![Poster](http://s1.studyres.com/store/data/008830648_1-de9a32c2f078668613f24194fd22b56e-300x300.png)
Poster
... Cleavage of SNAP-25 inhibits fusion of synaptic vesicles to the plasma membrane to inhibit acetylcholine release and muscle contraction, leading to flaccid paralysis. ...
... Cleavage of SNAP-25 inhibits fusion of synaptic vesicles to the plasma membrane to inhibit acetylcholine release and muscle contraction, leading to flaccid paralysis. ...
Synergy of Peptide and Sugar in O
... for two of the peptides, this conformation appears to be stabilized by intramolecular hydrogen bonds (Figure 1C). The hOGAderived glycopeptide forms a hydrogen bond between the histidine in the 1 subsite and the backbone carbonyl oxygen of the O-GlcNAc serine (Figure 1C). For the p53-derived glycop ...
... for two of the peptides, this conformation appears to be stabilized by intramolecular hydrogen bonds (Figure 1C). The hOGAderived glycopeptide forms a hydrogen bond between the histidine in the 1 subsite and the backbone carbonyl oxygen of the O-GlcNAc serine (Figure 1C). For the p53-derived glycop ...
Repeat motifs of tau bind to the insides of microtubules in the
... a-tubulin equivalent to the taxol-binding pocket in b-tubulin. We propose that loops in bound tau stabilize microtubules in a similar way to taxol, although with lower af®nity so that assembly is ...
... a-tubulin equivalent to the taxol-binding pocket in b-tubulin. We propose that loops in bound tau stabilize microtubules in a similar way to taxol, although with lower af®nity so that assembly is ...
Dictyostelium discoideum mutant synag 7 with altered G
... Culture conditions and membrane isolation The synag 7 mutant of wild-type D. discoideum NC-4 has been characterized by Dr Frantz (1980) and was kindly provided by Dr P. N. Devreotes. Wild-type and mutant cells were grown as described (Van Haastert & Van der Heijden, 1983), harvested in 10mM-Na/K pho ...
... Culture conditions and membrane isolation The synag 7 mutant of wild-type D. discoideum NC-4 has been characterized by Dr Frantz (1980) and was kindly provided by Dr P. N. Devreotes. Wild-type and mutant cells were grown as described (Van Haastert & Van der Heijden, 1983), harvested in 10mM-Na/K pho ...
Cyclophilin
... subsequently approved for use in 1983. Since then, it has been used to prevent and treat graft-versus-host reactions in bone-marrow transplantation and to prevent rejection of kidney, heart, and liver transplants. And it raised the survival rate from 50% to 70% after internal organ transplants. Bore ...
... subsequently approved for use in 1983. Since then, it has been used to prevent and treat graft-versus-host reactions in bone-marrow transplantation and to prevent rejection of kidney, heart, and liver transplants. And it raised the survival rate from 50% to 70% after internal organ transplants. Bore ...
Three-Dimensional Structure of ATP: Corrinoid Adenosyltransferase
... ABSTRACT: In Salmonella typhimurium, formation of the cobalt-carbon bond in the biosynthetic pathway for adenosylcobalamin is catalyzed by the product of the cobA gene which encodes a protein of 196 amino acid residues. This enzyme is an ATP:co(I)rrinoid adenosyltransferase which transfers an adenos ...
... ABSTRACT: In Salmonella typhimurium, formation of the cobalt-carbon bond in the biosynthetic pathway for adenosylcobalamin is catalyzed by the product of the cobA gene which encodes a protein of 196 amino acid residues. This enzyme is an ATP:co(I)rrinoid adenosyltransferase which transfers an adenos ...
Leukaemia Section t(4;17)(q12;q21) Atlas of Genetics and Cytogenetics in Oncology and Haematology
... amino-terminal amino acids of FIP1L, including the FIP homology domain and 403 carboxyl-terminal amino acids of RARA, including the DNA and ligand binding domains, with replacement of FIP1L1 amino acid 429 (Valine) and RARA amino acid 60 (Threonine) into an Alanine. Oncogenesis All known chimeric RA ...
... amino-terminal amino acids of FIP1L, including the FIP homology domain and 403 carboxyl-terminal amino acids of RARA, including the DNA and ligand binding domains, with replacement of FIP1L1 amino acid 429 (Valine) and RARA amino acid 60 (Threonine) into an Alanine. Oncogenesis All known chimeric RA ...
Diiffusional correlations among multiple active sites in a single enzyme
... modification of the model where the enzyme–substrate interactions are removed, while still retaining binding interactions with the active site beads. The plots of g R(r) and g P(r) for this case are given in Fig. 5 and the lack of structure is evident. For this model the substrate molecules can free ...
... modification of the model where the enzyme–substrate interactions are removed, while still retaining binding interactions with the active site beads. The plots of g R(r) and g P(r) for this case are given in Fig. 5 and the lack of structure is evident. For this model the substrate molecules can free ...
