Download Supplementary Information (doc 45K)

Frequent Loss of Cystatin E/M Expression Implicated in the
Progression of Prostate Cancer
Sai Murali Krishna Pulukuri, Bharathi Gorantla, James A. Knost, and Jasti S. Rao
SUPPLEMENTARY INFORMATION
Evaluation of immunostaining. CST6 and cathepsin B immunostaining positivity was
determined by a pathologist who assessed the percentage of positive cells and staining
intensity. An average value of two independent scores was presented in the present
study. The percentage of positive cells was divided into five grades (percentage scores):
<10% (0), 10-25% (1), 25-50% (2), 50-75% (3), and >75% (4). The intensity of staining
was divided into the following four grades (intensity scores): no staining (0), light brown
(1), brown (2), and dark brown (3). CST6 and cathepsin B staining positivity was
determined using this formula: overall score = positive percentage score × intensity score.
The overall score of ≤ 3 was defined as negative, > 3 to ≤ 6 as weak positive, and > 6 as
strong positive.
Drug treatments. Cells were seeded at a density of 1 x 106 cells/100-mm dish and
allowed to attach over 24 h. To reactivate CST6, we carried out HDAC inhibition
treatment by adding trichostatin A (300 µmol/L) to the culture medium for 20 h or by
treating cells for 12 h in medium supplemented with 1 mM NaB. We carried out
demethylating treatments using 5-aza (10 µmol/L) for 5 days, replacing the drug and
medium 24 h after the beginning of the treatment. The treated cells were washed once
with phosphate-buffered saline. Cells were allowed to recover for 24 h in drug-free
medium in a 37 °C incubator with a 5% CO2 humidified atmosphere.
1
Immunoblot analysis. Cells were lysed in RIPA buffer and proteins were quantified
using a BCA assay (Pierce, Rockford, IL). Equal amounts were separated on SDS-PAGE
gels. Membranes were probed with antibodies against CST6 (R & D Systems,
Minneapolis, MN), cystatin C (Oncogene, San Diego, CA) and GAPDH (Abcam,
Cambridge, MA). Antibodies against cathepsins B, D, H and L were obtained from Santa
Cruz Biotechnology (Santa Cruz, CA).
Chromatin immunoprecipitation assay. ChIP assays were performed as per the
manufacturer's instructions (catalog no. 17–295, Upstate Biotechnology, Lake Placid,
NY). In brief, cells (1106 cells/100 mm dish) were fixed by adding formaldehyde (final
concentration of 1%) and incubating for 10 min at 37°C. The cells were washed twice
with ice-cold phosphate-buffered saline (PBS) containing protease inhibitors (1 mM
phenylmethylsulfonyl fluoride, 1 µg/mL aprotinin, and 1 µg/mL pepstatin A), harvested,
and treated with SDS lysis buffer for 10 min on ice. The resulting lysates were sonicated
to shear the DNA to fragment lengths below 1000 bp (amplitude 60%; 4 x 10 s; Fisher
Sonic Dismembrator 60, Pittsburgh, PA). After pre-clearing the lysates, 4 µg of specific
antibodies (anti-acetylated histone H3, anti-acetylated histone H4, and anti-histone H3,
Cell Signaling Technology Inc., Beverly, MA) were used to immunoprecipitate the
protein-DNA complexes. Antibody controls were also included for each ChIP assay; no
precipitation was observed. The antibody-protein complexes were collected using salmon
sperm DNA-protein A-agarose slurry and washed several times as per the manufacturer's
instructions. The immunocomplexes were eluted with 1% SDS and 0.1 M NaHCO3, and
2
the cross-links were reversed by incubation at 65°C for 4 h in the presence of 200 nM
NaCl. The samples were treated with proteinase K for 1 h, and the DNA was purified by
phenol/chloroform extraction and ethanol precipitation.
The recovered DNA was
resuspended in 30 µL of H2O and used as templates for PCR of CST6 or β-actin gene
promoters. The following primers were used for PCR: CST6 promoter-sense, 5'- TGG
TCG CAT TCT GCC TCC T-3', and CST6 promoter-antisense, 5'- ATG CTG TTG CTG
CCC ATG TTG TAG-3'; β-actin promoter-sense, 5'-CCA ACG CCA AAA CTC TCC C3', and β-actin promoter-antisense, 5'-AGC CAT AAA AGG CAA CTT TCG-3'. Initially,
PCR was performed with different numbers of cycles or dilutions of input DNA to
determine the linear range of the amplification; all results shown fall within this range.
Following 30 cycles of amplification, PCR products were run on 2% agarose gels and
analyzed by ethidium bromide staining.
