 
									
								
									Threshold phenomena versus cell heredity in the
									
... for sex-linked genes for internal evidence concerning their origin. This paper deals with the genes of the house mouse for tabby {Ta; Falconer, 1953), brindled (Mobr; Fraser, Sobey & Spicer, 1953) and striated (Str; Phillips, 1963). The test for the validity of the L.H. is essentially a comparison b ...
                        	... for sex-linked genes for internal evidence concerning their origin. This paper deals with the genes of the house mouse for tabby {Ta; Falconer, 1953), brindled (Mobr; Fraser, Sobey & Spicer, 1953) and striated (Str; Phillips, 1963). The test for the validity of the L.H. is essentially a comparison b ...
									Methylation of the Factor IX Gene is the Main Source of Mutations
									
... in the factor IX gene increased many-fold [6]. These data were mostly obtained by PCR and sequencing of the amplified fragments. Analysis of these mutations gives us a unique chance to estimate the role of CG mutagenesis and to understand some specific mechanisms of generation of these transitions. ...
                        	... in the factor IX gene increased many-fold [6]. These data were mostly obtained by PCR and sequencing of the amplified fragments. Analysis of these mutations gives us a unique chance to estimate the role of CG mutagenesis and to understand some specific mechanisms of generation of these transitions. ...
									Inheritance of Aldehyde Oxidase in Drosophila melanogaster
									
... areas of genetic research. The study of genetics focuses on an understanding of the principles which govern the inheritance of specific traits. Initial experiments were concerned with the transmission of hereditary factors from generation to generation and led to the discovery of specific laws which ...
                        	... areas of genetic research. The study of genetics focuses on an understanding of the principles which govern the inheritance of specific traits. Initial experiments were concerned with the transmission of hereditary factors from generation to generation and led to the discovery of specific laws which ...
									Genetic Characteristic of the Usual Form of the Polydactyl Gene in
									
... have been started because the writers of the ban did not understand Danforth’s work? Scottish Fold Another dominant gene causes the folded ears in the Scottish Fold. According to the Fourth Edition of Robinson’s Genetics for Cat Breeders & Veterinarians (1999, pg 180) “the fold is produced by a domi ...
                        	... have been started because the writers of the ban did not understand Danforth’s work? Scottish Fold Another dominant gene causes the folded ears in the Scottish Fold. According to the Fourth Edition of Robinson’s Genetics for Cat Breeders & Veterinarians (1999, pg 180) “the fold is produced by a domi ...
									Genes involved in asexual sporophyte development in Ceratopteris
									
... genes that increase in transcription in gametophytes during this commitment time. By comparing the Gene Ontology terms mapped to this cDNA library with that of the gametophyte transcriptome of the homosporous fern Pteridium aquilinum, I discovered that the C. richardii apogamy library is enriched in ...
                        	... genes that increase in transcription in gametophytes during this commitment time. By comparing the Gene Ontology terms mapped to this cDNA library with that of the gametophyte transcriptome of the homosporous fern Pteridium aquilinum, I discovered that the C. richardii apogamy library is enriched in ...
									Duchenne and Becker Types of Muscular Dystrophy
									
... gene may have a variation in the instruction that causes the gene to no longer function properly. This variation is called a mutation or pathogenic variant, and means that the product produced by the gene, called a protein, is impaired or even absent. Gene mutations may be inherited from a parent, o ...
                        	... gene may have a variation in the instruction that causes the gene to no longer function properly. This variation is called a mutation or pathogenic variant, and means that the product produced by the gene, called a protein, is impaired or even absent. Gene mutations may be inherited from a parent, o ...
									The genomic landscape of meiotic crossovers and gene
									
... from the other in the pair. When these ‘non-crossovers’ cause a change in the DNA sequence they are known as gene conversions. Long-standing questions in the field of plant biology include: how common are gene conversions? How much DNA is typically exchanged? And where in the chromosomes do these ev ...
                        	... from the other in the pair. When these ‘non-crossovers’ cause a change in the DNA sequence they are known as gene conversions. Long-standing questions in the field of plant biology include: how common are gene conversions? How much DNA is typically exchanged? And where in the chromosomes do these ev ...
									Gene Detection Systems Catalog
									
... Gene Link, Inc. is a dynamic biotechnology company and research organization. Our mission is to be one of the most reliable suppliers of reagents and reagent systems used in genetic research technology applications worldwide. Gene Link, Inc. is privately held biotechnology company incorporated in th ...
                        	... Gene Link, Inc. is a dynamic biotechnology company and research organization. Our mission is to be one of the most reliable suppliers of reagents and reagent systems used in genetic research technology applications worldwide. Gene Link, Inc. is privately held biotechnology company incorporated in th ...
									reproductive cell fate transition in plants - Development
									
