• Study Resource
  • Explore
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Cellular Control revision - Mrs Jones A
Cellular Control revision - Mrs Jones A

... of cells. Some function continuously; some are present all the time, but are ‘idle’, only working when given the appropriate signal; Some are only needed if particular substrates are present Some may be needed for particular aspects of development. Clearly their action is regulated. Such regulation ...
Chapter 15 2015 - Franklin College
Chapter 15 2015 - Franklin College

... is important in determining the pattern of protein synthesis in a cell • Eukaryotic mRNA generally survives longer than prokaryotic mRNA • Nucleotide sequences that influence the life span of mRNA in eukaryotes reside in the untranslated region (UTR) at the 3 end of the molecule • Noncoding rna’s c ...
Analytical Questions
Analytical Questions

... grow, the fungus relies upon a series of biochemical pathways that can synthesize a complete set of amino acids and vitamins if the fungus is provided with inorganic nitrogen and the single vitamin biotin. By irradiating the spore forming parts of the fungus with X-rays and performing genetic analys ...
Additional materiel and methods: Patients and samples collection
Additional materiel and methods: Patients and samples collection

... The primary antibodies are raised in different species and are recognized by two secondary antibodies coupled with oligonucleotide probes. After ligation of the two probes, the circular DNA is amplified by polymerase reaction. The detection is performed using horseradish peroxidase (HRP) labeled pro ...
Gene Regulation in Eukaryotes
Gene Regulation in Eukaryotes

... Adjacent genes (RNA-coding as well as protein-coding) are often separated by an insulator which helps them avoid cross-talk between each other's promoters and enhancers (and/or silencers). Transcription start site This is where a molecule of RNA polymerase II (pol II, also known as RNAP II) binds. P ...
Prokaryotes: genome size: ? gene number: ? Eukaryotes single
Prokaryotes: genome size: ? gene number: ? Eukaryotes single

... Regulatory proteins • trans-acting DNA-binding proteins that recognize and bind to specific cis-acting sites: repressors, activators, negative regulators, positive regulators, transcription factors Cis-acting sites • gene specific -- often (but not necessarily) adjacent to the core promoter region • ...
DNA Structure and Function
DNA Structure and Function

... Translation: mRNA directs the sequence of Amino acids in a polypeptide (protein). ...
Zoology 145 course
Zoology 145 course

... acid. In the triplet code three consecutive ‫ متتالي‬bases specify ‫ تحدد‬an amino acid. The genetic instructions for a polypeptide chain are written in DNA as a series of three-nucleotide words (triplets). During transcription, one DNA strand (the template strand) provides an RNA template. The comp ...
Molecular Biology -
Molecular Biology -

... 1. Complete the following flowchart to describe how a gene influences a person's characteristics. Use the terms: DNA, protein, RNA. nucleotide sequence in the _________ of a gene  nucleotide sequence in messenger ___________ transcription  amino acid sequence in a polypeptide which folds into a __ ...
ECS 189K - UC Davis
ECS 189K - UC Davis

... You have just sequenced a shot segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. 5’ TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT 3’ 1) Find the longest possible coding region (also called open reading frame, or ORF). Remember that there are six ...
RNA biosensor for imaging translation
RNA biosensor for imaging translation

... -  What do you know about G-proteins (function, subunits, mechanism)? ...
Course Outline
Course Outline

... clinical importance of fat-soluble vitamins in health and disease. 5. To provide students with knowledge about the chemical constituents of biological fluids with special emphasis on blood, their function and alterations in different diseases. ...
DNA Study guide
DNA Study guide

... 1. Know the parts of a nucleotide and how they combine in a finished DNA molecule. 2. Be sure to know the four types of nucleotides and how they pair together. 3. Know the importance of Franklin, Watson, and Crick. 4. Be able to diagram DNA replication until two identical strands of DNA are created, ...
Methods to analyze RNA expression
Methods to analyze RNA expression

... The following experimental techniques are used to measure gene expression and are listed in roughly chronological order, starting with the older, more established technologies. They are divided into two groups based on their degree of multiplexity. Multiplexity is a measure of how many different gen ...
Lecture 2a – Origin of Life and the transition from the RNA world to
Lecture 2a – Origin of Life and the transition from the RNA world to