Reverse transcription-PCR analysis. Total RNA was isolated from prostate cell lines and
tissue samples using the RNeasy mini kit (Qiagen, Valencia, CA) and reverse-transcribed
using Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA) according to the
manufacturer’s instructions. We then used PCR to amplify this cDNA using primers that
spans exons 2 and 3 of the CST6 gene. The primers used for PCR were as follows: CST6
sense 5'- GAC TGC CGC AAG ACC -3' and antisense 5'- GAA GTG CCC TCC ACC A3'; GAPDH sense 5’-CGG AGT CAA CGG ATT TGG TCG TAT-3’ and antisense
5’AGC CTT CTC CAT GGT GGT GAA GAC-3’. Real-time PCR was conducted in
50 L volumes containing 1 L cDNA, 25 L SYBR Green, 2.5 L of 5 mol/L of each
of the specific primers and the probe, and 19 L RNA-free water. All of the reactions
3
were performed in triplicate in an iCycle iQ system (Bio-Rad, Hercules, CA). Optical
system software version 3.1 was used to detect the fluorescent level of CST6 and
GAPDH for 40 cycles. The PCR conditions were as follows: 95°C for 5 min, followed
by 40 cycles at 95°C for 1 min, 58°C for 1 min and 72°C for 1 min. The final extension
was at 72°C for 5 min.
Matrigel invasion assay. We used 6.5 mm-diameter Transwell inserts (Costar,
Cambridge, MA) with the 8 m-pore membranes coated with matrigel (Becton
Dickinson, Bedford, MA) to assess the invasive potential of prostate cells. Cells were
detached, washed twice in PBS and resuspended in serum-free DMEM. A total of 5×105
cells in 0.2 mL were placed in the upper chamber of a Transwell and the lower chamber
was filled with 400 L of DMEM/10% fetal bovine serum. After a 24 h incubation
period, the cells in the upper chamber that did not migrate were gently scraped away and
adherent cells present on the lower surface of the insert were stained with Hema-3 and
photographed.
Statistical analysis. Statistical comparisons were performed using ANOVA for analysis
of significance between different values using GraphPad Prism software (San Diego,
CA). Values are expressed as mean ± SD from at least 3 separate experiments and
differences were considered significant at a p value of <0.05.
4
SUPPLEMENTAL FIGURE LEGENDS
Supplemental Figure S1. Expression of cathepsin B in human prostate tissue samples.
Compared with normal prostate tissue, the overall expression level of cathepsin B in the
prostate cancer tissue was significantly higher (P < 0.001). Tissue sections were prepared
from formalin-fixed, paraffin-embedded specimens of normal and tumor human prostate
tissues. Immunostaining was carried out using a specific anti-human cathepsin B
antibody. Cathepsin B expression in normal human prostate tissue (32 cases) and prostate
cancer (42 cases) was analyzed.
Supplemental Figure S2. CST6 mRNA levels in control and SB-treated LNCaP, PC3
and PC3-M cells were analyzed by semiquantitative RT-PCR. Cystatin C mRNA was
amplified as a loading control and expression standard.
Supplemental Figure S3. Methylation-specific PCR (MSP) analysis of the CST6 gene
promoter region in human prostate cancer cell lines and in prostate tumor tissue samples.
(A). Bisulfite-modified DNA derived from prostate cell lines were amplified with CST6
primers specific for unmethylated and methylated DNA. CST6-U: unmethylated PCR
product; CST6-M: methylated PCR product. Positive controls used for MSP included
DNA from RWPE1 cells as unmethylated DNA control and CpGenome Universal
methylated DNA as methylated DNA control (Chemicon Internaltional). Negative control
MSP reactions were performed using water only (no DNA) as template. (B). Percentage
5
of cases methylated at CST6 promoter-associated CpG islands in human normal prostate
and tumor tissue samples. CST6-U: unmethylated PCR product; CST6-M: methylated
PCR product.
Supplemental Figure S4. Over- and knockdown expression of CST6 modified cathepsin
B levels in prostate cells. (A). Real-time RT-PCR analysis of cathepsins mRNA
expression in PC3 cells stably transfected with CST6 expression vector or empty vector.
RNA was isolated and reverse transcribed and SYBR Green real-time PCR carried out
with CST6-specific primers. Columns, mean of three independent experiments (*, P <
0.05); bars, SD. (B). Real-time RT-PCR analysis of CST6 and cathepsins mRNA
expression in RWPE1 cells transfected with siCST6 or siCTL. Columns, mean of three
independent experiments (*, P < 0.05); bars, SD.
Supplemental Figure S5. (A) PC3 cells stably expressing luciferase reporter with either
empty vector (control) or CST6 expression vector were injected into mouse prostate, and
luciferase activity was recorded for each mouse. Representative mice images are shown.
The color bar represents luciferase intensity. Numbers relating to the green ovals
represent photon counts in the prostate. (B) Representative lung images from mice groups
are shown.
6
Supplementary Table 1
Sequence Name
Sequence (5’-3’)
CST6-A
ACTTCATCAAGGTGCACGTCG
CST6-B
TTCGTACACCTGCGAGTGTTC
CST6-C
CCTTATCTAACTACCAGACCA
CST6-D
GCCAAGCATGATGAGCTGACC
“Smart pool” siRNAs that combined the above CST6 A-D siRNAs targeted against
different regions of the CST6 mRNA sequence were used for transfection to increase the
knockdown effect.
7