Download Erwinia amylovora

2008_TPDP_27
Erwinia amylovora
Annex to ISPM No. 27
INTERNATIONAL STANDARDS FOR
PHYTOSANITARY MEASURES
Annex to ISPM No. 27 (DIAGNOSTIC PROTOCOLS FOR REGULATED PESTS)
Erwinia amylovora
(200-)
CONTENTS
Endorsement
1. Pest information
2. Taxonomic information
3. Detection
3.1. Detection in plants with symptoms
3.1.1. Sampling
3.1.2. Isolation
3.1.2.1. Direct isolation
3.1.2.2. Enrichment isolation
3.1.3. Serological detection
3.1.3.1. Direct tissue print-ELISA
3.1.3.2. Enrichment DASI-ELISA
3.1.3.3. Immunofluorescence
3.1.4. Molecular detection
3.1.4.1. PCR
3.1.4.1.1. DNA extraction
3.1.4.1.2. PCR amplification
3.1.4.1.3. Real-time PCR
3.2. Detection in asymptomatic samples
3.2.1. Sampling and sample preparation
3.2.2. Enrichment
3.2.3. Screening tests
4. Identification
4.1. Nutritional and enzymatic tests
4.2. Serological identification
4.2.1. Agglutination test
4.2.2. IF test
4.2.3. ELISA tests
4.3. Molecular identification
4.3.1. PCR
4.3.2. Macrorestriction and PFGE
4.3.3. Inoculation techniques
5. Records
6. Contact points
7. Acknowledgements
8. References
1
2008_TPDP_27
Endorsement – This protocol was adopted by the Commission on Phytosanitary measures in---1.
Pest information
Erwinia amylovora is the causal agent of fire blight disease, which affects most species of subfamily
Maloideae of the family Rosaceae and was the first bacterium described as causal agent of a plant disease by
Burrill (1893). It was considered to be native to North America and was first detected outside of North
America in New Zealand in 1920. Fire blight was reported in 1957 in England and since them it has been
detected in Europe, in most areas where susceptible hosts are cultivated. E. amylovora is now present in
more than 30 countries, but has not been recorded in South America, most African and Asiatic countries
(with the exception of most of those surrounding the Mediterranean sea) and has been recorded in Australia
(Bonn and van der Zwet, 2000). It represents a threat to the pome fruit industry of all these countries. Details
on geographical distribution can be found in EPPO/CABI Distribution Maps (1998).
The most important hosts from both economic and epidemiological points of view are in the genera
Chaenomeles, Cotoneaster, Crataegus, Cydonia, Eriobotrya, Malus, Mespilus, Pyracantha, Pyrus, Sorbus
and Stranvaesia. E. amylovora isolated from Rubus sp. in the USA appears to be distinct from the strains
from other hosts (OEPP-CABI, 1997).
Fire blight is probably the most serious bacterial disease affecting pear or apple cultivars in many countries.
Epidemics are sporadic and are dependent on a number of factors that include favourable environmental
conditions, inoculum level present in the orchard and host susceptibility. The development of fire blight
symptoms follows the seasonal growth development of the host plant, it begins in spring with the production
of the primary inoculum and blossoms infection, continuing into summer with shoots and fruit infection and
ending in fall with the development of cankers. The pathogen is apparently quiescent throughout the dormant
period of the host (van der Zwet and Beer, 1995).
2. Taxonomic information
Erwinia amylovora is classified as a Proteobacteria, Y subdivision, order Enterobacteriales, family
Enterobacteriaceae, genus Erwinia
Synonyms: Micrococcus amylovorus Burrill, Bacillus amylovorus (Burrill) Trevisan, Bacterium amylovorus
(Burrill) Chester, Erwinia amylovora f.sp. rubi Starr, Cardona and Falson.
3. Detection
3.1. Detection in plants with symptoms
3.1.1. Sampling
Symptoms of fire blight on the most common hosts (pear, apple, quince, loquat, cotoneaster, hawthorn,
pyracantha) are relatively similar and easily recognized. The name of the disease is descriptive of its major
characteristic: the brownish aspect of twigs, flowers and leaves as though burned by fire. The typical
symptoms on pome fruit trees are the brown to black colour of leaves on affected branches, the production of
exudates and the typical “shepherd’s crook” in the shoots. Depending on the affected plant part the disease
produces blossom blight, shoot or twig blight, leaf blight, fruit blight, limb and trunk blight and collar or
rootstock blight (van der Zwet and Keil, 1979, van der Zwet and Beer, 1995).
In apple and pear trees the first symptoms usually appear in early spring when average temperatures rise
above 13-15oC, during warm and humid weather. Blossoms appear to be water-soaked, then wilt, shrivel, and
turn brown to black. Peduncles may also appear water-soaked, become dark green, and finally brown or
black, sometimes oozing droplets of sticky bacterial exudates. Leaves wilt, shrivel and entire spurs turn
brown in apples or dark brown to black in pears, but remain attached to the tree for some time. Young
fruitlets turn brown and remain attached to the tree. Immature fruit show infected parts appearing oily or
water-soaked, becoming brown to black and often exuding droplets of bacterial ooze. Characteristic reddishbrown streaks are often found in the subcortical tissues when the bark is peeled from the infected limb or
twig (van der Zwet and Keil, 1979). Brown to black, slightly depressed cankers develops in the bark of twigs
or branches, or trunk. These cankers may later become defined by cracks near the margin of diseased and
healthy tissue (Dye, 1983).
2
2008_TPDP_27
Confusion between fire blight and blight or blast like symptoms, especially in blossoms and buds, may occur
with diseases/disorders caused by other bacteria, fungi, insect damage and physiological disorders. Other
bacteria can cause blight-like symptoms including E. pyrifoliae, causal agent of bacterial shoot blight of
Asian pear (Pyrus pyrifolia) (Kim et al., 1999 ), a new Erwinia species isolated from necrotic pear blossoms
in Spain (Roselló et al., 2002, 2006)for which the name Erwinia piriflorinigrans is proposed, Erwinia sp. in
Japan that causes bacterial shot blight (Tanii et al., 1981) and Pseudomonas syringae pv. syringae the causal
agent of blossom blast. Certain fungal diseases have been reported to have symptoms similar to fire blight
for example European Canker (Nectria galligena) may cause difficulty in identifying the causal agent of
holdover cankers. Fire blight damage can also be confused with some insects due to wounds they cause at
the base of young shoots for example periodic cicada (Magicicada septendecim) and stem saw fly (Janus
compressus). Definitive diagnosis should always be obtained through laboratory analysis.
The samples for diagnosis of fire blight on plants with symptoms can be flowers, shoots or twigs, leaves,
fruits (with necrosis and exudates if possible) or the discoloured subcortical tissues after peeling the bark
from cankers in twig, branches, trunk or collar. Plant material should be processed as soon as possible after
collection and stored at 4-8 ºC until processed. Processed samples can be cold-stored for further verification,
for no longer than few weeks. The symptomatic samples can be processed individually or in small groups.
Precaution to avoid cross-contamination should be taken when collecting the samples and during the
bacterial/DNA extraction process.
The samples should be processed with a general procedure valid for isolation, serological tests and PCR
analysis, before or after enrichment. The use of an antioxidant maceration buffer (polyvinilpyrrolidone
(PVP-10), 20 g; mannitol 10 g; ascorbic acid 1.76 g; reduced glutathion 3 g; PBS 10 mM; pH 7,2; 1 liter;
sterilised by filtration) is strictly required for a successful enrichment, as indicated by Gorris et al. (1996b).
The samples can also be processed in phosphate buffered saline, pH 7.2 10 mM (PBS) (NaCl 8 g; KCl 0.2 g;
Na2HPO4·12H2O 2.9 g; KH2PO4 0.2 g; distilled water 1 liter) for direct isolation, immunofluorescence or
PCR.
Carefully select the plant parts showing the freshest symptoms and with exudates when possible. Select
material for processing from the leading edge of disease lesions.
Shoots: take a piece of the symptomatic shoot, including leaves, at the margin between the necrotic and
healthy tissue, to reach ca. 0.1 g of material. Put into a plastic bag and proceed with the maceration as
indicated below.
