• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Meiosis
Meiosis

... reform. ...
Learning from the Fossil Record Grade 8 Science Name: Katherine
Learning from the Fossil Record Grade 8 Science Name: Katherine

... Learning from the Fossil Record Grade 8 Science Name: Katherine Burns Date: 1/5/11 3. Circle the ones that come from the mother red and the father blue. ...
Airgas template
Airgas template

... Autosomal recessive disorders are manifested even if only one member of the gene pair is affected. A teratogenic agent is an environmental agent that produces abnormalities only during the first 4 weeks of embryonic or fetal development. Down syndrome, Turner syndrome, and Klinefelter syndrome are a ...
The principles and methods formulated by Gregor
The principles and methods formulated by Gregor

... total of four cells, etc. Thus, repeated cell division is needed for growth. The type of cell division that produces almost all the cells in our bodies is called mitosis. In mitosis, one cell divides to produce two identical daughter cells. (It may seem odd, but the cells produced by cell division a ...
Sex chromosomes determine gender Human males are the
Sex chromosomes determine gender Human males are the

... males with lower intellectual function are more likely to be convicted of crimes regardless of their karyotype XYY karyotype is over represented in tall males 1/325 More than 95% of all XYY males are not in prison ...
Sex for the purposes of this class refers to 4 components
Sex for the purposes of this class refers to 4 components

... males with lower intellectual function are more likely to be convicted of crimes regardless of their karyotype XYY karyotype is over represented in tall males 1/325 More than 95% of all XYY males are not in prison ...
Chapter 1 Notes
Chapter 1 Notes

... daughters, but not sons - mothers pass sex-linked alleles to both sons and daughters ...
Terms and Definitions 2017 File
Terms and Definitions 2017 File

... An allele that shows up in the phenotype if it is present in the genotype An allele that only shows up in the phenotype if it is homozygous in the genotype X or Y chromosome Differences in a particular characteristic of an organism which make each organism unique Process by which organisms which hav ...
Ch. 14 The Human Genome
Ch. 14 The Human Genome

... A picture of chromosomes arranged by homologous pairs ...
Chromosome Variations
Chromosome Variations

... compositions. For instance, it is possible to be 46,XY / 45,X. Some cells are normal male (XY) cells, while others are Turner syndrome female cells. This is caused by chromosome loss or non-disjunction in one of the first few mitoses of a newly formed embryo. • A chimera is an organism which is comp ...
Chapter 11: The Eukaryotic Chromosome: An Organelle for
Chapter 11: The Eukaryotic Chromosome: An Organelle for

... III. Specialized chromosomal elements ensure accurate replication and segregation of chromosomes A. The accurate duplication of chromosome structure depends on origins of replication and telomeres 1. There are many origins of replication 2. Telomeres preserve the integrity of linear chromosomes 3. P ...
Document
Document

... Ex. Cross a colorblind male with a female who is normal, but is a carrier. ...
AP Biology TEST #4 - Chapters 09, 10, 42-43
AP Biology TEST #4 - Chapters 09, 10, 42-43

... 1. Which of the following is true of mitosis? A) The chromosome number in the resulting cells is halved. B) DNA replication is completed prior to the beginning of this phase. C) The chromosome number of the resulting cells is the same as that of the parent cell. D) Both b and c 2. Which of the follo ...
XYZW as nature`s language of love?
XYZW as nature`s language of love?

