• Study Resource
  • Explore
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
File
File

... Lipids are molecules composed predominantly (but not exclusively) of hydrogen and carbon atoms. These atoms are linked by nonpolar covalent bonds. Thus, lipids are nonpolar and have a very low solubility in water. Lipids can be divided into four subclasses: fatty acids, triglycerides, phospholipids ...
Protein
Protein

...  result of hydrogen bonds at regular intervals along polypeptide backbone  two types: helix pleated sheet ...
m/z
m/z

... name of human serum albumin) - you can also choose a different protein if you like. Sequences and swissprot codes can for example be found in the swissprot database (at www.expasy.ch). 3. Scroll down, and tick the box “only the following selection of enzymes and chemicals”, and then select one chemi ...
The biomolecules of terrestrial life
The biomolecules of terrestrial life

... Biological macromolecules Macromolecules are created by polymerization of a large number of subunits (monomers) Heterogeneous class of organic molecules with common solubility properties Soluble in certain types of non-polar solvents Insoluble in water Larger number of C H bonds with respect to carb ...
The Development of a Method for the Characterization Of
The Development of a Method for the Characterization Of

... recognized as a major threat to the safety of watersheds utilized for recreation and as sources of drinking water. The ability to identify the source of microbial pollution, Microbial source tracking (MST), is essential to any efforts directed toward eliminating NPS pollution. Although Coliform bact ...
Macromolecule Scramble
Macromolecule Scramble

...  Beta pleated sheets and alpha helices fold based on interactions between R-groups of a.a.  Hydrogen bonds, polar/non-polar interactions, acid/base interactions, disulfide bonds, van derWaals forces  Quaternary Structure 4’  the association of the polypeptide chains  some proteins contain more ...
PowerPoint - Center for Biological Sequence Analysis
PowerPoint - Center for Biological Sequence Analysis

... -2: CTATACCGTCCCCGATACGTACCGT ...
Slide 1
Slide 1

... An OH from the acid group of one amino acid joins to an H from the amino group of the other amino acid. A water molecule is formed, and a C-N bond is formed between the two amino acids. ...
lec07_2013 - Andrew.cmu.edu
lec07_2013 - Andrew.cmu.edu

... bond are planar due to the hybridization properties of the carbonyl carbon and the nitrogen (both sp2). In addition, free rotation about the bond is not possible since the pz orbitals of oxygen, carbon, and nitrogen form a delocalized system. Rotation about the peptide bond would break the interacti ...
Biomolecule
Biomolecule

... The chemistry of carbon ...
Protein Expression and Purification Service Quotation Request Form
Protein Expression and Purification Service Quotation Request Form

... Which species would you like to use? Mouse Rat Either one What application(s) you would use the antibody for? ELISA WB FC or FACS IF IP IHC ELISA Sandwich Other: If several applications are needed, please mention the preferred one below (if any): What kind of sample will the antibody be used on? Add ...
Bottom-up Nanobiotechnology
Bottom-up Nanobiotechnology

...  The mammalian nose has the ability to rapidly distinguish between an enormous range of small molecules at low concentrations ...
Proteins 1 - Dr Rob's A
Proteins 1 - Dr Rob's A

... 2 aa’s can join (condensation) to form dipeptide Further reactions can occur making polypeptides ...
Chapter 3 Chemical components of Cells
Chapter 3 Chemical components of Cells

... Disaccharide: 2 Oligosaccharide: 3-50 Polysaccharide: > 100 ...
Nanotubes rev up photosynthesis
Nanotubes rev up photosynthesis

... took place at the same burrows where an individual was originally captured. Of the remaining animals, 43% travelled less than 1 km. But some ventured relatively long distances: 5% of movements were over 7.3 km and one animal travelled over 22 km. The authors suggest that officials seeking to confine ...
Unit 1 Test Biology Chapter 2.3
Unit 1 Test Biology Chapter 2.3

... Carbon-Based Molecules ...
Endoplasmic reticulum - Protein synthesis
Endoplasmic reticulum - Protein synthesis

... Synthesis and insertion into the ER membrane of proteins with multiple transmembrane a-helical segments - An uncleaved internal signal membrane-anchor sequence - A stop-transfer membrane-anchor sequence - An uncleaved internal signal membrane-anchor sequence Etc. ...
Comparison of Trypsin Immobilization Techniques With or Without a
Comparison of Trypsin Immobilization Techniques With or Without a

... The first stage in peptide mapping consists of chemical or enzymatic cleavage of a protein into specific peptides in order to obtain its fingerprint. To address the need for higher throughput in proteomics, fast enzymatic digestions and efficient analysis techniques like capillary electrophoresis (C ...
Chemistry Review
Chemistry Review

... 3. Tertiary Structure – occurs when the secondary structure folds up in a very specific shape and forms a specific protein. The tertiary structure comes from interactions/bonds between the R groups of the amino acid. Some of the interactions that occur between amino acid R groups are: ...
CHEM 260 | ELEMENTS OF BIOCHEMISTRY L/L
CHEM 260 | ELEMENTS OF BIOCHEMISTRY L/L

... Instructor: ...
DNA-RNA-Protein Synthesis
DNA-RNA-Protein Synthesis

... 9 purple pentagons (ribose sugar) 1 large purple ribosome 3 grey tubes (peptide bonds) 3 blue three pronged pieces (tRNA) 3 black three pronged piece (amino acids) Procedure: Designate roles within your group. There should be at least one builder (probably two), an artist, a recorder, and a demolish ...
Wade Chapter Twenty-Four Outline: Amino Acids and Peptides
Wade Chapter Twenty-Four Outline: Amino Acids and Peptides

...  Identify amino acids.  Identify the structure of a specific amino acid at a given pH  Understand the role of protecting groups in Organic synthesis  Propose a series of reactions to produce a given polypeptide.  Propose a sequence of steps to sequence a polypeptide using traditional wet chemis ...
PowerPoint bemutató
PowerPoint bemutató

... peptides become the outer surface of the surface membrane ...
PowerPoint bemutató
PowerPoint bemutató

... peptides become the outer surface of the surface membrane ...
2.1 Molecules to metabolism
2.1 Molecules to metabolism

...  Anabolic Reactions describe the set of metabolic reactions that build up complex molecules from simpler ones.  The synthesis of organic molecules via anabolism typically occurs via condensation reactions.  Condensation reactions occur when monomers are covalently joined and water is produced as ...
< 1 ... 8 9 10 11 12 13 14 15 >

Self-assembling peptide

Self-assembling peptides are a category of peptides which undergo spontaneous assembling into ordered nanostructures. These designer peptides have attracted interest in the field of nanotechnology for its potential for application in areas such as biomedical nanotechnology, cell culturing, molecular electronics, and more.Effectively they act as building blocks for a wide range of material and device applications.The essence of this technology is to replicate what nature does: to use molecular recognition processes to form ordered assemblies of building blocks that are capable of conducting biochemical activities.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report