Blossoms: take one or several flowers and peduncles until reaching ca 0.1 g and proceed as below.
Leaves: take one or several leaves and petioles until reaching ca. 0.1 g and proceed as below. Preferentially
select leaves with vein necrosis and not fully necrotic.
Stems: peel off the external bark of the stems with symptoms, using a sterile scalpel and take pieces
underneath with typical subcortical discolouration symptoms until reaching ca. 0.1 g of material.
Cut the shoots, flowers, stem, fruits, etc. into pieces into plastic bags (preferentially with a heavy net). To
each bag add 4.5 ml of the antioxidant maceration buffer above described . Let the samples stand in
maceration buffer for at least 5 min. Slightly crush the plant material with a hammer or specific apparatus in
the plastic bag. Let the samples stand on ice for few minutes. Transfer ca. 2 ml, 1 ml and 1 ml of each
macerate to three sterile Eppendorf tubes by decantation. Store one tube with 1 ml of each sample at –20ºC
for subsequent analysis and another with 30% glycerol at –80ºC. Keep the remaining tube with 2 ml on ice.
From these tubes, the same day of the maceration of the samples, perform the isolation procedures as well as
the enrichment and the fixation of the slides for immunofluorescence (if this technique is to be used) on the
same day the samples are macerated. The PCR analysis can be performed at the earliest convenience using
the Eppendorf tubes stored at –20ºC.
For preparation of the plant tissue prints or blottings (membrane printing) make cross-clean cuts on
symptomatic shoots, blossoms, leaves or fruitlets.
3
2008_TPDP_27
The techniques and protocols indicated below have been selected after validation in an European ring test in
10 laboratories.
3.1.2. Isolation
Freshly prepared sample extracts are essential for successful isolation. The isolation of E. amylovora from
symptomatic samples is relatively easy because numbers of culturable bacteria are usually high. However,
when symptoms are very advanced or when the environmental conditions are not favourable for fire blight
expression, the number of E. amylovora culturable cells can be very low. Isolations can result in plates being
overcrowded with saprophytic or antagonistic bacteria. If this is suspected, the sample should be re-tested
and/or enrichment used before isolation, according to 2.4.
Plating on three media is advised for maximum likelihood of recovery of E. amylovora, especially when
samples are not in the best conditions. Depending on the number and composition of the microbiota of the
sample, each one is more or less efficient. Three media (CCT, Levan and King’s B) have been validated in a
ring test, with Levan having the highest plating efficiency.
When analysing symptomatic samples, good correlation is expected between isolation, immunofluorescence,
enrichment DASI-ELISA and PCR. However, the induction of the viable but non culturable state has been
described in E. amylovora by copper (Ordax et al., 2006).
3.1.2.1. Direct isolation
The isolation has been validated in a ring test in the European Union as the most robust method for E.
amylovora detection when using the three media indicated below.
1) Use three media: CCT (Part 1: sucrose 100 g; sorbitol 10 g; Niaproof 1,2 ml; crystal violet 2 ml (sol. 0,1
% ethanol); nutrient agar 23 g; distilled water 1 liter; pH 7.0-7.2; sterilisation by autoclaving 115ºC, 10
min. Part 2: thallium nitrate 2 ml (1%w/v aqueous solution); cycloheximide 0,05 g; sterilization by
filtration and add to 1 liter of the sterile first part (at about 45ºC); Ishimaru and Klos, 1984), King’s B
(proteose peptone Nº 3 20 g; glycerol 10 ml; K2HPO4 1,5 g; MgSO4 .7H2O 1,5 g; agar 15 g; distilled
water 1 liter; pH 7.0-7.2, sterilization by autoclaving; King et al., 1954) and Levan (or Nutrient Agar
Sucrose) media (yeast extract 2 g; bactopeptone 5 g; NaCl 5 g; sucrose 50 g; agar 20 g; distilled water 1
liter; pH 7-7.2, sterilization by autoclaving). Prepare 1:10 and 1:100 dilutions of each macerate in PBS
(NaCl 8 g; KCl 0.2 g; Na2HPO4·12H2O 2.9 g; KH2PO4 0.2 g; distilled water 1 liter).
2) Pipette 50 l of the diluted and undiluted macerates onto separate plates of each medium. Start with 1:100
dilutions and proceed to the undiluted macerate. Carefully spread the pipetted volumes by triple streaking.
3) Plate a 103, 104 and 105 cfu/ml dilution of a pure culture of Erwinia amylovora as a quality control of the
media. Incubate the plates at 25ºC for 48-72 h. Final reading is at 72 h. Note for most isolations Erwinia
amylovora small colonies can be observed after 24 hrs.
4) Colonies of E. amylovora on CCT are pale-violet, circular, high convex to domed, smooth and mucoid
show slower growth than on King’s B or Levan. When viewed under 10 X microscope Erwinia
amylovora exhibit characteristic colony types with pitting/craters that allows distinction from other
bacteria. This should be viewed within 24 – 48 hrs after isolation. CCT medium inhibitsthe nonfluorescing group of pseudomonads but not the fluorescent pseudomonads such as Pseudomonas syringae
and Pseudomonas fluroscens (Ishimaru & Klos) or Pantoea agglomerans.
Colonies of E. amylovora on King’s B are creamy white, circular intending to spread and nonfluorescent under UV light at 366 nm. This allows the distinction from fluorescent Pseudomonas spp.
Colonies of E. amylovora on Levan medium are whitish, circular, domed, smooth and mucoid.
Levan negative colonies of E. amylovora have also been reported (Bereswill et al., 1997).
5) Obtain pure cultures from individual suspect colonies of each sample by plating on King’s B medium.
Identify presumptive colonies of Erwinia amylovora by inoculation on the available E. amylovora host,
by DASI-ELISA or PCR, or by any other appropiate test (biochemical tests, IF, fatty acids profile, etc) as
indicated in identification. Store cultures in Nutrient agar slants covered with mineral oil at 10ºC or, for
long term storage, in 30% glycerol at –80ºC or by lyophilization.
4
2008_TPDP_27
The isolation is negative if no bacterial colonies with morphology similar to E. amylovora are observed after
72 h in any of the three media (provided that no inhibition is suspected due to competition or antagonism)
and that typical E. amylovora colonies are found in the positive controls. The isolation is positive if
presumptive E. amylovora colonies are isolated in at least one of the media used.
3.1.2.2. Enrichment-isolation
The enrichment is used to multiply the initial population of culturable E. amylovora in the sample. It should
be used before isolation (even in symptomatic samples) when a low number of culturable E. amylovora is
expected (copper treated samples, old symptoms, non favourable weather conditions for fire blight, winter
season, etc). The use of two validated enrichment media, one non selective (King’s B) and one semiselective, (CCT) is advised because the composition and number of the microbiota is unknown. It is also
necessary to perform the enrichment before detection by ELISA, due to the low level of sensitivity obtained
by such technique when using specific monoclonal antibodies.
1) As soon the macerates have been made, dispense 0.9 ml of each sample into each of two sterile 35 ml tubes that have been prepared in advance with the same volume of each enrichment medium.
2) For additional negative controls, add an equal volume of CCT and King’s B sterile liquid media to
one each of the two tubes with 0.9 ml of the chosen maceration buffer. Incubate at 25ºC for 40 h without
shaking.
3) Plate the enrichments only on CCT plates. Spread 50 l of each enriched extract and of the 1:10,
1:100 and 1:1000 dilutions prepared in PBS by triple streaking (as for isolations) to obtain isolated colonies.
Incubate at 25ºC for 48-72 h. Final reading is at 72 h as indicated. The use of only semi-selective medium
and dilutions is advised because of the abundant multiplication of different bacteria during the enrichment
step.
3.1.3. Serological detection
3.1.3.1. Direct tissue print-ELISA
This method may facilitate presumptive diagnosis on symptomatic plant material but it needs further
confirmation. The method can also be used to spot bacterial colonies or exudates as and additional rapid test
of serological identification. The use of antibodies that have been well characterised with known specificity
is required. The only complete kit based on specific monoclonal antibodies, commercially available is
indicated in appendix 2.
