• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
EXAM 1 – 100 points - WebPhysics
EXAM 1 – 100 points - WebPhysics

... (A) Calculate the net electric field at x = 4.0 m. Enet = 5.394 N/C (B) Determine the direction of the net field. θ = 233.13° y E1 = 8.99 N/C at 0° 3.0 m +20 nC E2 = 7.192 N/C at –36.87° ...
Nutrient Notes
Nutrient Notes

... food components on the metabolism, health, performance and disease resistance of humans and animals. It also includes the study of human behaviors related to food ...
Fund of Chem
Fund of Chem

Title: Functional Studies of Arabidopsis FIN219 in Cross
Title: Functional Studies of Arabidopsis FIN219 in Cross

Protein lipid carbohydrate revision
Protein lipid carbohydrate revision

ECS 189K - UC Davis
ECS 189K - UC Davis

... does that string form a knot? (i.e. if you were to hold the two extremities of the string and pull, would it result in the formation of a knot, or would the string become linear?) Some proteins do form knots, and it remains unclear at this time if these knots play a role in defining the functions of ...
2005-07 Spectral Lines
2005-07 Spectral Lines

... Dr. Eknath V. Marathé St. Catharines, Ontario Spectroscopy has contributed to our knowledge not only of Earth but also of the Sun, interstellar space, distant stars and galaxies. The subject of spectroscopy began in the year 1666 with the discovery by Newton that when the Sun’s rays are allowed to p ...
Chapter 5 Separations: I) Based on Charge or pI A) Electrophoresis
Chapter 5 Separations: I) Based on Charge or pI A) Electrophoresis

L32
L32

... Effects due to the wave nature of light • Thus far we have been dealing only with geometrical optics • In geometrical optics we deal only with the behavior of light rays  it either travels in a straight line or is reflected by a mirror, or bent (refracted) when it travels from one medium into anot ...
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`

... List the pathway of organelles throught which it would travel before it was secreted from the cell. 1) pinches off enclosed in a vesicle 2) vesicle travels to Golgi complex where the two membranes join 3) protein moves inside Golgi complex where carbohydrates are added making the protein a glycoprot ...
Biochemistry Notes 2012
Biochemistry Notes 2012

... space. • Atoms - basic building blocks of all matter. • Elements – pure substances that can’t be broken down into other substances. (atoms) • Molecules – two or more atoms joined together by chemical bonds. (smallest combination that can’t be divided without changing its chemical and physical proper ...
NMR - University of Puget Sound
NMR - University of Puget Sound

Biochemistry (Macromolecules)
Biochemistry (Macromolecules)

Denaturation of proteins
Denaturation of proteins

... enzyme, then denaturation causes it to lose its enzymatic activity. If the protein was embedded in a cell membrane where it transported ions or molecules through the membrane, then denaturation destroys that ability. If the protein was an antibody, responsible for recognizing an infectious agent, de ...
MOLECULES of LIFE Matter is anything that has mass and takes up
MOLECULES of LIFE Matter is anything that has mass and takes up

1 - From protein structure to biological function through interactomics
1 - From protein structure to biological function through interactomics

Biomolecule
Biomolecule

... Each of these organisms uses a different type of structural carbohydrate ...
Slide 2
Slide 2

Chapter 2 - The Chemistry of Life Section 1
Chapter 2 - The Chemistry of Life Section 1

GREEN FLUORESCENT PROTEIN (GFP) GFP is produced by the
GREEN FLUORESCENT PROTEIN (GFP) GFP is produced by the

PROTEIN STRUCTURE ANALYSIS ASSIGNMENTS Search from
PROTEIN STRUCTURE ANALYSIS ASSIGNMENTS Search from

Proteins – Organic/Macromolecule #3
Proteins – Organic/Macromolecule #3

Proteins – Organic/Macromolecule #3
Proteins – Organic/Macromolecule #3

Slides
Slides

Summary Sheet – Waves, Sound, Electricity, Magnetism, Light
Summary Sheet – Waves, Sound, Electricity, Magnetism, Light

... oscillating systems are a mass on a spring and a pendulum, and their periods are: Tspring ...
< 1 ... 222 223 224 225 226 227 228 229 230 ... 253 >

Circular dichroism



Circular dichroism (CD) is dichroism involving circularly polarized light, i.e., the differential absorption of left- and right-handed light. Left-hand circular (LHC) and right-hand circular (RHC) polarized light represent two possible spin angular momentum states for a photon, and so circular dichroism is also referred to as dichroism for spin angular momentum. This phenomenon was discovered by Jean-Baptiste Biot, Augustin Fresnel, and Aimé Cotton in the first half of the 19th century. It is exhibited in the absorption bands of optically active chiral molecules. CD spectroscopy has a wide range of applications in many different fields. Most notably, UV CD is used to investigate the secondary structure of proteins. UV/Vis CD is used to investigate charge-transfer transitions. Near-infrared CD is used to investigate geometric and electronic structure by probing metal d→d transitions. Vibrational circular dichroism, which uses light from the infrared energy region, is used for structural studies of small organic molecules, and most recently proteins and DNA.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report