using a Micromass MassPREP Station in
conjunction with the manufacturer specified protocols. Briefly, gel pieces were rinsed (2x with
50% acetonitrile/50mM ammonium bicarbonate), dehydrated (acetonitrile), reduced (DTT),
alkylated (iodoacetamide), and digested with sequencing grade trypsin overnight. The resulting
peptides were extracted with 30μL of 1% formic acid. Automated nanoscale LC/MS/MS was
performed using a ThermoFinnigan Surveyor HPLC and LTQ XL ion trap mass spectrometer
along with a variation of the “vented column” approach. Ten μL of a tryptic digest extract was
loaded onto a 5cm long x 75μm i.d. precolumn packed with 5μm C-18 silica (Monitor 100Å)
retained by a Kaisel frit. After thorough washing, the vent was closed and the sample was
transferred to a 12cm long x 75μm i.d. column with a pulled 5μm tip packed with the same
material by starting the reversed-phase run. The chromatographic profile was from 100% solvent
A (0.1% acetic acid) to 50% solvent B (0.1% acetic acid in acetonitrile) in 30 minutes at
approximately 200nL/min (manual split from 300μL/min), and also allowed for appropriate
times for column washing and re-equilibration. An angiotensin 1 standard (1.25 pmol) was run
between each sample to eliminate carryover as well as monitor overall system performance. The
LTQ acquisition method involved one MS precursor ion scan followed by five data-dependant
MS/MS scans. Dynamic exclusion was enabled for a repeat count of one second, repeat duration
of 15 seconds, and exclusion duration of 30 seconds.
Tandem MS data was used to search a human specific database (IPI_human_3.36 database,
69012 entries) using Mascot (Matrix Science, London, UK). Searches were performed allowing
for the fixed modification of cysteine (carbaminomethyl), the variable modifications of Met
(oxidation), and no enzyme specificity. Scaffold (version Scaffold_3_00_02, Proteome Software
Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications.
Peptide identifications were accepted if: a) their ion scores were greater than their associated
identity scores, b) their ion score were at least 20, 30, and 40 for singly, doubly, and triply
charged peptides, respectively, and c), the identified sequence was fully tryptic.
Protein
identifications were accepted if they contained at least 2 peptides that matched these criteria.
1.
Dubrovska A, Kim S, Salamone RJ, et al. The role of PTEN/Akt/PI3K signaling in the maintenance
and viability of prostate cancer stem-like cell populations. Proc Natl Acad Sci U S A. 2009;106:268-73.
2.
Pan H, Mostoslavsky G, Eruslanov E, Kotton DN, Kramnik I. Dual-promoter lentiviral system
allows inducible expression of noxious proteins in macrophages. J Immunol Methods. 2008;329:31-44.
3.
Behre G, Singh SM, Liu H, et al. Ras signaling enhances the activity of C/EBP alpha to induce
granulocytic differentiation by phosphorylation of serine 248. J Biol Chem. 2002;277:26293-9.