1) Press freshly made plant sections carefully against the nitrocellulose membrane. The exudates or
bacterial colonies in solid medium can also be printed or spotted. Disinfect the cutting tool after using to
avoid contaminations. Print positive and negative controls using an inoculated host plant with fire blight
symptoms and a healthy plant of the same species to analyse. Let dry the trace or print for a few minutes.
Handle the membranes with care. Printed membranes can be kept for several months in a dry place at room
temperature.
2) Prepare a solution of 1% bovine serum albumin (BSA) in distilled water (stirring up with a stick).
Place the membranes in an appropriate container (tray, hermetic container, plastic bag). Pour, cover the
membranes with albumin solution and incubate for 1h at room temperature, or overnight at 4ºC. Slight
agitation is beneficial. After the incubation time elapsed, discard the albumin solution, keeping the
membranes in the same container.
3) Dilute specific E. amylovora monoclonal antibodies alkaline phosphatase conjugated in PBS at
the appropriate dilution. Pour the solution on the membranes, covering them. Incubate for 2-3 h by shaking
at room temperature and discard the solution.
4) Prepare washing buffer (PBS, pH 7.2-7.4 supplemented with 0.05% Tween 20: NaCl 8 g; KCl 0.2
g; Na2HPO4·12H2O 2.9 g; KH2PO4 0.2 g; Tween 20 500 l; distilled water 1 liter). Rinse the membranes and
the container with washing buffer. Wash by shaking (manually or mechanically) with a larger buffer amount
for 5 min. Eliminate washing buffer and repeat the operation twice.
5
2008_TPDP_27
5) Prepare BCIP-NBT (Sigma Fast) substrate buffer. Pour over the membranes and let incubate until
appearance of purple-violet colour in the positive control (approx. 10 min). Stop the reaction by washing the
membranes with tap water. Let dry, spreading them out on absorbent paper.
6) Observe the printings by using a low power magnification (X10 or X20).
The test is positive when purple-violet precipitates appear in the sections of plant material and not in
the negative control. If exudates or colonies are printed they should appear violet when positive. When using
the commercially available kit, pre-printed membranes include positive and negative controls.
The test is negative when no purple-violet precipitates appear as in the negative control.
3.1.3.2. Enrichment DASI-ELISA
The only commercial kit for Enrichment DASI-ELISA has been validated in a ring tests in the European
Union. It is available from PlantPrint Diagnostics (Valencia, Spain). It is based on the monoclonal antibodies
and technique described in Gorris et al. (1996 a and 1996 b) and requires the previous enrichment of the
samples as indicated in enrichment-isolation.
As positive controls use aliquots of sample extract of the same hosts analysed, that previously tested
negative, mixed with 108 cells of E. amylovora per ml.
As negative controls include a sample extract of the same hosts analysed, that have been previously tested
negative for E. amylovora and a suspension of a non E. amylovora strain in PBS.
1) Boil for 10 min the necessary amount of the enriched extracts and controls in a water bath (or put
them at 100º in a thermoblock) before being processed by ELISA, minding the tubes not to be opened. Keep
the remaining enriched samples for isolation and/or PCR. Use the heated samples (once at room temperature)
the same day after this heat treatment or freeze them at –20ºC for subsequent analysis. This treatment is
necessary for optimum sensitivity and specificity.
2) Prepare the appropriate dilution of rabbit anti-E. amylovora polyclonal immunoglobulins in
carbonate buffer, pH 9.6 (Na2CO3 1.59 g; NaHCO3 2.93 g; distilled water 1 liter). Add 200 µl to each well of
a Nunc Polysorp (or equivalent) ELISA plates. Incubate at 37ºC for 4 h or at 4ºC for 16 h. Wash the wells
three times with washing buffer (PBS, pH 7.2-7.4 supplemented with 0.05% Tween 20: NaCl 8 g; KCl 0.2 g;
Na2HPO4·12H2O 2.9 g; KH2PO4 0.2 g; Tween 20 500 l; distilled water 1 liter).
3) Add 200 µl per well of the plant macerates previously enriched in the two media and boiled. Use
two wells per sample enriched on each medium, and two of the positive and negative controls. It is also
necessary to place negative controls of the extraction buffer and of the enrichment media used (previously
prepared as additional negative controls of the enrichment). Incubate for 16 h at 4ºC. Wash the wells three
times with washing buffer (as above).
4) Prepare the appropriate dilution of specific E. amylovora monoclonal antibodies in PBS plus 0.5%
bovine serum albumin (BSA) and add 200 µl to each well. Incubate at 37ºC for 2 h. Wash the wells three
times with PBS-Tween.
5) Prepare the appropriate dilution of goat anti-mouse immunoglobulins conjugated with alkaline
phosphatase (Sigma) in PBS. Add 200 µl to each well. Incubate at 37ºC for 2 h. Wash the wells three times
as above.
6) Prepare a 1 mg/ml alkaline phosphatase substrate (p-nitrophenylphosphate) in substrate buffer
(diethanol amine 97 ml; dilute in 800 ml of distilled water; adjust pH 9.8 with concentrated HCl; adjust at
1000 ml with distilled water). Add 200 µl to each well. Incubate at room temperature and read at 405 nm
after 30, 45, and 60 min.
The ELISA test is negative if the average optical density (OD) reading from duplicate sample wells is <2x
OD of that in the negative sample extract control wells (providing the OD for the positive controls are above
1.0 after 60 minutes incubation and are greater than twice the OD obtained for negative sample extracts).
6
2008_TPDP_27
The ELISA test is positive if the average OD readings from duplicate sample wells is >2x OD in the negative
sample extract wells provided that 2x average OD readings in all negative control wells are lower those in
the positive control wells. Reliable confirmation of a positive result can be obtained by isolation, or
enrichment isolation and identification of the colonies as E. amylovora.
Negative ELISA readings in positive control wells indicate that the test has not been performed correctly
and/or the reagents were not well prepared. Positive ELISA readings in negative control wells indicate crosscontaminations or non-specific antibody binding has occurred. In either case, the test should be repeated or a
second test based on a different biological principal should be performed.
3.1.3.3. Immunofluorescence (IF)
IF is an alternative serological method. It is convenient to follow the standard protocol for described in
Anonymous (1998). Use a validated source of antibodies to E. amylovora. Three commercial antibodies have
been validated in the ring test of the European Union and are available through PlantPrint Diagnostics
(Valencia, Spain) and Loewe Biochemicals (Sauerlach, Germany). It is recommended that the titre and the
dilution of use is determined for each new batch of antibodies. IF test should be performed on fresh sample
extracts fixed in slides. When extracts stored at –80ºC under glycerol are used, remove it by adding 1 ml of
PBS, centrifuge for 15 min at 7000 g, discard supernatant and resuspend in PBS.
For each set of tests prepare a positive control slide using a suspension of 10 6 cells/ml of a known pure
culture of E. amylovora. For large-scale survey work it is recommended to include blind positive control
slides. Use PBS and an aliquot of a sample extract, which was negative by several techniques, as negative
controls.
a) Use undiluted macerates and 1:10 and 1:100 dilutions in PBS, (NaCl 8 g; KCl 0.2 g;
Na2HPO4·12H2O 2.9 g; KH2PO4 0.2 g; distilled water 1 liter) to spot windows of the IF slides.
Prepare one slide for each sample and its dilutions.
b) Allow to air dry and fix by flaming or by absolute or 95º ethanol according to the characteristics of
the antibodies used. Store slides at –20ºC until required.
c) Use the monoclonal or polyclonal antibodies at the appropriate dilutions in PBS. Spot 25-30 l per
well. Incubate slides in moist chamber for 30 minutes at room temperature. Use of two dilutions of
the antibodies is advised when working with polyclonal antibodies, to detect cross reactions with
other bacteria.
d) Shake droplets off the slide and rinse slides carefully with PBS. Wash 10 minutes with the same
buffer. Carefully remove excess moisture.
e) Dilute the appropriate FITC conjugates in PBS: anti-mouse for the monoclonal antibodies (GAMFITC) and anti-rabbit (GAR-FITC) or anti-goat for polyclonal antibodies. Cover the windows of
all slides with the corresponding diluted conjugate and incubate in moist chamber for 30 minutes
at room temperature. Repeat the washing step.
f) Pipette 5-10 l 0.1M phosphate buffered glycerol mountant with anti-fadding (0.5% pphenylendiamine or other) on each window and apply a cover slip.
g) View slides under oil immersion at 500-1000X magnification by scanning windows across 2
diameters at right angles and around the perimeters.
