Sequencing
... • The length of the ORF directly related to the size or molecular weight of the coded protein • The comparison of the similarity of two or more sequences is a good indicator of biological function of gene ...
... • The length of the ORF directly related to the size or molecular weight of the coded protein • The comparison of the similarity of two or more sequences is a good indicator of biological function of gene ...
TM review
... • E-value, Expectation value; this is the expected number of hits of at least the given score, that you would expect by random chance for the search database. • P-value, Probability value; this is the probability that a hit would attain at least the given score, by random chance for the search datab ...
... • E-value, Expectation value; this is the expected number of hits of at least the given score, that you would expect by random chance for the search database. • P-value, Probability value; this is the probability that a hit would attain at least the given score, by random chance for the search datab ...
Lecture 3: Sequence Alignment
... The Smith-Waterman algorithm (1981) is for determining similar regions between two nucleotide or protein sequences. Smith-Waterman is also a dynamic programming algorithm and improves on Needleman-Wunsch. As such, it has the desirable property that it is guaranteed to find the optimal local alignmen ...
... The Smith-Waterman algorithm (1981) is for determining similar regions between two nucleotide or protein sequences. Smith-Waterman is also a dynamic programming algorithm and improves on Needleman-Wunsch. As such, it has the desirable property that it is guaranteed to find the optimal local alignmen ...
Sequencing genomes
... • More difficult example ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ...
... • More difficult example ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ...
Problem of the Week - Sino Canada School
... A) One possible way of obtaining the sequence is to double the previous number. Alternatively, if you add all the previous numbers and add 1, you get the next number. Using this pattern, the next number in the sequence could be 64. B) One possible way of obtaining each number in this sequence is to ...
... A) One possible way of obtaining the sequence is to double the previous number. Alternatively, if you add all the previous numbers and add 1, you get the next number. Using this pattern, the next number in the sequence could be 64. B) One possible way of obtaining each number in this sequence is to ...
Bioinformatics and Supercomputing
... • Video •Short stretch of DNA originally characterized by the action of the Alu ‘restriction’ endonucleous. •Discovery of Alu subfamillies led to hypothesis of master/ source genes. AGCT •Reveal ancestry because individuals only share particular sequence insertion if the share an ancestor. •Can i ...
... • Video •Short stretch of DNA originally characterized by the action of the Alu ‘restriction’ endonucleous. •Discovery of Alu subfamillies led to hypothesis of master/ source genes. AGCT •Reveal ancestry because individuals only share particular sequence insertion if the share an ancestor. •Can i ...
presentation on Hidden Markov Models
... Output matrix : containing the probability of observing a particular observable state given that the hidden model is in a particular hidden state. Initial Distribution : contains the probability of the (hidden) model being in a particular hidden state at time t = 1. State transition matrix : holding ...
... Output matrix : containing the probability of observing a particular observable state given that the hidden model is in a particular hidden state. Initial Distribution : contains the probability of the (hidden) model being in a particular hidden state at time t = 1. State transition matrix : holding ...
CS790 – Introduction to Bioinformatics
... Initialize first row and column to all 0’s Allow free horizontal/vertical moves in last row and column Intro to Bioinformatics – Sequence Alignment ...
... Initialize first row and column to all 0’s Allow free horizontal/vertical moves in last row and column Intro to Bioinformatics – Sequence Alignment ...
Biclustering of Expression Data
... (2) The Paper’s Goal and criterion: • Goal: Finding of a set of genes showing strikingly similar up-regulation and down-regulation under a set of conditions. • Criterion: A low mean squared residue score plus a large variation from the constant as a criterion for identifying these genes and conditio ...
... (2) The Paper’s Goal and criterion: • Goal: Finding of a set of genes showing strikingly similar up-regulation and down-regulation under a set of conditions. • Criterion: A low mean squared residue score plus a large variation from the constant as a criterion for identifying these genes and conditio ...
Sequencing a genome and Basic Sequence Alignment
... DNA recombinant technology – Plasmid Vectors: help insert the DNA fragment that needs cloned into a host cell. Inside the host cell both the vector and the DNA fragment are cloned (copied). In the example a DNA fragment is inserted into the plasmid. The plasmid is then inserted into the host cells ...
... DNA recombinant technology – Plasmid Vectors: help insert the DNA fragment that needs cloned into a host cell. Inside the host cell both the vector and the DNA fragment are cloned (copied). In the example a DNA fragment is inserted into the plasmid. The plasmid is then inserted into the host cells ...
DNA Sequence Alignment - National Taiwan University
... deletion, replacement (substitution) and match. Insertions and deletions are both called the indels, and an indel is represented by a dash “-” in an alignment. The insertion operation, denoted by I, indicates inserting an “empty” letter to the first sequence, and the deletion operation, denoted by D ...
... deletion, replacement (substitution) and match. Insertions and deletions are both called the indels, and an indel is represented by a dash “-” in an alignment. The insertion operation, denoted by I, indicates inserting an “empty” letter to the first sequence, and the deletion operation, denoted by D ...
I. Comparing genome sequences
... • Homologous sequences = derived from a common ancestor • Orthologous sequences = homologous sequences separated by a speciation event (e.g., human HOXA and mouse Hoxa) • Paralogous sequences = homologous sequences separated by gene duplication (e.g., human HOXA and human HOXB) ...
... • Homologous sequences = derived from a common ancestor • Orthologous sequences = homologous sequences separated by a speciation event (e.g., human HOXA and mouse Hoxa) • Paralogous sequences = homologous sequences separated by gene duplication (e.g., human HOXA and human HOXB) ...
I. Comparing genome sequences
... • Homologous sequences = derived from a common ancestor • Orthologous sequences = homologous sequences separated by a speciation event (e.g., human HOXA and mouse Hoxa) • Paralogous sequences = homologous sequences separated by gene duplication (e.g., human HOXA and human HOXB) ...
... • Homologous sequences = derived from a common ancestor • Orthologous sequences = homologous sequences separated by a speciation event (e.g., human HOXA and mouse Hoxa) • Paralogous sequences = homologous sequences separated by gene duplication (e.g., human HOXA and human HOXB) ...
Algorithm - SSUET - Computer Science Department
... 1. An algorithm is a precise prescription of how to accomplish a task. 2. Two important issues determine the character of an algorithm: 3. Which operations are available to us? 4. In which order can the operations be performed? 5. One at a time (sequentially). 6. Several at once (in parallel). A Sim ...
... 1. An algorithm is a precise prescription of how to accomplish a task. 2. Two important issues determine the character of an algorithm: 3. Which operations are available to us? 4. In which order can the operations be performed? 5. One at a time (sequentially). 6. Several at once (in parallel). A Sim ...
