Download Supplemental Research Design and Methods

APPENDIX
RESEARCH DESIGN AND METHODS
Plasmid cDNA constructs and mutagenesis
Four previously characterized (15; 19) mutant AS160 isoforms include: 1) AS160
mutated at four phospho-Akt substrate (PAS) motifs (Ser318, Ser588, Thr642, and Ser751), rendering
these sites incapable of being phosphorylated (4P); 2) AS160 mutated to lysine at Arg973 within
its Rab-GAP domain, effectively eliminating AS160 GAP activity (R/K); 3) AS160 double
mutant containing both the 4P and R/K mutations (2M); and 4) AS160 mutated to glycine at
Leu842 and Trp843 within its calmodulin-binding domain (CBD), which abolishes AS160 affinity
for calmodulin. In addition, two novel AS160 mutants were also generated (see mutagenesis),
including an AS160 double mutant devoid of Rab-GAP activity and the ability to bind
calmodulin (CBD+R/K) and an AS160 double mutant carrying both the 4P and CBD mutations
(CBD+4P). For the purposes of cDNA injection and in vivo electroporation in adult mouse
skeletal muscle, AS160 DNA was excised from the original CMV-10 vector, affixed to a myctag leader sequence via specific primers (Table 1) and PCR amplification, and subcloned into
pCAGGS plasmids (donated by Dr. J. Miyazaki; Osaka University, Osaka, Japan). This
expression vector drives a target gene under the CAG (cytomegalovirus immediate-early
enhancer-chicken β-actin hydrid) promoter, and has been demonstrated to have high activity in
skeletal muscle. For the creation of novel AS160 mutants, myc-tagged plasmids (CBD and 4P)
served as templates and were combined with mutagenic primers (Table 2) to synthesize double
mutants (CBD+R/K and CBD+4P) via polymerase chain reaction. All AS160 cDNA constructs
were confirmed for accuracy using the High-Throughput DNA Sequencing service at Brigham
and Women’s Hospital (Boston, MA). Plasmid DNA was then amplified in E. coli TOP10 cells
(Invitrogen), extracted and purified using an endotoxin-free Plasmid Mega Kit (Qiagen), and
suspended in saline at [4 μg/μl].
In vivo gene transfer in mouse skeletal muscle
Briefly, mice were anesthetized via intraperitoneal injection of pentobarbital sodium (90
mg/kg), and 100 µg of DNA (empty pCAGGS or AS160 constructs) was injected longitudinally
into the tibialis anterior muscle using a 29-gauge needle. Stainless steel electrode needles fixed 4
mm apart were then inserted into the transverse muscle belly and square-wave electrical pulses
(200 V/cm) were applied 8x at a rate of one pulse per second (duration 20 ms) using a Grass S88
pulse generator (Grass Instruments, Quincy, MA).
Infusion of glucose into retroorbital sinus
To perform this infusion, a blunt-tipped 29-gauge hypodermic needle attached to an insulin
syringe was inserted into the corner of the eye socket, directing the tip at a 45-degree angle
toward the middle of the eye socket. Gentle downward pressure was applied until the vein was
pierced, and then saline or glucose solution containing 3H-2-DG (5uL/g body wt) was slowly
(90-sec) injected.