The Citrate Carrier CitS Probed by Single
... To obtain fluorophore-conjugated CitS, 5 ml of Alexa Fluor 546 C5 maleimide (AF546, Molecular Probes, Leiden, The Netherlands) stock solution (800 mM) in 50 mM potassium phosphate buffer (pH 7.0) were added to 100 ml of purified and concentrated CitS-sC398 or CitS-sC414 (40 mM) and incubated in a ther ...
... To obtain fluorophore-conjugated CitS, 5 ml of Alexa Fluor 546 C5 maleimide (AF546, Molecular Probes, Leiden, The Netherlands) stock solution (800 mM) in 50 mM potassium phosphate buffer (pH 7.0) were added to 100 ml of purified and concentrated CitS-sC398 or CitS-sC414 (40 mM) and incubated in a ther ...
Identification and characterization of phage displayed, SC
... Cells and cellular effector mechanisms of the innate immune system The innate immune response lacks specificity, it is rapid and is considered to be the first line of defence. Immune responses depend largely upon the activities of white blood cells, or leukocytes. All leukocytes derive ultimately fr ...
... Cells and cellular effector mechanisms of the innate immune system The innate immune response lacks specificity, it is rapid and is considered to be the first line of defence. Immune responses depend largely upon the activities of white blood cells, or leukocytes. All leukocytes derive ultimately fr ...
NICKEL(II) PINCER COMPLEXES SUPPORTED BY 2,6
... class of dianionic, tridentate, nitrogen-based ligands in coordination chemistry, was prepared starting with a modified method for the synthesis of pyrrolyl pyridine. This modified procedure is simpler, less time consuming making it cheaper than the classical method and provides 2,6-bis(3,5-ditolyl- ...
... class of dianionic, tridentate, nitrogen-based ligands in coordination chemistry, was prepared starting with a modified method for the synthesis of pyrrolyl pyridine. This modified procedure is simpler, less time consuming making it cheaper than the classical method and provides 2,6-bis(3,5-ditolyl- ...
"A Reexamination of the Nucleotide Incorporation Fidelity of DNA
... step) which directly dictates catalytic efficiency as well as fidelity. The latter results from the free energy difference between the highest-energy transition states of the two competing reactions. Thus, the substrate-induced conformational change (or any other step) is not directly responsible fo ...
... step) which directly dictates catalytic efficiency as well as fidelity. The latter results from the free energy difference between the highest-energy transition states of the two competing reactions. Thus, the substrate-induced conformational change (or any other step) is not directly responsible fo ...
The UUAG-specific RNA Binding Protein, Heterogeneous Nuclear
... common groups of RNA binding proteins is the RBD class proteins (2). They possess a CS-RBD (consensus sequence-RNA binding domain) motif, which is typically 80 –90 amino acids. Two short sequences, RNP 2 octamer and RNP 1 hexamer, have been found to be conserved among different RBDs. Several RBDs ar ...
... common groups of RNA binding proteins is the RBD class proteins (2). They possess a CS-RBD (consensus sequence-RNA binding domain) motif, which is typically 80 –90 amino acids. Two short sequences, RNP 2 octamer and RNP 1 hexamer, have been found to be conserved among different RBDs. Several RBDs ar ...
Both PS 7 and PS 8 are due next Thursday
... • Hanes-Woolf – Preferred because there isn’t an overemphasis of the data obtained at low [S] Deviation from the linear plot implies allostery (regulation) ...
... • Hanes-Woolf – Preferred because there isn’t an overemphasis of the data obtained at low [S] Deviation from the linear plot implies allostery (regulation) ...
Photogeneration of Hydride Donors and Their Use Toward CO2
... This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, nor any of their contractors, subcontractors, or their employees, makes any warranty, express or implied, or ...
... This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, nor any of their contractors, subcontractors, or their employees, makes any warranty, express or implied, or ...
THE ESTIMATION OF PEPSIN WITH HEMOGLOBIN A number of
... because it can be stored in solution for a long time without change, because it is rapidly digested, and because the rate at which it is digested by a given pepsin solution does not vary from one hemoglobin preparation to another. Not only is hemoglobin a reproducible protein which can be brought to ...
... because it can be stored in solution for a long time without change, because it is rapidly digested, and because the rate at which it is digested by a given pepsin solution does not vary from one hemoglobin preparation to another. Not only is hemoglobin a reproducible protein which can be brought to ...
Sarcomeric Protein Mutations in Dilated Cardiomyopathy DCM
... regulatory and essential light chains form the complete myosin molecule. • The structure of myosin is comprised of head, neck, and tail regions. • The myosin head, also known as myosin subfragment 1 (S1), functions as the catalytic portion of the myosin structure. • The essential and regulatory ligh ...
... regulatory and essential light chains form the complete myosin molecule. • The structure of myosin is comprised of head, neck, and tail regions. • The myosin head, also known as myosin subfragment 1 (S1), functions as the catalytic portion of the myosin structure. • The essential and regulatory ligh ...
Studies on the structure and function of 16S ribosomal RNA using
... positions 109 and 279, where many residues remain unreactive even at 90°C in EDTAcontaining buffer. This region may correspond to a structural 'core' that is important for early events in ribosome assembly (Garrett et al., 1973). Probing the active-inactive transition in 50S ribosomal subunits Zamir ...
