• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
3 - Dr. Jerry Cronin
3 - Dr. Jerry Cronin

... 2 Once attached to the ER, the SRP is released and the growing polypeptide snakes through the ER membrane pore into the cisterna. 3 The signal sequence is clipped off by an enzyme. As protein synthesis continues, sugar groups may be added to the protein. ...
Cells Part C PPT
Cells Part C PPT

DNA and Genes - Buckeye Valley
DNA and Genes - Buckeye Valley

LNA-PNA Comparison4
LNA-PNA Comparison4

... great potential in the growing area of Single Molecule Genomics PNA may be used in many of the applications where PNA become a versatile tool in genetic diagnostics and a variety of molecular biology techniques such as PCR clamping, plasmid vector tagging and nucleic acid solution phase hybridizatio ...
msc_botnay_pre_pap1_bl2
msc_botnay_pre_pap1_bl2

... Methylation also occurs on arginine and histidine. Similarly, phosphorylation occurs on the hydroxyl group of serine and histidine. Methylation and acetylation remove the positive charge on NH3+, while phosphorylation introduces a negative charge in the form of phosphate group. 3.6 DNA STRUCTURE THE ...
A defense-offense multi-layered regulatory switch in a pathogenic
A defense-offense multi-layered regulatory switch in a pathogenic

... At this stage complexes are formed first between the mRNAs of gene 1 and the sRNA, and later between the mRNAs of gene 2 and the sRNA (C). At the transition to OFF step (at t = 20 h) the sRNA level decreases (A), as well as the level of its complexes (C). At this stage the TF level increases (A), le ...
Molecular Determinants of Alphavirus Neurovirulence: Nucleotide
Molecular Determinants of Alphavirus Neurovirulence: Nucleotide

... D N A complementary to the 26S region of viral 42S RNA was prepared for cloning into pUC18 by priming at the T-end of the genome, as previously described (Kinney et al., 1986). Restriction fragments of the cloned cDNA, designated pTC-5, were subcloned into M 13 phages mpl0 and mpl 1. The entire sequ ...
Chapter 3d
Chapter 3d

... 2 Once attached to the ER, the SRP is released and the growing polypeptide snakes through the ER membrane pore into the cisterna. 3 The signal sequence is clipped off by an enzyme. As protein synthesis continues, sugar groups may be added to the protein. ...
Algorithm to extract REP sequences Pattern
Algorithm to extract REP sequences Pattern

... GACACGGAAGTGACCCCCGTCGCTCCGCCCTCTCCCACTC TGGCCTAAGCTTTAACAGGCTTCGCCTGTGCTTCCTGTTT ACCCTACGCCCGACTTGTGCGCCCGGGAAACCCCGTCGTT GGTCTGGGCGTCCCGGCTGGGCCCCGTGTCTGTGCGCACG GGGAGGGTATATAAGCGTTGGCGGACGGTCGGTTGTAGCA CCGCGGGCTATATAAAACCTGAGCAGAGGGACAAGCGGCC TCAGCGTTCTATAAAGCGGCCCTCCTGGAGCCAGCCACCC CGCGGCGGCGCCC ...
Presentation: Computation to Solve Problems
Presentation: Computation to Solve Problems

SGD sample annotations
SGD sample annotations

... annotation to “NOT RNA-3’-phosphate cyclase activity” with the evidence code NAS. While the authors mention the use of a direct assay, it is only in passing in the Discussion section and no experiment is shown. Thus, we have used the evidence code NAS, to indicate that this annotation is based on a ...
Transcript Fold Change - University of Saskatchewan
Transcript Fold Change - University of Saskatchewan

... Open format nucleic acid sequencing technology, such as Illumina’s RNAseq, afford the opportunity to perform large-scale analysis of gene expression in species for which there is little or no sequence information. The fathead minnow (Pimephales promelas) is a popular small fish model. Several cDNA m ...
Virp1 Is a Host Protein with a Major Role in Potato - IMBB
Virp1 Is a Host Protein with a Major Role in Potato - IMBB

... Viroids are small, circular, single-stranded RNA molecules that, while not coding for any protein, cause several plant diseases. Viroids rely for their infectious cycle on host proteins, most of which are likely to be involved in endogenous RNA-mediated phenomena. Therefore, characterization of host ...
Characterization of two rice DNA methyltransferases
Characterization of two rice DNA methyltransferases