The test is negative if green fluorescing cells with morphology typical of E. amylovora are observed in
positive controls but not in sample windows. The test is positive if green fluorescing cells with typical
morphology are observed in positive control and sample windows, but not in negative control windows.
Reliable confirmation of a positive result can be obtained by isolation, or enrichment isolation and
identification of the colonies as E. amylovora. As a population of 103 cells per ml is considered the limit of
reliable detection by the IF test, for samples with > 103 cells per ml, the IF test is considered positive. For
7
2008_TPDP_27
samples with <103 cells per ml, the result of the IF test may be considered doubtful. In such case further
testing or re-sampling should be performed. Samples with large numbers of incomplete or weakly
fluorescing cells compared to the positive control would need further testing.
3.1.4. Molecular detection
3.1.4.1. PCR
Use validated PCR reagents and protocols. Take standard precautions to avoid contamination of samples
with target DNA for example, the use of dedicated pipettes for PCR and the use of barrier tips. Positive
controls should use aliquots of sample extract previously tested negative by several techniques, to which
suspensions of 104 and 106 cells/ml of a known E. amylovora strain (preferably the type strain from an
international collection) have been added. Prepare positive controls in a separate laboratory where samples
will be tested. Negative controls should consist of a sample extract consisting of host material previously
tested negative for E. amylovora and a sample of ultra pure water used in preparation of the PCR
mix/reagents. Perform the DNA extraction from the positive and negative controls as well as from the
samples.
One protocol for DNA extraction from plant samples (Llop et al., 1999) and two amplification
protocols (Bereswill et al., 1992 and Llop et al., 2000) have been validated in the ring test. Some commercial
kits for extracting DNA are available, but have not yet been validated.
3.1.4.1.1. DNA extraction
Use 1 ml of each macerate and/or 1 ml of the enriched macerates to perform a protocol for extracting the
DNA according to Llop et al., 1999.
1) Centrifuge the macerates at 13.000 rpm for 5 min at room temperature. Discard the supernatant,
and resuspend the pellet in 500 µl of extraction buffer (Tris HCl, pH 7.5 24.2 g; NaCl 14.6 g; EDTA 9.3 g;
SDS 5 g; polyvinilpyrrolidone PVP-10 20g; distilled water 1 liter; sterilised by filtration) and shake for 1 h
at room temperature.
2) Centrifuge the tubes at 5.000 rpm for 5 min. Take 450 µl of the supernatant and place it into a
new Eppendorf tube. Add the same volume of isopropanol, invert and leave for 1 h at room temperature.
3) Centrifuge at 13.000 rpm for 5 min, discard the supernatant and dry on bench. If there is still a
coloured precipitate (brown or green) at the bottom of the tubes, carefully take it while discarding the
supernatant, thus obtaining a cleaner DNA. DNA tends to stick to the side of the Eppendorf tube rather than
the bottom. Resuspend the pellet in 200 µl of water. Use 5 or 1 µl for the PCR reaction depending on the
amplification performed.
Taylor et al. reported good specificity by macerating tissue samples in 500 µl of buffer (140 mM
NaCl; 50 mM KCl; 0.05% Tween 20; 2% PVP; 0.4% BSA). Five µl of the resultant suspension are mixed
with 15 µl of gene releaser TM (Bioventures, Inc.) and treated according to the manufacturer’s protocol.
3.1.4.1.2. PCR amplification
There are many PCR primers and protocols described for E. amylovora detection. Most of them can be used
for specific identification (Bereswill et al., 1992; Bereswill et al., 1995; Guilford et al., 1996; Taylor et al.,
2001 Mc Manus and Jones, 1995). Some have shown specificity problems as the primers of Maes et al.
(1996) because they also amplified an Erwinia piriflorinigrans. isolated from necrotic pear blossoms
(Roselló et al., 2002; 2006).
The primers and protocols validated in a ring test were those of Bereswill et al. (1992) and Llop et al. (2000),
with or without previous enrichment.
The discovery of fully virulent E. amylovora strains without pEA29 (Llop et al., 2006) and experience from
different countries (Powney et al., 2007) advices the use of two PCR protocols: one can use primers based on
pEA29 sequences and the other should be based on chromosomal sequences.
Conventional PCR.
8
2008_TPDP_27
Conventional or single PCR can be applied using the primers and conditions described by Bereswill et al.
(1992). The primers sequences are: A: 5’ CGG TTT TTA ACG CTG GG; B: 5’ GGG CAA ATA CTC GGA
TT. The PCR mix is composed by: water (PCR grade), 20 µl; buffer 10x, 5 µl; MgCl2 50 mM, 1.5 µl; dNTPs
10 mM, 1 µl; 2-mercaptoethanol, 1.4 µl; bovine serum albumin 1 µg/µl, 8 µl; DMSO, 2.5 µl; Tween 20, 0.5
µl; Primer A 10 pmol/µl, 2.5 µl; Primer B 10 pmol/µl, 2.5 µl; Tth polymerase 5 U/µl, 0.1 µl. The sample
volume is 5 l that should be added to 45 l mix. The reaction conditions are: a denaturation step of 93ºC for
2 min followed by 37 cycles of 93ºC for 1 min, 52ºC for 2 min, and 72ºC for 2 min. A final step of 72ºC for
10 min finishes the reaction. The amplicon size is 900 bp size according to Bereswill et al. (2002) although
variations in size can occur between 900 and 1100 bp (Lecomte et al., 1997), due to the number of 8 bp
repeats sequences within the fragment (Jones and Geider, 2001).
Also, a more simple PCR mix was assayed with the same results as the original, as shown: water (PCR
grade), 33.1 µl; buffer 10x, 5 µl; MgCl2 50 mM, 3 µl; formamide, 2 µl; dNTPs 10 mM, 0.5 µl; primer A 10
pmol/µl, 0.5µl; primer B 10 pmol/µl, 0.5 µl; Taq polymerase 5 U/µl, 0.4 µl. The reaction conditions in this
case are: a denaturation step of 93ºC for 5 min followed by 40 cycles of 93ºC for 30 s, 52ºC for 30 s, and
72ºC for 1 m 15 s. A final step of 72ºC for 10 min finishes the reaction. Single components of the mix can be
replaced by Ready Mix Taq with Cl2 Mg or Ready Mix Red Taq PCR Reaction Mix with MgCl2 (Sigma).
The protocol designed by Taylor et al. (2001) is also providing good results. The primers are:
5’CCTGCATAAATCACCGCTGACAGCTCAATG3’
and
5’GCTACCACTGATCGCTCGAATCAAATCGCC3’. The PCR mix is composed by: 1.5 mM MgCl 2, 50
mM KCl, 10mM Tris HCl pH 8.3, 200 M of each dNTP, 0.5 M of each primer, 400 ng/l BSA, and 1.25
units of Taq DNA polymerase. The reaction conditions are: 95ºC for 3 min, followed by 35 cycles of 94ºC
for 20s, 60ºC for 20s, 72ºC for 1 min and a final extension cycle of 5 min at 72ºC. The sample volumen is 15 l. The amplicon size is 187 bp.
Nested PCR
The Nested-PCR in a single tube (Llop et al., 2000) uses two sets of primers placed at the same time, and due
to the different annealing temperatures the two PCR reactions are performed consecutively. The external
primers are the same designed by McManus and Jones (1995), whilst the internal are the ones described by
Llop et al. (2000). The sequences are the following: external primers AJ75: 5’ CGT ATT CAC GGC TTC
GCA GAT and AJ76: 5’ ACC CGC CAG GAT AGT CGC ATA. Internal primers PEANT1: 5’ TAT CCC
TAA AAA CCT CAG TGC and PEANT2: 5’ GCA ACC TTG TGC CCT TTA.