... positions 109 and 279, where many residues remain unreactive even at 90°C in EDTAcontaining buffer. This region may correspond to a structural 'core' that is important for early events in ribosome assembly (Garrett et al., 1973). Probing the active-inactive transition in 50S ribosomal subunits Zamir ...
Prediction of Enzyme Class by Using {\itshape Reactive Motifs}
... motifs together with known Enzyme Sequence Dataset (train data set). The efficiency of our prediction model is compared with the one of PROSITE, the original pattern subscribed by mutation control to create reactive motif automatically. Concerning data preparation for phase II, the motifs and enzyme ...
... motifs together with known Enzyme Sequence Dataset (train data set). The efficiency of our prediction model is compared with the one of PROSITE, the original pattern subscribed by mutation control to create reactive motif automatically. Concerning data preparation for phase II, the motifs and enzyme ...
Brown, V, Small, K, Lakkis, L, Feng, Y, Gunter, C, Wilkinson, KD and Warren, ST: Purified recombinant Fmrp exhibits selective RNA-binding as an intrinsic property of the fragile X mental retardation protein. Journal of Biological Chemistry 273:15521-15527 (1998).
... Fmrp Constructs—The baculoviral constructs used in wild type Fmrp production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the ...
... Fmrp Constructs—The baculoviral constructs used in wild type Fmrp production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the ...
Ribosome-targeting antibiotics and mechanisms of bacterial
... Ribosomes are the protein-synthesizing factories of the cell. These large macromolecular machines provide the platform on which amino acids are polymerized in a template-dependent fashion to form polypeptide chains1. Given the fundamental nature of protein synthesis, it is not surprising that this p ...
... Ribosomes are the protein-synthesizing factories of the cell. These large macromolecular machines provide the platform on which amino acids are polymerized in a template-dependent fashion to form polypeptide chains1. Given the fundamental nature of protein synthesis, it is not surprising that this p ...
Inquiry into Life Twelfth Edition
... • The off-regulation is done by the lac repressor – Product of the lacI gene – Tetramer of 4 identical polypeptides – Binds the operator just right of promoter ...
... • The off-regulation is done by the lac repressor – Product of the lacI gene – Tetramer of 4 identical polypeptides – Binds the operator just right of promoter ...
THE MECHANISMS OF SELECTIVITY AND ACTION OF PROTEIN
... of the unbound inhibitor (by gel filtration, centrifugation, flltration or any other possible method) before the reconstitution experiments; (d) effects of antibiotics on a function specifically associated with a ribosome subunit which can be studied in the absence of the other subunit; and (e) it c ...
... of the unbound inhibitor (by gel filtration, centrifugation, flltration or any other possible method) before the reconstitution experiments; (d) effects of antibiotics on a function specifically associated with a ribosome subunit which can be studied in the absence of the other subunit; and (e) it c ...
Exploring the Structure and Function of Cytochrome bo3 Ubiquinol
... cytochrome c oxidase from P. denitrificans. These two proton transfer pathways, called the Dand K-channels, are also observed in subunit I of cytochrome bo3 ubiquinol oxidase (Fig. 6A and B). Both these channels contain amino acid residues that are highly conserved in cytochrome c oxidases and ubiqu ...
... cytochrome c oxidase from P. denitrificans. These two proton transfer pathways, called the Dand K-channels, are also observed in subunit I of cytochrome bo3 ubiquinol oxidase (Fig. 6A and B). Both these channels contain amino acid residues that are highly conserved in cytochrome c oxidases and ubiqu ...
Translation - e
... The sedimentation coefficient s of a particle is used to characterize its behaviour in sedimentation processes, notably centrifugation. It is defined as the ratio of a particle's sedimentation velocity to the acceleration that is applied to it. The sedimentation speed υt (in ms−1) is also known as t ...
... The sedimentation coefficient s of a particle is used to characterize its behaviour in sedimentation processes, notably centrifugation. It is defined as the ratio of a particle's sedimentation velocity to the acceleration that is applied to it. The sedimentation speed υt (in ms−1) is also known as t ...
Cooperative binding
![](https://commons.wikimedia.org/wiki/Special:FilePath/Bohr_effect.png?width=300)
Molecular binding is an interaction between molecules that results in a stable physical association between those molecules. Cooperative binding occurs in binding systems that are constituted by more than one type (species) of molecule (say molecules A and B) and in which one of the partners is not mono-valent; i.e., it binds more than one molecule of the other molecular species. For example, one molecule of type A can bind 6 molecules of type B (in such cases, B is usually referred to as the ""ligand""). Binding in this type of system can be considered ""cooperative"" if the binding of B to one site on A is affected by the binding of B to other site(s) on A. In other words, the binding of B molecules to the different sites on A do not constitute mutually independent events. This can be due, for instance, to an affinity for the ligand that depends on the amount of ligand bound. Cooperativity can be positive or negative. Cooperative binding is observed in many biopolymers, including proteins and nucleic acids. Cooperative binding has been shown to be the mechanism underlying a large range of biochemical and physiological processes.