Gene Regulation Prokaryoperon_RD_MP
... • Structural genes- genes that are related and used in a biochemical pathway. • Promoter-The nucleotide sequence that can bind with RNA polymerase to start transcription. This sequence also contains the operator region. • Operator-The nucleotide sequence that can bind with repressor protein to inhib ...
... • Structural genes- genes that are related and used in a biochemical pathway. • Promoter-The nucleotide sequence that can bind with RNA polymerase to start transcription. This sequence also contains the operator region. • Operator-The nucleotide sequence that can bind with repressor protein to inhib ...
Rich Probabilistic Models for Genomic Data
... Find parameter estimates which make observed data most likely General approach, as long as tractable likelihood function exists Can use all available information ...
... Find parameter estimates which make observed data most likely General approach, as long as tractable likelihood function exists Can use all available information ...
BCH 501- Introduction to Biochemistry Y1 BDN Final Exam S2 2015
... 1. Cell membrane is composed of lipid bilayer which has proteins floating in it. (True / False)? 2. Peptide bond can be broken down by hydrolysis. (True / False)? 3. The side chain of an amino acid is responsible for its unique characteristics.(True / False)? 4. When two monosaccharaides are joined ...
... 1. Cell membrane is composed of lipid bilayer which has proteins floating in it. (True / False)? 2. Peptide bond can be broken down by hydrolysis. (True / False)? 3. The side chain of an amino acid is responsible for its unique characteristics.(True / False)? 4. When two monosaccharaides are joined ...
Lesson12 sp2012
... zebra fish, amino acids from mice. The proteins made in vitro should be the same proteins found in the cells of.. a. coral ...
... zebra fish, amino acids from mice. The proteins made in vitro should be the same proteins found in the cells of.. a. coral ...
ppt - Chair of Computational Biology
... obtained in the experimental yeast two-hybrid system. The diameter of the black circles is proportional to the interaction index; true pairs are highlighted with gray squares. Empty spaces correspond to those cases in which the i2h system could not be applied, because they contained <11 sequences fr ...
... obtained in the experimental yeast two-hybrid system. The diameter of the black circles is proportional to the interaction index; true pairs are highlighted with gray squares. Empty spaces correspond to those cases in which the i2h system could not be applied, because they contained <11 sequences fr ...
CRONOS: the cross-reference navigation server
... In order to detect gene and protein names which are assigned to products of different genes and thus result in erroneous cross-references, dedicated lists are created for each organism separately. Organism-specific lists are necessary, since terms that are ambiguous in one organism might be explicit ...
... In order to detect gene and protein names which are assigned to products of different genes and thus result in erroneous cross-references, dedicated lists are created for each organism separately. Organism-specific lists are necessary, since terms that are ambiguous in one organism might be explicit ...
Protein Structure and Function
... -Domain is a structural and functional unit composed of generally continuous amino acids (50~200 a.a.) -Domains have hydrophobic cores ...
... -Domain is a structural and functional unit composed of generally continuous amino acids (50~200 a.a.) -Domains have hydrophobic cores ...
3 | Amino Acids, Peptides, Proteins
... – MALDI MS and ESI MS can precisely identify the mass of a peptide, and thus the amino acid sequence – Can be used to determine post‐translational modifications ...
... – MALDI MS and ESI MS can precisely identify the mass of a peptide, and thus the amino acid sequence – Can be used to determine post‐translational modifications ...
Protein-protein interaction and pathway databases, a graphical review
... the DNA encoding the "target" protein (the protein whose possible partners we wish to identify) is inserted to amating type cell . In a second yeast cells, α-mating type cells, a plasmid with the DNA encoding the activation domain of the transcription factor coupled to the DNA encoding a possible pa ...
... the DNA encoding the "target" protein (the protein whose possible partners we wish to identify) is inserted to amating type cell . In a second yeast cells, α-mating type cells, a plasmid with the DNA encoding the activation domain of the transcription factor coupled to the DNA encoding a possible pa ...
Review Article
... Soluble proteins of the ER in animal cells share a common C-terminal tetrapeptide sequence, usually LysAsp-Glu-Leu (KDEL) that is essential for retention in the ER (Munro & Pelham, 1987). Variations on the KDEL theme are found in different organisms but the principles for function are no doubt very ...
... Soluble proteins of the ER in animal cells share a common C-terminal tetrapeptide sequence, usually LysAsp-Glu-Leu (KDEL) that is essential for retention in the ER (Munro & Pelham, 1987). Variations on the KDEL theme are found in different organisms but the principles for function are no doubt very ...
Go ontology
... external to GO (‘translation tables’) o Proteins then electronically annotated with the relevant GO term(s) ...
... external to GO (‘translation tables’) o Proteins then electronically annotated with the relevant GO term(s) ...