... with distinct fates over the course of only two to three divisions. For the female gametophyte, which initiates its polarized development as a syncythium, it has been postulated that epigenetic differentiation of the mitotic daughter nuclei might already take place in nuclei before cellularization ( ...
                        	... with distinct fates over the course of only two to three divisions. For the female gametophyte, which initiates its polarized development as a syncythium, it has been postulated that epigenetic differentiation of the mitotic daughter nuclei might already take place in nuclei before cellularization ( ...
									Equilibrium Statistics of Channel-confined DNA
									
... This thesis concerns the statistical description of a very long molecule (a polymer) that is confined to a channel which is much narrower than the size of the molecule. The primary motivation is recent experiments where DNA molecules are inserted into channels with a width of about 100 nm. The resea ...
                        	... This thesis concerns the statistical description of a very long molecule (a polymer) that is confined to a channel which is much narrower than the size of the molecule. The primary motivation is recent experiments where DNA molecules are inserted into channels with a width of about 100 nm. The resea ...
									WHITE PANICLE1, a Val-tRNA Synthetase
									
... punctate structures similar in shape and size to mitochondria. To test the hypothesis that WP1-GFP also localized to mitochondria, we used Mito-Tracker Orange as a mitochondrial marker and found that the GFP signal from the punctate structures merged with that from Mito-Tracker Orange. We therefore ...
                        	... punctate structures similar in shape and size to mitochondria. To test the hypothesis that WP1-GFP also localized to mitochondria, we used Mito-Tracker Orange as a mitochondrial marker and found that the GFP signal from the punctate structures merged with that from Mito-Tracker Orange. We therefore ...
									Pairing of homologous regions in the mouse genome is associated
									
... Although somatic homologous pairing is common in Drosophila it is not generally observed in mammalian cells. However, a number of regions have recently been shown to come into close proximity with their homologous allele, and it has been proposed that pairing might be involved in the establishment o ...
                        	... Although somatic homologous pairing is common in Drosophila it is not generally observed in mammalian cells. However, a number of regions have recently been shown to come into close proximity with their homologous allele, and it has been proposed that pairing might be involved in the establishment o ...
									Two groups of human herpesvirus 6 identified by sequence
									
... As HHV-6 has a tropism similar to that of human immunodeficiency virus (HIV) in infections of CD4 ÷ T lymphocytes and monocytes/macrophages (Yamanishi et al., 1988; Okuno et al., 1989; Levy et al., 1990a; Kondo et al., 1991; Wrzos et al., 1990), it has been suggested that HHV-6 may reactivate and pa ...
                        	... As HHV-6 has a tropism similar to that of human immunodeficiency virus (HIV) in infections of CD4 ÷ T lymphocytes and monocytes/macrophages (Yamanishi et al., 1988; Okuno et al., 1989; Levy et al., 1990a; Kondo et al., 1991; Wrzos et al., 1990), it has been suggested that HHV-6 may reactivate and pa ...
									Gene conversion and purifying selection shape nucleotide variation
									
... M opsin genes of both DNA strands from a sample of a male as only one X-chromosome is present. We sequenced only one strand for other samples if there was no nucleotide difference from the ones for which both strands were sequenced. When we found nucleotide differences in two or more individuals at ...
                        	... M opsin genes of both DNA strands from a sample of a male as only one X-chromosome is present. We sequenced only one strand for other samples if there was no nucleotide difference from the ones for which both strands were sequenced. When we found nucleotide differences in two or more individuals at ...
									Mutational analysis of protein phosphatase 2C involved in abscisic
									
... for cotransfection experiments. The results of at least two independent clones were identical. The primers for generating ABI1 and AtPP2C mutants by PCR are: ABI1 MED141– 143IGH, GGAAGAAGACCTGAGATCCATGGTGCTGTTTCGACT and AGTCGAAACAGCACCATGGATCTCAGGTCTTCT; ABI1 G174D, GCTCATTTCTTCGATGTTTACGACGGC and G ...
                        	... for cotransfection experiments. The results of at least two independent clones were identical. The primers for generating ABI1 and AtPP2C mutants by PCR are: ABI1 MED141– 143IGH, GGAAGAAGACCTGAGATCCATGGTGCTGTTTCGACT and AGTCGAAACAGCACCATGGATCTCAGGTCTTCT; ABI1 G174D, GCTCATTTCTTCGATGTTTACGACGGC and G ...
									guidelines for usage of the vetgen dna marker
									
... range of causative factors identified. A specific progressive renal disease of young dogs has been reported on for the following breeds: Bedlington Terrier, Bull Terrier (miniature), Cocker Spaniel, Doberman Pincher, Keeshond, Lhasa Apso, Malamute, Norwegian Elkhound, Samoyed, Shih Tzu, Soft Coated ...
                        	... range of causative factors identified. A specific progressive renal disease of young dogs has been reported on for the following breeds: Bedlington Terrier, Bull Terrier (miniature), Cocker Spaniel, Doberman Pincher, Keeshond, Lhasa Apso, Malamute, Norwegian Elkhound, Samoyed, Shih Tzu, Soft Coated ...
									Comparison of hair and DNA-based approaches in dietary analysis
									