... by transcriptional machinery. The discovery of several methyl binding domain (MBD)containing proteins (such as MeCP1, MeCP2, MBD1, MBD2, MBD3 and MBD4), that interact with DNA MTases and are capable of recruiting repressive complexes and histone deacetylases, suggests the existence of additional mec ...
A Fruit-Specific Putative Dihydroflavonol 4
A Fruit-Specific Putative Dihydroflavonol 4

... Achenes from two sets of G2-stage strawberry fruits were carefully removed in the growing plant using the tip of a scalpel blade. One set of de-achened fruits was treated with the synthetic auxin NAA in a lanolin paste at 1 mm NAA in 1% (v/v) DMSO. The other set (the control group) was treated with ...
Nanotechnology for the Delivery of Therapeutic Nucleic Acids
Nanotechnology for the Delivery of Therapeutic Nucleic Acids

... suggested that nucleic acids (NA) could be used to block gene function by virtue of Watson–Crick base pairing. Since the discovery of RNAi in 1998 by Andrew Fire and Craig Melo and soon after the discovery that RNAi is found in mammals in 2001 by Thomas Tuschl’s group, synthetic small RNAs were show ...
Diplosporous development in Boehmeria tricuspis: Insights
Diplosporous development in Boehmeria tricuspis: Insights

... processes (98,330), cellular processes (97,189), and single-organism processes (77,792) in the biological process category, and cells (53,137), cell parts (53,088), and organelles (34,918) in the cellular component category. Under molecular functions, binding (89,384) was most abundant, followed by ...
Antisense Transcript and RNA Processing
Antisense Transcript and RNA Processing

... was required for viability but could not produce stable atpB transcripts. Based on strand-specific RT-PCR, S1 nuclease protection, and RNA gel blots, evidence was obtained that the PSþ genome stabilizes atpB mRNA by generating an atpB antisense transcript, which attenuates the degradation of the pol ...
MAST CELL DISEASE & Ig E
MAST CELL DISEASE & Ig E

... TNF-α blockade on lipid patterns are still unclear.  The mechanisms of action of such treatment have not been fully explored. ...
High-Throughput Neurotechnology
High-Throughput Neurotechnology

... Fig. 4. Schematic of zebrafish manipulation and imaging platform. Larvae are automatically loaded to the system from either reservoirs or multiwell plates. Reservoirs are connected to the system via fluidic valves and a bubble mixer prevents the larvae from settling. The multiwell plate is located o ...
Section 3: Prokaryotic Sample and Array Processing
Section 3: Prokaryotic Sample and Array Processing

... As starting material for the cDNA synthesis procedure, total RNA can be isolated by using standard procedures for bacterial RNA isolation or various commercial RNA isolation kits. For Pseudomonas aeruginosa and E. coli, we have successfully used the QIAGEN® RNeasy Mini Purification Kit. Caution shou ...
Robust gene silencing mediated by antisense small RNAs in the
Robust gene silencing mediated by antisense small RNAs in the

... technologies. Additionally, these data shed mechanistic insights into a eukaryotic RNA interference pathway with many novel aspects. INTRODUCTION RNA interference (RNAi) pathways regulate gene expression in diverse systems ranging from protozoans to humans and can function at the transcriptional or ...
Epigenetic inheritance of acquired traits through sperm RNAs and
Epigenetic inheritance of acquired traits through sperm RNAs and

... is transferred to the other. The transvection phenomenon in mice was first noticed during transgene manipulation38–40. In these cases, induced DNA methylation on one allele (triggered by transgene manipulations at this allele) was transferred to the other allele, the genotype of which remained wild ...
FISH or CISH methods for In situ hybridization
FISH or CISH methods for In situ hybridization

Text Book of Molecular Biology
Text Book of Molecular Biology

< 1 ... 14 15 16 17 18 19 20 21 22 ... 225 >

RNA silencing

RNA silencing (associated with the concept of post-transcriptional gene silencing or RNA interference) refers to a family of gene silencing effects by which the expression of one or more genes is downregulated or entirely suppressed by non-coding RNAs, particularly small RNAs. It may also refer to the introduction of a synthetic antisense RNA molecule used in scientific experiments on gene expression. RNA silencing may also be defined as sequence-specific regulation of gene expression triggered by double-stranded RNA (dsRNA). RNA silencing mechanisms are highly conserved in most eukaryotes. The most common and well-studied example is RNA interference (RNAi), in which endogenously expressed microRNA (miRNA) or exogenously derived small interfering RNA (siRNA) induces the degradation of complementary messenger RNA. Other classes of small RNA have been identified, including piwi-interacting RNA (piRNA) and its subspecies repeat associated small interfering RNA (rasiRNA).
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report