... before further selfreplication can occur), and also it is essentially random (because the initial copy has to form in the absence of a template). So we think that “in the beginning” there must have been a catalyst for selfreplication. Possibly at first this catalyst was some type of inorganic molecu ...
Plasmids are fragments of double-stranded DNA that can replicate
Plasmids are fragments of double-stranded DNA that can replicate

... the generation of RNA from the insert DNA via transcription. The terminator sequence on the newly synthesized RNA signals for the transcription process to stop. An expression vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression vectors can dr ...
1) Definition of the gene
1) Definition of the gene

... NUTRITION AND GENE EXPRESSION Jan 22, 2015 Dr. Garry Handelman ...
Table of Contents - Milan Area Schools
Table of Contents - Milan Area Schools

... • Messenger RNA, or mRNA moves from the nucleus of eukaryotic cells into the cytoplasm, where it serves as a template for protein synthesis. ...
AP Biology Objectives
AP Biology Objectives

... 6. Explain how RNA polymerase recognizes where transcription should begin. Describe the promoter, the terminator, and the transcription unit. 7. Explain the general process of transcription, including the 3 major steps of initiation, elongation, and termination. 8. Explain how RNA is modified after ...
259071_DNAStructureStudyGuide
259071_DNAStructureStudyGuide

... oversimplified. One thing it doesn’t explain is that DNA replication takes place at multiple points along the same DNA strand. There will be “replication forks” (areas where DNA is being copied) all along the strand of DNA. Why do you think this is so, instead of simply starting at one end ...
Making RNA in other ways
Making RNA in other ways

... • The activity of AZT depends on the ability of an enzyme to mistakenly incorporate it instead of thymidine • Random mutation of reverse transcriptase due to its inherent error rate results in the chance occurrence of an RT that can discriminate between the two nucleotides – The same process works f ...
NUCLEOTIDES AND NUCLEIC ACIDS 2
NUCLEOTIDES AND NUCLEIC ACIDS 2

... • Involves separation of the double helix of DNA into single strands when hydrogen bonds between the bases are disrupted. • Factors that are responsible for denaturation of DNA includes: ↑temperature, ↓pH. • Because there are 3 bonds between G and C but only 2 between A and T, DNA that contains high ...
Amino Acids - Biology Learning Center
Amino Acids - Biology Learning Center

... Von Neumann argued that... [self-reproducing] machines would need to store separately the information needed to make the machine and would need to have a mechanism to interpret that information—a tape and a tape reader. In effect, he abstractly described the gene, the ribosome, and the messenger. ...
Chapter 17 Transcriptional Regulation In Eukaryotes
Chapter 17 Transcriptional Regulation In Eukaryotes

... Transcriptional Regulation In Eukaryotes ...
DNA Replication, Transcription, and Translation
DNA Replication, Transcription, and Translation

... These unzipped areas are called replication forks. Each DNA strand of the double helix has a 5’ (5 prime) and a 3’ end. The two DNA strands align in opposite directions. This head to tail alignment is called antiparallelism. Additional bases to form the new DNA strand are added from the 5’ end towar ...
< 1 ... 442 443 444 445 446 447 448 449 450 ... 524 >

Gene expression



Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as transfer RNA (tRNA) or small nuclear RNA (snRNA) genes, the product is a functional RNA.The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea), and utilized by viruses - to generate the macromolecular machinery for life.Several steps in the gene expression process may be modulated, including the transcription, RNA splicing, translation, and post-translational modification of a protein. Gene regulation gives the cell control over structure and function, and is the basis for cellular differentiation, morphogenesis and the versatility and adaptability of any organism. Gene regulation may also serve as a substrate for evolutionary change, since control of the timing, location, and amount of gene expression can have a profound effect on the functions (actions) of the gene in a cell or in a multicellular organism.In genetics, gene expression is the most fundamental level at which the genotype gives rise to the phenotype, i.e. observable trait. The genetic code stored in DNA is ""interpreted"" by gene expression, and the properties of the expression give rise to the organism's phenotype. Such phenotypes are often expressed by the synthesis of proteins that control the organism's shape, or that act as enzymes catalysing specific metabolic pathways characterising the organism.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report