Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Questions to help study for test 1
Transcript
Help and Hints for test 1 Biol2 Since the lectures and the labs were essentially integrated with respect to the material you can expect to have to draw on information from both for tests. This means read over and study your lab manual as well as your lecture notes for tests. You do need to be familiar with methods to isolate Blood genomic DNA,.and everything else you have done in the lab (calc, restic. digest. ). The test will be a few MCQs (less than 10) followed by short answer questions. Example Questions 1. Mark the following True or False a. A plasmid is to bacteria what genomic DNA is to eukaryotic cells b. Red blood cells are a good source of DNA c. Footprinting is a useful method for forensic identification d. DNA has a net negative charge and moves towards the positive electrode 2. The complement of the following sequence ATGCCCGTGTGGAGGTTTTA is: 3. The restriction enzyme BIG1 recognises the double stranded sequence 5’ TACGTA 3’ and cuts between the G and C. a) Does it yield sticky ends? b) Draw a diagram of the products of digestion of the following double stranded sequence. 5’ TATTACGTATTTAG 3” 3’ ATAATGCATAAATC 5’ 4. How does the high salt method ( used to extract genomic DNA from blood ) work? 5. Explain a. what RFLP stands for b. how RFLPs can be used in a paternity analysis 6. Draw a nucleotide (not the base but everything else in full) 7. What would run further on a gel a piece of DNA 300bp or a piece of DNA 3000bp long? 8. You isolate DNA and you have only got 25ul of sample. You take 5ul and make it up to 48ul and then take 40 ul and make it up to 1000ul. The OD 260 is 0.22. What is the concentration of DNA How much total DNA do you have left in your original sample. 9. 10. 11. Why do you keep a lab book! Explain how a DNA fingerprint can be generated Why does DNA have a net negative charge?