The PCR mix is composed by: water (PCR grade), 34.76 µl; buffer 10x, 5 µl; MgCl 2 50 mM, 3 µl;
formamide, 2 µl; dNTPs 10 mM, 1 µl; primer AJ75 0.1 pmol/µl, 0.32 µl; primer AJ76 0.1 pmol/µl, 0.32 µl;
PEANT1 10 pmol/µl, 1 µl; PEANT2 10 pmol/µl, 1 µl; polymerase 5 U/µl, 0.6 µl. The sample volume is 1 µl
that should be added to 49 µl PCR mix.
The reaction conditions are: a denaturation step of 94ºC for 4 min followed by 25 cycles of 94ºC for 30 s and
72ºC for 1 min. This first round PCR is followed in the same thermocycler by a second denaturation step of
94ºC for 4 min and 40 cycles of 94ºC for 30 s, 56ºC for 30 s, and 72ºC for 45 s. A final step of 72ºC for 10
min finishes the reaction. The expected amplicon size is 391 bp, although some variations in size can occur.
The amplification conditions are optimised for the Perkin-Elmer 9600 apparatus, so small modifications of
the protocol could be necessary in other thermocyclers. When using the PCR reactions to confirm the
isolated colonies, use 1 U of Taq polymerase for Bereswill et al. (1992) protocol or 2 U with the Nested PCR
of Llop et al. (2000), (instead of 2 or 3 U as for plant material).
After both PCRs, prepare a 1.5 % agarose gel in TAE buffer 0.5 X (appendix 1). Load wells of gel and
include positive and negative controls. Include DNA marker 100 bp ladder in the first and last well of the
gel. Run the gel for 20 min at 120 V (medium gel tray: 15x10 cm) or 40 min at 160 V (big gel tray or
electrophoresis tank: 15x25 cm). Use a 2% w/v gel and 1h at 100v for Taylor’s primers. Soak the gel in
ethidium bromide solution for 20 minutes. Visualise the amplified DNA fragments by UV transillumination.
9
2008_TPDP_27
The restriction pattern of the amplicons obtained with the primers of Bereswill et al. (1992) and of the
amplicons obtained with the nested PCR in a single tube (Llop et al., 2000) can be performed with Dra I and
Sma I endonucleases, to confirm the PCR analysis.
The PCR test is negative if the E. amylovora specific amplicon of expected size and restriction pattern is not
detected for the sample in question but is detected for all positive control samples. Inhibition of the PCR may
be suspected if the expected amplicon is obtained from the positive control sample containing E. amylovora
in water but negative results are obtained from positive controls with E. amylovora in plant extract.
The PCR test is positive if the E. amylovora specific amplicon of expected size is detected, providing that it
is not amplified from any of the negative control samples and the restriction enzyme pattern is identical with
that derived from the positive control strain. If one of the negative controls shows a band of the size expected
for E. amylovora, repeat the PCR with a new mix and include several negative controls that allow the
detection of the contaminations. Reliable confirmation of a positive result can be obtained by isolation , or
enrichment isolation and identification of the colonies of E. amylovora.
3.1.4.1.3. Real-time PCR
Until now, there is only one published protocol for the detection of E. amylovora that takes advantage of the
real-time PCR technology (Salm and Geider, 2004). The primers are also devised from sequences of the
pEA29 plasmid, and the sensitivity and specificity are similar to that of the conventional PCRs. The authors
also developed a TaqMan probe for the detection, but with similar results regarding sensitivity as the SYBR
Green dye.
The primers are: P29TF 5’ CACTGATGGTGCCGTTG and P29TR5’ CGCCAGGATAGTCGCATA
The PCR mix is composed by: water (PCR grade), 10 µl; master mix 2X, 2,5 µl; P29TF 10 pmol/µl, 0,25 µl;
P29TR 10 pmol/µl, 0,25 µl. The sample volume is 2 µl added to 23 µl PCR mix. The reaction conditions are:
a denaturation step of 95ºC for 10 min followed by 40 cycles of 95ºC for 15 s and 60ºC for 1 min. A final
step of dissociation of the PCR products is performed to confirm that the fluorescence signals are true
positive, compared to the signal provided by the positive control.
The protocol involves heating the samples after the PCR reaction and detecting the fluorescence during the
increase of temperature. The fluorescence obtained with each sample should be analysed through the
dissociation step to distinguish the signal produced by primer-dimer formation and unspecific amplification
from the specific amplification product. A positive sample has to show a signal at the same temperature as
the positive control. Sometimes signals from primer-dimer can also be provided by a positive sample but this
does not interfere with the analysis.
3.2. Detection in asymptomatic samples.
3.2.1. Sampling and sample preparation
The asymptomatic samples can be processed individually or in groups of up to 100 samples (EPPO, 1992).
Where surveys are performed they should be based on statistically representative samples. Samples taken
from stored material can be considered random whereas those from the orchards or nurseries may not be.
Precautions to avoid cross contamination should be taken when collecting the samples and during the
extraction process.
Sampling and sample preparation can be performed following one of these protocols:
1) Collect blossoms, shoots, fruitlets or stem segments in sterile bags or containers in summer or
early autumn, after favourable conditions for fire blight confirmed (van der Zwet and Beer, 1995), according
to the following sampling procedures:
Nursery plants: Cut young shoots ca. 20 cm in length from the suspect plant, taking care to surface
disinfest the cutting tools between taking samples. If analyses need to be performed in winter, collect 5-10
buds per plant.
10
2008_TPDP_27
Field grown plants: Cut blossoms when available and/or young shoots of ca. 20 cm., taking care to
surface disinfest the cutting tools between taking samples. Take blossoms, or peduncle and base of the limb
of several leaves, or the stem segments of the selected plants.
Weigh ca. 0,1 – 1 g of plant material and use for maceration in the antioxidant buffer described for
isolation following the protocol described above. Process the samples immediately by performing
enrichment followed by DASI-ELISA, PCR and isolation, following the protocols described for
symptomatic samples. IF must be done directly with the extracts, without enrichment.
2) The quarantine procedure Nº 40 of the EPPO (1992) includes a sampling procedure for the
analysis of twigs of asymptomatic woody material from nurseries. A sample consists of 100 twigs about 10
cm in length from 100 plants. If there are several plant genera in the lot, these should be equally represented
in the sample (with a maximum of three genera per sample). From each sample randomly take 30 cut twigs
and cut them in four pieces (120 stem pieces). Place them for 1,5 h in a rotary shaker at room temperature in
sterile PBS additioned with 0,1 % Tween 20 in Erlenmeyer flasks. Filter with a paper held in a sintered glass
filter using a vacuum pump and collect the filtrate. Use directly the filtrate for analysis or centrifuge it for 20
min at 10.000 g. Suspend the pellet in 4.5 ml sterile PBS. Perform the techniques indicated below. A similar
protocol can be applied for leaves, shoots, flowers or buds. Depending on the season of survey the expected
recovery of E. amylovora will be more or less high being maximum in summer (provided that weather
conditions being favourable to E. amylovora and minimum in winter).
When following 1) or 2), prepare for each sample three Eppendorf tubes with ca. 2 ml, 1 and 1 ml of
macerate an use them as indicated for symptomatic material.
3.2.2. Enrichment
The direct analysis of asymptomatic samples is normally negative for E. amylovora due to the low bacterial
population. Consequently, it is advised to perform a previous enrichment of the samples prepared in the
antioxidant buffer (Gorris et al., 1996) as indicated above. When analysing asymptomatic material perform
the enrichment for 72 h at ca. 25ºC.
3.2.3. Screening tests
It is adviced to perform at least two screening tests:
a)
IF. Use one sample extract before or after concentration by centrifugation (but non enriched)
per IF slide window. Fix also decimal dilutions of the sample and follow the protocol described.
b)
Enrichment-isolation. Follow the procedure indicated.
c)
Enrichment-ELISA. Follow the procedure indicated.
d)
Enrichment-PCR. Use 500 µl of the samples enriched in King’s B and in CCT for DNA
extraction following Llop et al. (2000), Taylor et al. (2001), or other appropriate protocols. Follow the
amplification protocols described.