Table 1. Primer pairs used for subcloning and sequencing human AS160 with N-terminal myc-tag
Composite Forward Primer (76mer):
5’ AACTCGAGGCCACCATGGAGCAAAAGCTTATTTCTGAAGAGGACTT
GATGGAGCCGCCCAGCTGCATTCAGGATGA 3’
Composite Reverse Primer (41mer):
5’ TTCTCGAGTTATGG CTTATTTCCTATCTTGGCTTTGTTGTT 3’
Forward Sequencing Primer #1 (24mer): Coverage from 5’ nucleotide 573 on human AS160
5’ ATAATGAGGACGCCTTTTACAACT 3’
Reverse Sequencing Primer #1 (23mer): Coverage from 3’ nucleotide 646 on human AS160
5’ AGCATAAAGACTGGGGCTGATTT 3’
Forward Sequencing Primer #2 (26mer): Coverage from 5’ nucleotide 1250 on human AS160
5’ TTATGTATTCCAGTGTGCCAGCGAAT 3’
Reverse Sequencing Primer #2 (24mer): Coverage from 3’ nucleotide 1180 on human AS160
5’ AATATCTTCCATATCACATCTGAT 3’
Table 2. Primer pairs used for mutagenesis of myc-tagged CBD mutant AS160 and 4P mutant AS160
to create two additional double mutant forms of AS160
Double Mutant AS160 (CBD + R/K)
Start with CBD Mutant Template and Mutate GAP domain (R/K) with Following Primers:
Mutagenic Primer Sequences (33mer)
R973K Mutant Forward Primer:
5’ CTCGTGGATTTAGGAAAGACGTTTCCTACTCAC 3’
R973K Mutant Reverse Primer:
5’ GTGAGTAGGAAACGTCTTTCCTAAATCCACGAG 3’
Sequencing Primer Sequence (26mer)
R973K Mutant Sequencing Primer:
5’ CAGAAAAGTTAAATTAGACTATGAAG 3’
Double Mutant AS160 (CBD + 4P)
Start with 4P Mutant Template and Mutate CBD w/Following Primers:
Mutagenic Primer Sequences (42mer)
CBD Mutant Forward Primer:
5’ CAAAAGAACTGAGGAGCGGGGGGAGAAAAGCTATACACCAAC 3’
CBD Mutant Reverse Primer:
5’ GTTGGTGTATAGCTTTTCTCCCCCCGCTCCTCAGTTCTTTTG 3’
Sequencing Primer Sequence (24mer)
CBD Mutant Sequencing Primer:
5’ ACTGCCCCCTCTTTCCTGAAAAGC 3’
Figure S1. AS160 expression in transfected skeletal muscles. Empty pCAGGS vector or one
of six myc-tagged AS160 DNA constructs (1) wild type, 2) CBD mutant, 3) 4P mutant, 4) CBD
+ 4P mutant, 5) R/K mutant, and 6) CBD + R/K mutant) were injected into the tibialis anterior
muscles of anesthetized mice, followed by in vivo electroporation. Animals were sacrificed 7
days post-injection, and muscles were processed for analysis of total AS160 expression via
immunoblot. The data are expressed as means ± S.E. (n = 5–6/group).
Figure S2. Contraction-stimulated AMPK Thr172 phosphorylation is normal in skeletal
muscle transfected with wild type and CBD mutant AS160. Empty pCAGGS vector or myctagged AS160 DNA constructs (wild type and CBD mutant) were injected into the tibialis
anterior muscles of anesthetized mice, followed by in vivo electroporation. Transfected muscles
were harvested 7 days later following basal treatment (sham operation) or 15 min in situ muscle
contractions, and subsequently analyzed via immunoblot for phospho-AMPK Thr172. The data
are expressed as the means ± S.E. (n = 4-5/group).
Figure S3. Transfected mice exhibit similar blood glucose levels during contraction
experiments in vivo. Empty pCAGGS vector or CBD-mutant AS160 DNA was injected into
the tibialis anterior muscles of anesthetized mice, followed by in vivo electroporation. Seven
days later, each mouse performed 15 min in situ muscle contractions in one leg while the other
leg was left unstimulated. Blood was obtained from the tail vein over the course of 45-min. The
data are expressed as the means ± S.E. (n = 11-12/group).
Figure S4. Biotinylated calmodulin strongly binds AS160 unless the calmodulin-binding
domain (CBD) has been mutated. Myc-AS160 immunoprecipitates (wild type, CBD mutant,
4P mutant, CBD + 4P mutant, R/K mutant, CBD + R/K mutant) were probed with biotinylated
calmodulin (100 ng/ml) in the presence of calcium (0.5 mM CaCl2) to determine whether
transfected AS160 can bind calmodulin (A). Subsequently, total AS160 protein was assessed
after stripping membranes with the calcium chelator EGTA (5 mM) (B). Data are representative
blots; n = 4/group.
Figure S1
Figure S2
Figure S3
Figure S4