Document
... into membranes can subsequently assemble into the native structure of BR. This indicates that the insertion steps are independent of the intra-membrane assembly process. They refer to this insertion-oligomerization process as the 'two-stage' model. ...
... into membranes can subsequently assemble into the native structure of BR. This indicates that the insertion steps are independent of the intra-membrane assembly process. They refer to this insertion-oligomerization process as the 'two-stage' model. ...
Design Principles in Biology:
... About the mutational process Point mutations: • Transitions (A↔G, C↔T) are more frequent than transversions (all other substitutions) • In mammals, the CpG dinucleotide is frequently mutated to TG or CA (possibly related to the fact that most CpG dinucleotides are methylated at the C-residues) • Mi ...
... About the mutational process Point mutations: • Transitions (A↔G, C↔T) are more frequent than transversions (all other substitutions) • In mammals, the CpG dinucleotide is frequently mutated to TG or CA (possibly related to the fact that most CpG dinucleotides are methylated at the C-residues) • Mi ...
Methods - BioMed Central
... The first constraint for the identification of a “tight” set of marker-genes is that each gene’s CER must be - at least - Seq % identical with exactly one CER from every other gene. The first prerequisite is not so crucial and typically for the datasets we used Seq was 40% - 60%. The second constrai ...
... The first constraint for the identification of a “tight” set of marker-genes is that each gene’s CER must be - at least - Seq % identical with exactly one CER from every other gene. The first prerequisite is not so crucial and typically for the datasets we used Seq was 40% - 60%. The second constrai ...
a pdf of this article as it appeared in Projects in Scientific
... nuclear pore complex. Hundreds to thousands of NPCs are embedded in the nuclear envelope of each cell, a double membrane that houses and protects the organism’s genetic information. The NPC’s ability to pick and choose which large proteins pass is crucial, protecting the nuclear DNA and, at the same ...
... nuclear pore complex. Hundreds to thousands of NPCs are embedded in the nuclear envelope of each cell, a double membrane that houses and protects the organism’s genetic information. The NPC’s ability to pick and choose which large proteins pass is crucial, protecting the nuclear DNA and, at the same ...
Gene Section USP7 (ubiquitin specific peptidase 7 (herpes virus- associated))
... found in thymus, spleen and brain, organs which rely on apoptosis for development. A similar observation was not observed in caspase 3-deficient thymocytes or thymocytes treated with general caspase inhibitors indicating caspase involvement in the process of apoptosis. ...
... found in thymus, spleen and brain, organs which rely on apoptosis for development. A similar observation was not observed in caspase 3-deficient thymocytes or thymocytes treated with general caspase inhibitors indicating caspase involvement in the process of apoptosis. ...
Variations in Surface Protein Composition Associated
... Some caution is necessary in comparisons between the variants of N . gonorrhoeae P9 since acquisition of a new outer membrane protein may result in a concomitant decrease in one previously present (Heckels, 1978) and perhaps other as yet unknown alterations in membrane composition. Nevertheless, dif ...
... Some caution is necessary in comparisons between the variants of N . gonorrhoeae P9 since acquisition of a new outer membrane protein may result in a concomitant decrease in one previously present (Heckels, 1978) and perhaps other as yet unknown alterations in membrane composition. Nevertheless, dif ...
Carbohydrates - Home - KSU Faculty Member websites
... Many proteins secreted by cells have attached N-linked oligosaccharide chains. Genetic diseases have been attributed to deficiency of particular enzymes involved in synthesizing or modifying oligosaccharide chains of these glycoproteins. Such diseases, and gene knockout studies in mice, have been u ...
... Many proteins secreted by cells have attached N-linked oligosaccharide chains. Genetic diseases have been attributed to deficiency of particular enzymes involved in synthesizing or modifying oligosaccharide chains of these glycoproteins. Such diseases, and gene knockout studies in mice, have been u ...
Polymorphism and Protein Evolution
... may differ in this respect, though there is as yet little evidence one way or another on this point. Also of course only a very small number of different enzymes and proteins have been investigated compared with the many thousands that actually occur in an organism. So the estimates of the fraction ...
... may differ in this respect, though there is as yet little evidence one way or another on this point. Also of course only a very small number of different enzymes and proteins have been investigated compared with the many thousands that actually occur in an organism. So the estimates of the fraction ...
International Biomarker Discovery Consortium
... Project. The Chinese human liver proteome project (HLPP) is at the pilot stage with 10% of the HLPP in the antibody bank. The aim is to have antibodies against 5000 liver proteins at year 2010 and to generate a HPLL database. The general approach is to use fractionated liver proteins, recombinant pr ...
... Project. The Chinese human liver proteome project (HLPP) is at the pilot stage with 10% of the HLPP in the antibody bank. The aim is to have antibodies against 5000 liver proteins at year 2010 and to generate a HPLL database. The general approach is to use fractionated liver proteins, recombinant pr ...