If any of the screening tests are positive, attempt to isolate the pathogen from the extract conserved
at –80 ºC with glycerol, or from the enriched samples. When three or four tests are positive and the isolation
is negative or not done, it is reasonable to consider E. amylovora presumptively detected in the sample, but
confirmation needs the isolation from new samples and identification of the bacterium.
4. Identification
A confirmed identification would involve results obtained from:
(1) key phenotypic tests such as Gram stain, oxidase test, O/F test, potato rot test, levan production
and morphologic characteristics on the selected media and
(2) PCR detection assays based on pEA29 plasmid (Bereswill et al., 1995) and on chromosomal
DNA (Taylor et al., 2001).
(3) tobacco hypersensity and inoculation into fire blight hosts to meet the requirement for koch's
postulates and to verify pathogenicity.
Symptoms caused by Erwinia amylovora can be confused with those caused by Pseudomonas syringae from
different hosts, Erwinia piriflorinigrans on pear (Roselló et al., 2002) and Erwinia pyrifoliae on Asian pear
(Kim et al., 1999, Rhim et al., 1999). The Spanish strains of Erwinia sp. and E. pyrifoliae have relatively
11
2008_TPDP_27
similar morphology to that of Erwinia amylovora. Differentiation can be observed by the use of monoclonal
antibodies (Gorris et al., 1996), PCR with specific primers and pathogenicity assays on several hosts.
The E. amylovora isolates recommended for use as positive controls are: NCPPB683 and CFBP 1430. The
following collections can provide different E. amylovora reference strains: National Collection of Plant
Pathogenic Bacteria (NCPPB), Central Science Laboratory, York, UK; Collection Française de Bactéries
Phytopathogènes (CFBP), INRA Station Phytobactériologie, Angers, France; The International Collection of
Micro-organisms from Plants, Manaaki Whenua Landcare Research New Zealand Ltd, Auckland, New
Zealand; The American Type Culture Collection (ATTC), Manassas, VA, U.S.A. The authenticity of the
strains can be guaranteed only if directly obtained from the culture collections.
4.1. Nutritional and enzymatic tests.
The genus Erwinia was defined for Gram-negative bacteria, facultative anaerobes, motile by peritrichous
flagella, rod shaped and acid produced from glucose, fructose, galactose and sucrose. Determine the
following key phenotypic properties (Paulin, 2000) that are universally present or absent in E. amylovora,
according to the methods of Jones and Geider (2001).
Test
Expected result
Gram staining
-
Levan production
+
Fluorescent pigment production in King’s B (under UV)
-
Oxidation/Fermentation (O/F) test
O+/F+
Kovac´s oxidase test
-
Rotting of potato tuber slice
-
Reduction of nitrate
-
Utilisation of citrate
+
Growth at 39ºC
-
Gelatine liquefaction
+
Urease
-
Indol
-
Reducing substances from sucrose
+
Acetoin
+
The following tests allow to differentiate E. amylovora from E. pyrifoliae, causal agent of Asian pear blight
on Pyrus pyrifolia, (Kim et al., 1999, Kim et al., 2001) and Erwinia piriflorinigrans, a new species isolated
from necrotic pear blossoms in Spain (Roselló et al., 2002; Roselló et al., 2007), although some
physiological and biochemical characteristics may vary for some strains.
Differences among Erwinia amylovora, Erwinia pyrifoliae and Erwinia piriflorinigrans.
Microbiological tests
Erwinia amylovora
Erwinia pyrifoliae
Erwinia piriflorinigrans
Gelatin hydrolysis
+
-
-
Inositol1
-
ND3
+
Sorbitol1
+
+
-
Aesculin1
V4
-
+
Melibiose1
-
-
+
12
2008_TPDP_27
D-Raffinose1
-
-
+
-Gentibiose1
+
-
+
Amplification with2
EP16A/EPI62C
+
ND3
CPS1/CPS2C
1= From Roselló et al., (2006). Oxidation of substrates in API 50 CH (bioMérieux) with a modified protocol.
2= According to Kim et al. (2001).
3= ND: Not determined
4= V: Variable
4.1.1. Biochemical characterisation by API system (BioMérieux, France)
Biochemical identification of E. amylovora can be obtained by specific profile in API 20 E and API 50 CH
strips.
1) API 20 E. Follow manufacturer’s instructions for preparing the suspension and inoculating the
strip. Incubate at 25-26ºC and read after 24 and 48 h. The readings after 48 h should be as indicated for a
typical E. amylovora culture.
Reaction of E. amylovora in API 20E tests
Test
Reaction (48 h)1
ONPG
Variable
ADH
- (or weak +)
LDC
-
ODC
-
CIT
-
SH2
-
URE
-
TDA
-
IND
-
VP
+ (or variable)
GEL
Variable
GLU
+
MAN
Variable
INO
Variable
SOR
Variable
RHA
-
SAC
+
MEL
- (or weak +)
AMY
-
ARA
+ (some -)
1
= Common reactions of 90 % strains of E. amylovora analysed (Donat et al., unpublished results).
13
2008_TPDP_27
API 50 CH. Prepare a suspension of OD=1.0 in PBS: Add 1 ml of the suspension to 20 ml of Ayers
medium (NH4 H2 PO4 1 g; KCl 0.2 g; Mg SO4 0.2 g; bromothymol blue 0.2%, 75 ml; distilled water 1liter;
pH 7, sterilisation at 120ºC 20 min. Ayers et al., 1919). Follow the manufacturer’s instructions for
inoculation of the strip. Incubate at 25-26ºC in aerobiosis and read after 24 and 48. Utilisation of the different
carbohydrates is observed by a yellow colour in the well.
Test
1
The reading after 72 h should be as indicated for a typical E. amylovora culture:
Reaction
L-arabinose
+
Ribose
+
D-xilose
Variable
Galactose
Variable (mostly +)
D-glucose
+
D-fructose
+
D-manose
Variable
Mannitol
+
Sorbitol
+
N-acetylglucosamine
+
Melibiose
Variable
Sucrose
+
Trehalose
+
ß-gentiobiose
+
1
= The remaining sugars are not utilised by E. amylovora but some strains can utilise glycerol and D-fucose
(Donat et al., unpublished results).
Automated Biolog identification system.
An identification system based on 95 carbon sources utilisation in a microtiter plate is commercially
available (Biolog, CA, USA). Follow the manufacturer’s instructions for automatic identification of E.
amylovora suspected strains.
Fatty acid profiling (FAP)
Grow the levan-positive, non-fluorescent colonies, on commercial trypticase soy agar for 48 hours at 28 ºC.
Apply an appropriate FAP procedure and use the MIDI system (Newark, USA) for identification. A positive
FAP test is achieved if the profile of the presumptive culture is identical to that of the positive control.
4.2. Serological identification
4.2.1. Agglutination test
Suspected E. amylovora colonies levan-positive, non fluorescent in King’s B medium, can be tested for slide
agglutination mixing them in a drop of PBS with a drop of E. amylovora specific antiserum (not diluted or
only at 5 or 10 fold dilution) on a slide. Monoclonal antibodies can be used only provided they agglutinate
with the reference strains.
4.2.2. IF test
Prepare a suspension of approximately 106 cells per ml in PBS from levan-positive, non fluorescent colonies
and apply the IF procedure described.
4.2.3. ELISA tests
14
2008_TPDP_27
Printing ELISA, DASI-ELISA (described) and indirect-ELISA (see below) for isolates identification can be
performed using specific monoclonal antibodies. A mixture of monoclonal antibodies has been validated in
an European ring test.
Prepare a suspension of approximately 108 cells per ml in PBS from suspected colonies. If the DASI-ELISA
procedure described above is used it can be follow without previous enrichment.