... of ecological studies, especially for cryptic or far-ranging species such as large carnivores (Gese 2001; Shehzad et. al. 2012). The most widely used method to study carnivore diets is scat analysis (Leopold and Krausman 1986; Gamberg and Atkinson 1988) because sample collection can be planned over ...
                        	... of ecological studies, especially for cryptic or far-ranging species such as large carnivores (Gese 2001; Shehzad et. al. 2012). The most widely used method to study carnivore diets is scat analysis (Leopold and Krausman 1986; Gamberg and Atkinson 1988) because sample collection can be planned over ...
									Molecular evidence for the existence of additional members of the
									
... sequencing. PCR assays were carried out using DNA isolated from nosekhroat specimens or from peripheral blood mononuclear cells of patients with respiratory tract infections, and from vessel wall specimens of abdominal aneurysms. Six of the 42 nosekhroat swab specimens analysed yielded strong bands ...
                        	... sequencing. PCR assays were carried out using DNA isolated from nosekhroat specimens or from peripheral blood mononuclear cells of patients with respiratory tract infections, and from vessel wall specimens of abdominal aneurysms. Six of the 42 nosekhroat swab specimens analysed yielded strong bands ...
									8. Punnett Squares - Macmillan Learning
									
... Because each of the two homologs was donated by a different parent (of the organism in whose gonad this meiosis is taking place), the two homologs are not necessarily identical. So, when crossing over happens, each of the participating homologs can end up different from when it started. That means t ...
                        	... Because each of the two homologs was donated by a different parent (of the organism in whose gonad this meiosis is taking place), the two homologs are not necessarily identical. So, when crossing over happens, each of the participating homologs can end up different from when it started. That means t ...
									A nested deletion approach to generate Cre deleter mice with
									
... Mouse genetics disposes of a set of technologies, which have made this animal a valuable model for human development, physiology and diseases. Of particular interest is the loxP/Cre recombinase system, which allows for site- or time-specific recombination of particular target sequences, hence for a ...
                        	... Mouse genetics disposes of a set of technologies, which have made this animal a valuable model for human development, physiology and diseases. Of particular interest is the loxP/Cre recombinase system, which allows for site- or time-specific recombination of particular target sequences, hence for a ...
									Full-Text PDF
									
... ε-ionone rings in the crucial bifurcation step of carotenoid biosynthesis. Among all carotenoid constituents, β-carotene (β,β-carotene) is found in all photosynthetic organisms, except for purple bacteria and heliobacteria, suggesting a ubiquitous distribution of lycopene β-cyclase activity in these ...
                        	... ε-ionone rings in the crucial bifurcation step of carotenoid biosynthesis. Among all carotenoid constituents, β-carotene (β,β-carotene) is found in all photosynthetic organisms, except for purple bacteria and heliobacteria, suggesting a ubiquitous distribution of lycopene β-cyclase activity in these ...
									Forward to the special issue on Hox/Tale transcription factors in
									
... identified, but Hox-regulated sites that do not rely on cooperative binding with TALE proteins cannot be identified bioinformatically. This handicap would be at least somewhat alleviated by the ability to perform high-quality molecular biochemistry using antibodies in vivo and in cell culture; howev ...
                        	... identified, but Hox-regulated sites that do not rely on cooperative binding with TALE proteins cannot be identified bioinformatically. This handicap would be at least somewhat alleviated by the ability to perform high-quality molecular biochemistry using antibodies in vivo and in cell culture; howev ...
									Genome-Wide Gene Expression Effects of Sex Chromosome
									
... and histone modifications established during oogenesis and spermatogenesis (Sha 2008). In mammals, gynogenetic offspring are inviable (McGrath and Solter 1984; Thomson and Solter 1988), indicating that a balanced contribution of chromosomes of paternal and maternal origin is required for development ...
                        	... and histone modifications established during oogenesis and spermatogenesis (Sha 2008). In mammals, gynogenetic offspring are inviable (McGrath and Solter 1984; Thomson and Solter 1988), indicating that a balanced contribution of chromosomes of paternal and maternal origin is required for development ...
									The Use of Cytochrome B Sequence Variation in Estimation of
									
... except the middle amplification cycles were repeated 40 times. For every sample, one ofthe two isolated products was used as a template to produce a specific single strandedDNA while the other product was used as a template to produce the other complementary strand. In this way, any errors of the PC ...
                        	... except the middle amplification cycles were repeated 40 times. For every sample, one ofthe two isolated products was used as a template to produce a specific single strandedDNA while the other product was used as a template to produce the other complementary strand. In this way, any errors of the PC ...
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									