• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
FEBS Letters
FEBS Letters

... glutamate were said to be transported from vegetative cells to heterocysts [l-3]. The latter statement is not so well substantiated by experimental findings as the former. The disaccharide has not yet been identified. The evidence for the transport of glutamate mainly stems from [4-61 that carbon ca ...
keystone exam format - Souderton Area High School
keystone exam format - Souderton Area High School

... The Biology Keystone Exam includes questions that require students to select the best answer from four possible answer options. Students read each question and record their answers in the space provided. The correct answer for each multiple-choice question is worth one point. The Biology Keystone Ex ...
Amino Acid Metabolism
Amino Acid Metabolism

... Nitrate assimilation – the reduction of nitrate to NH4+ in plants, various fungi, and certain bacteria, in a two-step metabolic pathway Nitrate assimilation occurs in two steps: The two-electron reduction of nitrate to nitrite, catalyzed by nitrate ...
Canine CD34: Cloning of the cDNA and Evaluation
Canine CD34: Cloning of the cDNA and Evaluation

... PCR primers 34A and 348 were designed from sequences of highest homology when comparing humanand murine CD34 cDNAs. Primers were (see Fig I A ) (a) 34A (sense) S’-CCGAATTCGCTCCTTGCCCAGTCTGAGG; (b) 34B (antisense) 5”CCGAATTCCACGTGTTGTCTTGCTGAATGG: (C) 34c (sense) ~ ” T A G A A G (I7T(JTCGAGAAGGATGCGG ...
Glucose homeostasis in the blood (2) – un-storing energy
Glucose homeostasis in the blood (2) – un-storing energy

... By the end of the first week of fasting metabolism begins to slow down, and a person will start to feel extremely fatigued. By slowing down the metabolism, cells will use less energy and the lifespan is prolonged. After one week without eating At this point in fasting, the only energy source availab ...
1. Which of the following are connected by hydrogen bonds? A
1. Which of the following are connected by hydrogen bonds? A

... Compare the use of carbohydrates and lipids in energy storage. ...
α-Ketoglutarate Dehydrogenase Activity Colorimetric Assay Kit
α-Ketoglutarate Dehydrogenase Activity Colorimetric Assay Kit

... ---Mix and add 50 µl of the Reaction Mix to each well containing the Standard, Positive Control and test samples. * For samples with background, add 50 µl of Background Control Mix (without substrate) to sample background control well(s) and mix well. 4. Measurement: Measure the absorbance immediate ...
fast pyrolysis characteristics of sugarcane bagasse hemicellulose
fast pyrolysis characteristics of sugarcane bagasse hemicellulose

... of xylan and 4-O-methylglucuro-D-xylan.25 Organ and Mackie considered that furan consumption was ruled by (1, 2)-H transfers, which resulted in the formation of cyclic carbene intermediates whose successive decomposition forms either CO and propyne or C2H2 and ketene.26 However, some aromatic compou ...
INSULIN
INSULIN

... • GLUT 1,2 & 3 are NOT affected by insulin: - GLUT-1: transports glucose across blood brain barrier - GLUT-2: kidney cells - GLUT-3: neurons Therefore, in all these tissues the glucose entry is insulin independent. • Only GLUT-4 is insulin-dependant & occurs in the muscles & adipocytes. These cells ...
Antimelanoma Effect of 4-S-Cysteaminylcatechol, an Activated Form
Antimelanoma Effect of 4-S-Cysteaminylcatechol, an Activated Form

... undergoes cyclization followed by oxidation to form a more stable intermediate, t.-dopachrome. The rearrangement of dopachrome leads to 5,6-dihydroxyindole and 5,6-dihydroxyindole-2-carboxylic acid. These dihydroxyindoles are oxidized to form indolequinones, which are polymerized to form ultimately ...
Maintaining proton homeostasis is an essential role of
Maintaining proton homeostasis is an essential role of

... 1920s when this phenomenon, termed “the Warburg Effect”, was observed (Warburg, 1956), its growth advantage provided for proliferating cells has been largely unknown. Although other metabolites, such as pyruvate and amino acids, can efficiently generate ATP in mitochondrial pathway or can even be co ...
Studies of Fatty Acid Oxidation IX. The Effects of
Studies of Fatty Acid Oxidation IX. The Effects of

... substrates, including the endogenous supply of fatty acids. In the preliminary experiments the extent of oxidation of exogenous fatty acid was determined under conditions where there was no significant change in the rate of oxygen uptake. Ten Warburg vessels were set up, one containing no palmitate ...
PPT - Napa Valley College
PPT - Napa Valley College