4.2.3.1. Indirect-ELISA
1) Use 200 µl aliquots of pure cultures of the suspected isolates (after being treated at 100ºC for 10
min, in a waterbath or heating block, for reducing non-specific reactions). Add an equal volume of carbonate
buffer (Na2CO3 1.59 g; NaHCO3 2.93 g; distilled water 1 liter; adjust pH to 9.6). Apply 200 µl aliquots to at
least 2 wells of a microtitre plate Nunc-Polysorp or equivalent. Use as positive control a 109 cfu/ml heat
treated suspension of a pure culture of E. amylovora and as negative control a similar suspension of another
species. Incubate for 1 hour at 37 ºC or overnight at 4 ºC. Flick out extracts from the wells. Wash the wells
the three times with washing buffer (PBS, pH 7.2-7.4 supplemented with 0.05% Tween 20: NaCl 8 g; KCl
0.2 g; Na2HPO4·12H2O 2.9 g; KH2PO4 0.2 g; Tween 20 500 l; distilled water 1 liter), leaving the last
washing solution in the wells for at least 5 minutes.
2) Prepare the appropriate dilution of anti E. amylovora antibodies using the recommended dilutions
for commercial antibodies. Add 200 µl to each well and incubate for 1 hour at 37 ºC. Flick out the antibody
solution from the wells and wash as before.
3) Prepare the appropriate dilution of secondary antibody-alkaline phosphatase conjugate (GAMAP) in PBS + 0.5% BSA. Add 200 µl to each well and incubated for 1 hour at 37 ºC. Flick out conjugated
antibody from wells and wash as before.
4) Prepare a 1mg/ml alkaline phosphatase substrate (p-nitrophenylphosphate) in substrate buffer
(diethanol amine 97 ml; dilute in 800 ml of distilled water; adjust pH 9.8 with concentrated HCl; adjust at
1000 ml with distilled water). Add 200 µl alkaline phosphatase substrate solution to each well. Incubate in
the dark at room temperature and read at 405 nm at regular intervals within 90 min.
4.3. Molecular identification
4.3.1. PCR
Prepare a suspension of approximately 106 cells per ml in molecular grade sterile water from levan-positive,
non fluorescent colonies. Apply appropriate PCR procedures, following the protocols indicated above
(without DNA extraction).
For identification of pure cultures as E. amylovora other sets of primers can be used: Among them are those
described by Taylor et al. (2001) based on a chromosomal sequence of E. amylovora are adviced:
5’CCTGCATAAATCACCGCTGACAGCTCAATG3’
and
5’GCTACCACTGATCGCTCGAATCAAATCGCC3’.
4.3.2. Macrorestriction and Pulse Field Gel Electrophoresis (PFGE)
PFGE analysis of genomic DNA after Xba I digestion according to Jock et al. (2002) shows 6 patterns for E.
amylovora European strains. The method can provide useful information for strain differentiation and has
been applied to understand the spread of fire blight in Europe.
4.4. Inoculation techniques
Hypersensitive reaction in tobacco leaves can give an indication of the presence of the hrp genes, but is also
positive for many plant pathogenic bacteria. Use tobacco plants of cv. Xanthi or Samsun with more than 5-6
leaves. Prepare bacterial suspensions of 109 cfu/ml (OD at 620 nm =1.0) and inject them into the intracellular
space of the adult leaves with a 25 GA 5/8 0.5 x 16 needle and syringe. Complete collapse of the infiltrated
tissue after 24 h at room temperature is recorded as positive.
Suspected E. amylovora colonies from the isolation and enrichment plates should be inoculated back into the
host from which it was isolated as well as other susceptible hostsin order to demonstrate Koch’s postulates to
verify their pathogenicity. Include always a positive control using a pure culture of a known E. amylovora
strain and a negative control with sterile PBS. Plants inoculated with positive and negative controls should be
15
2008_TPDP_27
kept apart from other test plants, but under the same conditions. Reisolate E. amylovora-like colonies from
the inoculated fruitlets, plants or shoots showing typical E. amylovora symptoms. A range of bacterial
concentrations should be used since artificial inoculation of high inoculum levels can result in false positives.
Inoculation can be performed on whole immature fruits fruitlets (pear, apple or loquat susceptible cultivars) ,
using 10 l of 109 cfu/ml suspensions of the colonies in PBS. Include a positive and negative control as
indicated below. Incubate in humid chamber at 25ºC for 3-5 days. A positive test on fruit is evident by a
oozing of bacteria and browning around the wounding site in approximately 3-7 days, provided that only a
necrotic lesion is observed in the negative control.
For plant inoculation use susceptible cultivars of pear, apple or loquat, or Crataegus, Cotoneaster or
Pyracantha spp. for whole plant inoculation. In potted plants use young shoots for inoculation by cutting a
young leaf through the central veinwith scissors dipped into a 109 cfu/ml suspension of each colony prepared
in PBS (appendix 1). Surface disinfested, detached young shoots (30 sec ethanol 70%; 3 washings with
sterile distilled water) from greenhouse growing plants can also be inoculated in the same way and kept in
tubes with sterile 1% agar. Maintain the plants at 20-25ºC at 80-100 % relative humidity and the tubes at 2025ºC with 16 h. light. Read results after 3, 7 and 15 days. Typical E. amylovora symptoms include epinasty,
wilting, and/or discolouration and/or necrotic tissue and/or ooze.
5. Records
The following records are to be kept:
-
Scientific name of the pest identified.
Code or reference number of the sample (for traceability).
Nature of the infected/infested material including scientific name of host where applicable.
Origin of the infected/infested material, and the chain of possession of the sample between collection
and processing, including conditions under which the sample was held before processing
Description of signs or symptoms (including photographs were relevant).
Methods, including controls, used in the diagnosis and the results obtained with each method.
For morphological methods, measurements, drawings or photographs of the diagnostic features
(where relevant), if applicable the developmental stage.
For biochemical and molecular methods, documentation of test results such as photographs of
diagnostic gels, ELISA printouts of results, on which the diagnosis was based.
Where appropriate, the magnitude of any infection/infestation (how many individual pests found;
how much damaged tissue).
The name of the laboratory and, where appropriate, the name of the person(s) responsible for and/or
who performed the diagnosis.
The retention of culture(s) of the pest, preserved/mounted specimens, or test materials (e.g.
photograph of gels, ELISA plate printout results) is recommended in cases of non-compliance (ISPM No. 13:
Guidelines for the notification of non-compliance and emergency action) and where pests are found for the
first time in a country or new area.
6. CONTACT POINTS FOR FURTHER INFORMATION
1) Bacteriología. Instituto Valenciano de Investigaciones Agrarias (IVIA)
Carretera Moncada-Náquera km 4.5
46113 Moncada (Valencia). Spain.
(Dr. María M. López, [email protected])
2) Tree Fruit Research Laboratory. USDA.
1104 N. Western Av. Wenatchee, WA 98801 USA
(Dr. Rodney Roberts, [email protected])
3) Import Standards Group
Border Standards Directorate
MAF Biosecurity New Zealand
(Dr. Robert Taylor, [email protected])
16
2008_TPDP_27
7. ACKNOWLEDGEMENTS
The first draft of this protocol was written by M. M .López, M.T. Gorris, P. Llop, V. Donat, J. Peñalver, and
M. Cambra. Some techniques described were ring tested in the DIAGPRO project financed by the EU and
the participants in the ring test for evaluating the E. amylovora detection techniques were J. Janse, M. Keek,
A. Sletten, M.A. Cambra, J.L. Palomo, S. Simpkins, T. Teixeira Duarte, F. Poliakoff and van Vaerenbergh.
8. REFERENCES
Anonymous (1998). Council Directive 98/57 EC of 20 July 1998 on the control of Ralstonia solanacearum
(Smith) Yabuuchi et al. Official Journal of the European Communities L235: 1-39.
Ayers SH, Rupp P, Johnson WT (1919). A study of alkali forming in milk. U.S. Dept. Agric. Bull. 782.
Bereswill S, Pahl A, Bellemann P, Zeller W & Geider K (1992). Sensitive and species-specific detection
of Erwinia amylovora by polymerase chain reaction analysis. Appl. Environ. Microbiol. 58: 3522-3526.
