• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Enhanced Bioaccumulation of Heavy Metals by Bacterial Cells Displaying Synthetic Phytochelatins
Enhanced Bioaccumulation of Heavy Metals by Bacterial Cells Displaying Synthetic Phytochelatins

... The synthetic gene encoding for (Glu-Cys)20Gly (EC20) was prepared using two oligonucleotides (Research Genetics, Huntsville, AL): ec-a) 5⬘TTTGGATCCATGGAATGTGAATGTGAATGTGAATGTGAATGTGAATGTGAATGTGAGTGTGAATGTGAGTGCGAATGCGAA3⬘ and ec-b) 5⬘TTTAAGCTTTTAACCACATTCACATTCACATTCACATTCACATTCACATTCGCATTCACATTCGC ...
Unit
Unit

... (B) Movement in Paramaecium : Bring water from a pond and place a few drops of it on a slide and observe under the microscope. You will observe many microscopic organism moving in the water. Among them there may be a slipper shaped paramaecuim visible. Paramaecuim is a unicellular organism which mov ...
Viruses
Viruses

... The species specific characteristic of viruses is significant for controlling the spread of viral diseases. For example, by 1980, the World Health Organization had announced that smallpox, which is a deadly human viral disease, had been eradicated. The eradication was possible partly because the sm ...
This is an open-book, 1 week long, take
This is an open-book, 1 week long, take

... student learned in a cell biology course that when membranes are sheared during isolation, they can form both “outside out” and “inside out” vesicles. This is because when they are broken up during homogenization they can reseal in either direction. Furthermore, the bacteria come out of these endoso ...
because personal discovery is an important aspect
because personal discovery is an important aspect

... what are the diagnostic characteristics of each of the four main types of tissues what are the diagnostic characteristics of each of the subtypes of tissues be able to give examples of each tissue type are organs made of one or more tissues? ...
patriciazuk.com
patriciazuk.com

... • in other words – internal and external signals exert control over cdk/cyclins and the cell cycle • internal signal – e.g. kinetochores not attached to spindle microtubules send a molecular signal that delays anaphase – all chromosomes must be attached to the spindle in order to eventually activate ...
Quantitative analysis of yeast internal architecture using soft X‐ray
Quantitative analysis of yeast internal architecture using soft X‐ray

prokaryotes
prokaryotes

... • Replication and metabolism are key properties of life and may have appeared together • Protocells may have been fluid-filled vesicles with a membrane-like structure ...
iGCSE revision notes topic 2 (Part 1) Cells, animal
iGCSE revision notes topic 2 (Part 1) Cells, animal

... microorganisms and fermenters to manufacture the antibiotic penicillin and enzymes for use in biological washing powders Describe the production of antibiotic penicillin ...
a-Catulin, a Rho signalling component, can regulate NF
a-Catulin, a Rho signalling component, can regulate NF

... microscopy. IKK-b partially co-localized with a-catulin in the cytoplasm and at the plasma membrane (Figure 2). Subcellular distribution of a-catulin Using an antibody raised against recombinant a-catulin, we performed immunostaining of HUVEC cells. a-Catulin was distributed throughout the cell, inc ...
Effect of Gibberellic Acid and Actinomycin D on the Formation and
Effect of Gibberellic Acid and Actinomycin D on the Formation and

... vesiculation of the rough endoplasmic reticulum. Furthermore, when cells were treated with actinomycin D and gibberellic acid, -amylase synthesis was inhibited by 45% and secretion by 63%. These cells were characterized cytologically by large areas of disarrayed segments of fragmented rough endopla ...
File
File

... Day 8 – The blastocyst is partially embedded in the endometrium. The side of the embryo containing the inner cell mass is the embryonic pole and opposite of it is the abembryonic pole. The trophoblast (outer cell mass) differentiates into an inner cytotrophoblast (mononuclear cells) and outer syncyt ...
www.theallpapers.com
www.theallpapers.com

... State the main difference in the composition of the plant cell wall compared to the bacterial cell wall. plant cell wall ............................................................................................................ bacterial cell wall .................................................. ...
Modules04-15to04-21
Modules04-15to04-21

... actin (microfilaments) and microtubules. Most types of intermediate filaments are located in the cytosol between the nuclear envelope and the cell surface membrane. Nuclear lamins are localized to the cell nucleus. ...
1.-Types-of-microbes
1.-Types-of-microbes

... • Identify what a bacterial cell looks like • Identify what a yeast cell looks • State what type of microbe Yeast is ...
500KB - NZQA
500KB - NZQA