... -Produced in tubers when exposed to light – natural defense against herbivores. Chlorophyll content also increases (=> greening of the potato), but bitter taste indicates solanine buildup. - Disrupts cellular ion balance, leads to cell death. Symptoms include vomiting, diarrhea in vertebrates. ...
identification of esterases expressed in caco
identification of esterases expressed in caco

... at 37°C. For the hydrolysis of PNPA, the reaction was initiated by the addition of PNPA (final concentration: 25–500 ␮M), and the p-nitrophenol formed was spectrophotometrically determined at 405 nm (V-530; Jasco, Tokyo, Japan). For the hydrolysis of temocapril, the reaction was initiated by the add ...
Carbohydrate Chemistry - Dr. Sato-Bigbee
Carbohydrate Chemistry - Dr. Sato-Bigbee

... (cell receptors, blood group molecules, interaction sperm­egg), extracellular matrix  components (glycosaminoglycans), and cell adhesion molecules (carbohydrates in endothelial  cells allowing interaction with lymphocytes, carbohydrate epitopes in nerve cell membranes  involved in cell migration and ...
Chapter 9. Cellular Respiration Oxidation of Pyruvate Krebs Cycle
Chapter 9. Cellular Respiration Oxidation of Pyruvate Krebs Cycle

... value of NADH & FADH2  electron carriers  reduced molecules store energy!  to be used in the Electron Transport Chain ...
Chapter 9. Cellular Respiration Kreb`s Cycle
Chapter 9. Cellular Respiration Kreb`s Cycle

... value of NADH & FADH2  electron carriers  reduced molecules store energy!  to be used in the Electron Transport Chain ...
Human Gene Editing 2
Human Gene Editing 2

... & Correspondence: [email protected] (J. Huang), [email protected] (C. Zhou) Received March 30, 2015 Accepted April 1, 2015 ...


... without further addition of H2O2. The H2O2 concentration for absorbance was checked at 240 nm prior to each addition. In some experiments the cells were pretreated for 2 h by adding 5 mL of 2 mM solutions of N-acetylcysteine (NAC) to each culture dish, reduced glutathione and glutathione monethyl es ...
PDF
PDF

... medium and fixed immediately for electron microscopy. The fixation and embedding protocols of Stein & Stein (1971) for lipid high-resolution autoradiography were used in the present study. Thin sections were collected on copper grids and coated with Ilford L-4 nuclear emulsion. After a suitable expo ...
Adaptations of protein structure and function to temperature: there is
Adaptations of protein structure and function to temperature: there is

... normal physiological conditions, and flexibility to allow those motions necessary for catalysis at a rate appropriate to maintain metabolic flux (Fields, 2001; Somero, 2010). Temperature is a significant complicating factor in the maintenance of this enzyme stability–flexibility balance (Feller, 201 ...
Peer-reviewed Article PDF
Peer-reviewed Article PDF

... in this respect, the basic reserve phosphorous compound is inorganic polyphosphates [4]. In the typical case of cultivation in a complete medium with excess Pi (20 mM), the cells of S. cerevisiae accumulate little Pi (~ 94 µmole P/g dry biomass) and much polyP (~ 658 mole P/g dry biomass) [27]. Poly ...
Biochem Chapter 44 [4-20
Biochem Chapter 44 [4-20

... o Page 834 bottom pic – Dr. Thomas made a big deal about knowing graphs like this Carbon dioxide – most of the carbon dioxide made from metabolism is carried to the lungs as bicarb, but some of the carbon dioxide binds to Hgb in the tissues o In the lungs, where there’s more oxygen, the oxygen binds ...
Thermo Scientific HyClone Super Low IgG Fetal Bovine Serum
Thermo Scientific HyClone Super Low IgG Fetal Bovine Serum

... Processed to substantially reduce IgG (via Protein G Chromatography) level, Thermo Scientific HyClone Super Low IgG Fetal Bovine Serum (FBS) is suitable for use in more exacting applications. FBS contains natural levels of immunoglobulin (IgG) that may be too high for certain cell culture and protei ...
Insulin, Glucagon, and Diabetes Mellitus
Insulin, Glucagon, and Diabetes Mellitus

... usual onset of type I diabetes occurs at about 14 years of age – juvenile diabetes mellitus may develop abruptly (few days or weeks) ...
< 1 ... 6 7 8 9 10 11 12 13 14 ... 42 >

Cryobiology

Cryobiology is the branch of biology that studies the effects of low temperatures on living things within Earth's cryosphere or in science. The word cryobiology is derived from the Greek words κρῧος [kryos], « cold », βίος [bios], « life », and λόγος [logos], « word » (hence science). In practice, cryobiology is the study of biological material or systems at temperatures below normal. Materials or systems studied may include proteins, cells, tissues, organs, or whole organisms. Temperatures may range from moderately hypothermic conditions to cryogenic temperatures.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report