... chromosome encodes ‘maleness’ so is restricted to the male lineage, while in birds the W chromosome encodes ‘femaleness’ so is restricted to the female lineage. The non-SD chromosomes are coloured black or white, depending on whether they are present in females or males, respectively, in the first g ...
tggccatcgtaaggtgcgacc ggtagca
tggccatcgtaaggtgcgacc ggtagca

... 2. In the space below, come up with your own metaphor to show the relationship between DNA, genes, and chromosomes. Draw a picture in the space below. Underneath each picture, give a brief description of how your picture represents the concept. ...
Honors BIOLOGY
Honors BIOLOGY

... carried on a sex chromosome. Therefore it determines sex as well as the characteristic. Most sex-linked traits are carried on the X chromosome because it carries many more chromosomes than the Y chromosome. Because males get only one X chromosome (always from mom), if that gene is faulty then there ...
File
File

...  Gene 3 is more closely linked to Gene 2 than to Gene 4. Gene 1 and Gene 3 are not linked, but by chance they will still be inherited together 50% of the time.  But not all genes on a chromosome are linked. Genes that are farther away from each other are more likely to be separated during a proces ...
File - Schuette Science
File - Schuette Science

... •Genes are •sections of your chromosome •made up of DNA ...
What makes us human?
What makes us human?

... within a family, is used. In a pedigree, a circle represents a female, and a square represents a male. A filled-in circle or square shows that the individual has the trait being studied. The horizontal line that connects a circle and a square represents a marriage. The vertical line(s) and brackets ...
Document
Document

... predict the probability of traits in offspring. 24. DOMINANT- a trait or characteristic that shows up most often in an organism. 25. RECESSIVE- a trait that is less likely to show up in an organism. 26. ALLELE- another word for a “gene” 27. HETEROZYGOUS- having 2 different genes (alleles) for a sing ...
A1981MD68300002
A1981MD68300002

... after operon, only to discover that a single eukaryotic gene may, in some instances, be as large and complex as several operons or even an entire viral chromosome. "I believe this paper is frequently cited because it reported one of the most direct measures of gene size and number in a eukaryote. It ...
Chromosomes and Cell Reproduction Notes
Chromosomes and Cell Reproduction Notes

... coiled around proteins (*this is after replication but before cell division) B. Chromatid- each copy of the DNA on a chromosome C. Centromere- place where the chromatids attach to make a chromosome D. Genes- Segments of DNA on a chromosome that code for a specific protein/trait A. ...
discov5_lecppt_Ch13
discov5_lecppt_Ch13

... Genes Are Located on Chromosomes • The physical location of a gene on a chromosome is called a locus • A diploid cell that has two different alleles at a given genetic locus has a heterozygous genotype for the gene at that locus • A diploid cell that has two identical alleles at a given genetic lo ...
Dominantаннаallele that is always shown in the phenotype, never
Dominantаннаallele that is always shown in the phenotype, never

... 4. Genotype ­­ actual make­up of genes (TT, Tt, etc.) 5. Homozygous ­­ both alleles are same (TT, tt) 6. Heterozygous ­­ 2 different alleles (Tt) 7. Chromosomes ­­ extremely long molecule of DNA, humans have 23 pairs of these 8. Sex chromosomes ­­ X and Y chromosomes, ones that determine gender  9. ...
Chapter 12: Genetics and Health
Chapter 12: Genetics and Health

... affects females who have three X chromosomes one out of every 1000 female births has Trisomy X syndrome often remains unnoticed because affected individuals appear normal, experience puberty, and are usually fertile often no treatment necessary affects females who are missing or have a damaged X chr ...
< 1 ... 215 216 217 218 219 220 221 222 223 ... 290 >

Y chromosome



The Y chromosome is one of two sex chromosomes (allosomes) in mammals, including humans, and many other animals. The other is the X chromosome. Y is the sex-determining chromosome in many species, since it is the presence or absence of Y that determines the male or female sex of offspring produced in sexual reproduction. In mammals, the Y chromosome contains the gene SRY, which triggers testis development. The DNA in the human Y chromosome is composed of about 59 million base pairs. The Y chromosome is passed only from father to son. With a 30% difference between humans and chimpanzees, the Y chromosome is one of the fastest evolving parts of the human genome. To date, over 200 Y-linked genes have been identified. All Y-linked genes are expressed and (apart from duplicated genes) hemizygous (present on only one chromosome) except in the cases of aneuploidy such as XYY syndrome or XXYY syndrome. (See Y linkage.)
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report