Bereswill S, Bugert P, Bruchmuller I, Geider K (1995). Identification of the fire blight pathogen, Erwinia
amylovora by PCR assays with chromosomal DNA. Appl. Environ. Microbiol. 61: 2636-2642.
Bereswill S, Jock S, Aldridge P, Janse JD, Geider K (1997). Molecular characterization of natural Erwinia
amylovora strains deficient in levan synthesis. Physiol. Mol. Plant Pathol. 51: 215-225.
Bonn WG & van der Zwet T (2000). Distribution and economic importance of fire blight. In J. Vanneste:
Fire blight, the disease and its causative agent Erwinia amylovora. CABI Wallingford, UK.
Bradbury JF (1986). Guide to plant pathogenic bacteria. CAB International Mycological Institute, Kew,
Surrey, UK.
Burrill TJ (1883) New species of Micrococcus. Am. Naturalist. 17:319.
Dye DW (1983). Erwinia: The “amylovora” and “herbicola” groups. In P.C. Fahy and GJ Persley ed. Plant
bacterial diseases. A diagnosis guide. Academic Press, Sydney.
EPPO (1992) Quarantine procedure no.40. Erwinia amylovora. Sampling and test methods. Bull. OEPP 22:
225-231.
EPPO/CABI (1997) Erwinia amylovora. In Quarantine Pests for Europe(2nd edn), pp.1001-1007. CAB
International, Wallingford (UK)
EPPO/CABI (1998) Map 257. In Distribution maps of quarantine pests for Europe CAB International,
Wallingford (UK)
Gorris MT, Cambra E, López MM, Paulin JP, Chartier R, Cambra M (1996a). Production and
characterization of monoclonal antibodies specific for Erwinia amylovora and their use in different
serological techniques. Acta Horticulturae 411: 47-51.
Gorris MT, Cambra M, Llop P, López MM, Lecomte P, Chartier R, Paulin JP (1996b) A sensitive and
specific detection of Erwinia amylovora based on the ELISA-DASI enrichment method with monoclonal
antibodies. Acta Horticulturae 411: 41-45
Guilford PJ, Taylor RK, Clark RG, Hale CN, Forster RLS, Bonn WG (1996). PCR-based techniques for the
detection of Erwinia amylovora. Acta Horticulturae. 411: 53-56.
Ishimaru ES, Klos EJ (1984) New medium for detection of Erwinia amylovora and its use in
epidemiological studies. Phytopathology 74: 1342-1345.
Jock S, Donat V, López MM, Bazzi C, Geider K (2002). Following spread of fire blight in Western, Central
and Southern Europe by molecular differentiation of Erwinia amylovora strains with PFGE analysis.
Envir. Microbiol. 4: 106-114.
Jones A, Geider K. (2001). II Gram negative bacteria. B. Erwinia and Pantoea. In: Guide for identification
of plant pathogenic Bacteria, 2nd edition, Schaad NW, Jones JB, Chum W, APS Press, St Paul, USA.
Kim WS, Gardan L, Rhim S.L, Geider K (1999) Erwinia pyrifoliae sp., a novel pathogen that affects Asian
pear trees (Pyrus pyrifolia Nakai) Int. J. Systematic Bact. 49: 899-906.
Kim WS, Jock S, Rhim S-L, Geider K (2001). Molecular detection and differentiation of Erwinia pyrifoliae
and host range analysis of the Asian pear pathogen. Plant Dis. 85: 1183-1188.
King EO, Ward M, Raney DE (1954). Two simple media for the demonstration of pyocyanin and
fluorescein. J. Lab. Clin. Med. 44: 301-307.
Lecomte P, Manceau C, Paulin JP, Keck (1997). Identification by PCR analysis on plasmid pE29 of isolates
of Erwinia amylovora responsible of an outbreak in Central Europe. Eur. J. Plant Path. 103: 91-98.
17
2008_TPDP_27
Llop P, Caruso P, Cubero J, Morente C, Lopez MM (1999) A simple extraction procedure for efficient
routine detection of pathogenic bacteria in plant material by polymerase chain reaction. J. Microbiol.
Meth. 37: 23-31.
Llop P, Bonaterra A, Peñalver J, Lopez MM (2000) Development of a highly sensitive nested-PCR
procedure using a single closed tube for detection of Erwinia amylovora in asymptomatic plant material.
Appl. Environ. Microbiol. 66: 2071-2078.
Llop P, Donat V, Rodríguez M, Cabrefiga J, Ruz L, Palomo JL, Montesinos E, López MM (2006). An
indigenous virulent strain of Erwinia amylovora lacking the ubiquitous plasmid pEA29. Phytopathology
96: 900-907.
Maes M, Garbeva P, Crepel C (1996). Identification and sensitive endophytic detection of the fire blight
pathogen Erwinia amylovora with 235 ribosomal DNA sequences and the polymerase chain reaction.
Plant Pathol. 45: 1139-1149.
Mc Manus PS, Jones AL (1995). Detection of Erwinia amylovora by nested. PCR and PCR-dot-blot and
reverse blot hybridisations. Phytopathology 85: 618-623.
Ordax M, Marco-Noales E, López MM, Biosca EG (2006). A survival strategy of Erwinia amylovora against
copper: induction of the viable but non culturable state. Applied and Environmental Microbiology
72:3482-3488.
Paulin JP (2000) Erwinia amylovora: general characteristics, biochemistry and serology, in J. Vanneste: Fire
blight, the disease and its causative agent, Erwinia amylovora. CABI, Wallingford, UK.
Powney R, Plummer K, Beer S, Rodoni B (2007). Evaluation of PCR-based protocols for the detection of
Erwinia amylovora. 11th International Workshop on Fire Blight, Portland, Oregon, 107.
Roselló M, García-Vidal S, Tarín A, Llop P, Gorris M.T, Donat V, Peñalver J, Chartier, R, Paulin JP, Gardan
L, López MM (2002). Characterization of an Erwinia sp. isolated from necrotic pear blossoms in
Valencia, Spain. Acta Horticulturae 590: 139-142.
Roselló M, Peñalver J, Llop P, Gorris MT, Charter R, Cambra M, López MM (2006) Identification of an
Erwinia sp., different from Erwinia amylovora which is responsible for necrosis on pear blossoms. Can J
Plant Pathol 28: 1-12.
Roselló M, Christen R, Llop P, Ferrer S, Garden L, López MM (2007). Description of Erwinia
piriflorinigrans sp. nov. that causes necrosis of pear blossoms. 11th International Workshop on Fire
Blight, Portland, Oregon, 24.
Salm H, Geider K (2004). Real-time PCR for detection and quantification of Erwinia amylovora, the causal
agent of fireblight. Plant pathology,53: 602-610.
Sasser M (1990) Identification of bacteria through fatty acid analysis. In: Klement F, Rudolf K, Sands DC
(eds), Methods in Phytobacteriology, 199-204. Akademiai Kiado, Budapest.
Starr MP, Cardona C, Folsom D (1951). Bacterial fire blight of raspberry. Phytopathology 41: 9515-59.
Tanii A, Tamura O, Ozaki M (1981).The causal agent of a fire blight-like disease. Annals of
Phytopathological Society of Japan 47:102.
Taylor, R.K., Guilford, P.J., Clark, R.G., Hale, C.N. and Forster (2001) Detection of Erwinia amylovora in
plant material using novel polymerase chain reaction (PCR) primers. New Zealand Journal of Crop and
Horticultural Science 29: 35-43.
Thomson SV (2000). Epidemiology of fire blight. In J. Vanneste: Fire blight, the disease and its causative
agent Erwinia amylovora. CABI, Wallingford, UK.
van der Zwet (2002). Present world wide distribution of fire blight. Acta Horticulturae 590: 33-34.
van der Zwet T, Keil HL (1979) Fire blight: A bacterial disease of rosaceous plants. United States
Department Agriculture Handbook 510, Washington DC, USA.
van der Zwet T, Beer S (1995). Fire blight –its nature, prevention and control. A practical guide to integrated
disease management, USDA. Agricultural Information Bulletin No. 631, Washington DC, USA.
18