... chlorophyll in the plants chloroplasts. Carbon dioxide is absorbed by the plants’ stomata, and water via the roots. Carbon dioxide and water are joined together to create glucose; oxygen is a waste product. The end product, glucose, is used in the cell respiration to create energy the cell can use. ...
Chapter3summary
Chapter3summary

... Many proteins found on the outer surface of cells have oligosaccharides attached to the R group of certain amino acids, or to lipids. ...
6 per page - University of San Diego Home Pages
6 per page - University of San Diego Home Pages

... So why do cells need to communicate? -Coordination of movement bacterial movement towards a chemical gradient ...
Regulación Post-transcripcional en eucariotas Biología Molecular
Regulación Post-transcripcional en eucariotas Biología Molecular

... stems, and relatively small loops. Drosha also generates either the 5' or 3' end of the mature miRNA, depending on which strand of the pre-miRNA is selected by RISC (Lee 2003, Yi 2003). ...
Cellular preservation therapy in acute myocardial infarction
Cellular preservation therapy in acute myocardial infarction

... with neoangiogenesis, hyperplasia of fibroblast, and increased collagen production and deposition. The inflammatory infiltrate disappears over time by means of cell apoptosis. Ultimate scar formation is characterized by a prevalence of connective tissues fibers and supporting cells. The fate of the ...
NCEA Level 2 Biology (91156) 2016
NCEA Level 2 Biology (91156) 2016

... chlorophyll in the plants chloroplasts. Carbon dioxide is absorbed by the plants’ stomata, and water via the roots. Carbon dioxide and water are joined together to create glucose; oxygen is a waste product. The end product, glucose, is used in the cell respiration to create energy the cell can use. ...
auxin
auxin

... External Signals • External signals are used by plant cells to alter their physiology, morphology and development, – physical environment, – chemical environment, – biological environment, • sometimes other plants, ...
Introduction - Cedar Crest College
Introduction - Cedar Crest College

... Many proteins found on the outer surface of cells have oligosaccharides attached to the R group of certain amino acids, or to lipids. ...
action potential - HCC Learning Web
action potential - HCC Learning Web

... Postsynaptic potentials fall into two categories: – Excitatory postsynaptic potentials (EPSPs) are depolarizations that bring the membrane potential toward threshold – Inhibitory postsynaptic potentials (IPSPs) are hyperpolarizations that move the membrane potential farther from threshold After rele ...
So why do cells need to communicate?
So why do cells need to communicate?

... second messenger systems associated with it. -  The specificity of action of an organism to a hormone (tissue and cell type) depends on which receptors are expressed in each cell and to which signaling pathway is linked to the receptor. ...
< 1 ... 206 207 208 209 210 211 212 213 214 ... 1009 >

Endomembrane system

The endomembrane system is composed of the different membranes that are suspended in the cytoplasm within a eukaryotic cell. These membranes divide the cell into functional and structural compartments, or organelles. In eukaryotes the organelles of the endomembrane system include: the nuclear membrane, the endoplasmic reticulum, the Golgi apparatus, lysosomes, vesicles, endosomes and the cell membrane. The system is defined more accurately as the set of membranes that form a single functional and developmental unit, either being connected directly, or exchanging material through vesicle transport. Importantly, the endomembrane system does not include the membranes of mitochondria or chloroplasts.The nuclear membrane contains two lipid bilayers that encompass the contents of the nucleus. The endoplasmic reticulum (ER) is a synthesis and transport organelle that branches into the cytoplasm in plant and animal cells. The Golgi apparatus is a series of multiple compartments where molecules are packaged for delivery to other cell components or for secretion from the cell. Vacuoles, which are found in both plant and animal cells (though much bigger in plant cells), are responsible for maintaining the shape and structure of the cell as well as storing waste products. A vesicle is a relatively small, membrane-enclosed sac that stores or transports substances. The cell membrane, is a protective barrier that regulates what enters and leaves the cell. There is also an organelle known as the Spitzenkörper that is only found in fungi, and is connected with hyphal tip growth.In prokaryotes endomembranes are rare, although in many photosynthetic bacteria the plasma membrane is highly folded and most of the cell cytoplasm is filled with layers of light-gathering membrane. These light-gathering membranes may even form enclosed structures called chlorosomes in green sulfur bacteria.The organelles of the endomembrane system are related through direct contact or by the transfer of membrane segments as vesicles. Despite these relationships, the various membranes are not identical in structure and function. The thickness, molecular composition, and metabolic behavior of a membrane are not fixed, they may be modified several times during the membrane's life. One unifying characteristic the membranes share is a lipid bilayer, with proteins attached to either side or traversing them.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report