1 - Nature
... RNAi analysis PCR products corresponding to predicted C. elegans genes were synthesized using Ahringer Lab RNAi feeding vectors as templates16,17. Primers used to amplify ORFs were: DT7 ForA (TGCGTTATCCCCTGATTCTG) and DT7 RevB (GTAAAACGACGGCCAGTGAG). Alternatively, PCR products were generated by inc ...
... RNAi analysis PCR products corresponding to predicted C. elegans genes were synthesized using Ahringer Lab RNAi feeding vectors as templates16,17. Primers used to amplify ORFs were: DT7 ForA (TGCGTTATCCCCTGATTCTG) and DT7 RevB (GTAAAACGACGGCCAGTGAG). Alternatively, PCR products were generated by inc ...
ppt - Chair of Computational Biology
... • Batch 1 contains the most confident predictions: all predictions with probability of regulation (pba > 0.99 according to the noise model learned from homozygous deletion data • Batch 2: all predictions with a score two standard deviations below the average according to all types (linear AND sigmo ...
... • Batch 1 contains the most confident predictions: all predictions with probability of regulation (pba > 0.99 according to the noise model learned from homozygous deletion data • Batch 2: all predictions with a score two standard deviations below the average according to all types (linear AND sigmo ...
Find information about the protein product of a gene
... Search databases for proteins that confer the ability to alter light by searching for proteins with similar domains. Highlight and copy this amino acid sequence. Open the NCBI Internet site, click BLAST, find Protein, click Search by domain architecture (cdart). Paste the sequence into the win ...
... Search databases for proteins that confer the ability to alter light by searching for proteins with similar domains. Highlight and copy this amino acid sequence. Open the NCBI Internet site, click BLAST, find Protein, click Search by domain architecture (cdart). Paste the sequence into the win ...
Research Article Identification and Characterization of Cell Wall
... which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The cell wall is an important subcellular component of dinoflagellate cells with regard to various aspects of cell surface-associated ecophysiology, but the full range of cell ...
... which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The cell wall is an important subcellular component of dinoflagellate cells with regard to various aspects of cell surface-associated ecophysiology, but the full range of cell ...
Human chromosome 21/Down syndrome gene function and
... location and genomic position, plus links to the genes located immediately centromeric or telomeric and the mouse or human ortholog. A schematic showing the exon/intron organization is provided for up to ten cDNAs and/or spliced ESTs, with nucleic acid and protein sequence accession numbers. Exon bo ...
... location and genomic position, plus links to the genes located immediately centromeric or telomeric and the mouse or human ortholog. A schematic showing the exon/intron organization is provided for up to ten cDNAs and/or spliced ESTs, with nucleic acid and protein sequence accession numbers. Exon bo ...
Protein moonlighting
Protein moonlighting (or gene sharing) is a phenomenon by which a protein can perform more than one function. Ancestral moonlighting proteins originally possessed a single function but through evolution, acquired additional functions. Many proteins that moonlight are enzymes; others are receptors, ion channels or chaperones. The most common primary function of moonlighting proteins is enzymatic catalysis, but these enzymes have acquired secondary non-enzymatic roles. Some examples of functions of moonlighting proteins secondary to catalysis include signal transduction, transcriptional regulation, apoptosis, motility, and structural.Protein moonlighting may occur widely in nature. Protein moonlighting through gene sharing differs from the use of a single gene to generate different proteins by alternative RNA splicing, DNA rearrangement, or post-translational processing. It is also different from multifunctionality of the protein, in which the protein has multiple domains, each serving a different function. Protein moonlighting by gene sharing means that a gene may acquire and maintain a second function without gene duplication and without loss of the primary function. Such genes are under two or more entirely different selective constraints.Various techniques have been used to reveal moonlighting functions in proteins. The detection of a protein in unexpected locations within cells, cell types, or tissues may suggest that a protein has a moonlighting function. Furthermore, sequence or structure homology of a protein may be used to infer both primary function as well as secondary moonlighting functions of a protein.The most well-studied examples of gene sharing are crystallins. These proteins, when expressed at low levels in many tissues function as enzymes, but when expressed at high levels in eye tissue, become densely packed and thus form lenses. While the recognition of gene sharing is relatively recent—the term was coined in 1988, after crystallins in chickens and ducks were found to be identical to separately identified enzymes—recent studies have found many examples throughout the living world. Joram Piatigorsky has suggested that many or all proteins exhibit gene sharing to some extent, and that gene sharing is a key aspect of molecular evolution. The genes encoding crystallins must maintain sequences for catalytic function and transparency maintenance function.Inappropriate moonlighting is a contributing factor in some genetic diseases, and moonlighting provides a possible mechanism by which bacteria may become resistant to antibiotics.