• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
DNA Transcription
DNA Transcription

... This is the stage where the RNA is made from a strand of DNA using the enzyme RNA polymerase. This occurs in the nucleus of the eukaryotic cell. ...
I. Natural selection and human evolution
I. Natural selection and human evolution

... Describe similarities and differences between eukaryotic and prokaryotic cells, plant and animal cells, and bacteria and viruses and relate these differences to the use of antibiotics to treat infectious diseases. ...
Document
Document

... _____ a. consists of a single strand of nucleotides _____ b. is made of nucleotides linked together _____ c. contains deoxyribose _____ d. has the nitrogenous base uracil _____ e. contains ribose _____ f. is a nucleic acid _____ g. consists of a double strand of nucleotides _____ h. contains a base ...
O - mustafaaltinisik.org.uk
O - mustafaaltinisik.org.uk

4.4 Genetic Engineering and Biotechnology
4.4 Genetic Engineering and Biotechnology

... Outline a basic technique used for gene transfer involving plasmids, a host cell (bacterium, yeast or other cell), restriction enzymes (endonucleases) and DNA ligase.  The use of E. coli in gene technology is well documented.  Most of its DNA is in one circular chromosome, but it also has plasmids ...
BioSc 231 Exam 5 2008
BioSc 231 Exam 5 2008

... 3’ CCGGCCGGCCGGCCGGCCGG C. 5’ GGCCGGCCGGCCGGCCGGCC 3’ CCGGCCGGAAGGCCGGCCGG D. All are equally stable. ...
promoters
promoters

... A consensus sequence for rho-dependent terminators cannot be defined (high C and low G content). ...
Chapter 12 Notes - Rankin County School District
Chapter 12 Notes - Rankin County School District

Nessun titolo diapositiva
Nessun titolo diapositiva

... A consensus sequence for rho-dependent terminators cannot be defined (high C and low G content). ...
Microbial Genetics - University of Montana
Microbial Genetics - University of Montana

... • Extensive lateral gene transfer has occurred among bacteria – Transmission of antibiotic resistance, virulence & pathogenicity factors – Transfer of new genes or gene homologues • Genomic stability: housekeeping functions ...
Electrochemical DNA Biosensors
Electrochemical DNA Biosensors

... – The presence of accelerating agents – Viscosity ...
Chapter 13 Selective breeding is a technique of choosing specific
Chapter 13 Selective breeding is a technique of choosing specific

... To read it, they take a single strand of DNA that has an unknown base sequence and put it in a test tube. They add DNA polymerase (the enzyme that copies DNA) and the 4 nucleotide bases. Some of the bases have a chemical dye added to them. By reading the colored bases on the new copied strand, they ...
FLOW OF GENETIC INFORMATION
FLOW OF GENETIC INFORMATION

... Most human genes consist of coding sequence (exons) separated by noncoding sequences (introns) (Table 1). The number and size of introns in various genes in humans are extremely variable. Some introns are much longer than the coding sequences and some contain coding sequences for other genes. At 5' ...
Ask A Bioloigist - Darwin and Mendel`s Afternoon Tea
Ask A Bioloigist - Darwin and Mendel`s Afternoon Tea

Lecture 1
Lecture 1

... Figure 1-17 Schematic diagram of DNA replication. •The division of a cell must be accompanied by replication of DNA •Enzymatically catalyzed •Each DNA strand acts as a template for its complementary strand. •Each progeny cell has one parental strand and one daughter strand. •Mutations occur in copyi ...
Bio290-08-Week 9
Bio290-08-Week 9

... Base-excision repair • Carried out by DNA glycolylases, generate apurininc or apyrimidinic sites • AP endonuclease nicks strand • Deoxyribophosphodiesterase removes more DNA • DNA polymerase fills in the gap with new DNA ...
DNA and Protein Synthesis Review Questions
DNA and Protein Synthesis Review Questions

... 4. The basic building block of a DNA molecule is a _______________ 5. ________________ are made out of three things… a _________, _________, and a __________________ 6. Nitrogen bases are complimentary which means that _____ bonds with ______ and ______ bonds with ______ 7. What is the shape of DNA ...
DNA Molecule Worksheet
DNA Molecule Worksheet

... Note that that the bases attach to the sides of the ladder at the sugars and not the phosphate. The DNA helix is actually made of repeating units called nucleotides. Each nucleotide consists of three molecules: a sugar (deoxyribose), a phosphate which links the sugars together, and then one of the f ...
DNA, RNA, and Proteins - Tri-City
DNA, RNA, and Proteins - Tri-City

... –  Add  nucleotides  to  exposed   nitrogen  bases,  according  to   base-­‐pairing  rules   –  As  DNA  polymerases  move   along,  two  new  double   helixes  are  formed   ...
chapter 12 practice test - open to see diagrams
chapter 12 practice test - open to see diagrams

Document
Document

... Step 2 - At the replication fork, enzymes known as DNA polymerases move along each of the DNA strands. DNA polymerases add nucleotides to the exposed nitrogen bases, according to the base-pairing rules Step 3 - Two DNA molecules that form are identical to the original DNA molecule ...
Molecular Genetics
Molecular Genetics

...  Involves separating “unzipping” the DNA molecule into 2 strands  Each strand serves as a template for making a new complementary strand  The process is SEMI CONSERVATIVE = each new molecule consists of one new and one old strand of DNA  the sequence of bases gets preserved ...
Session 4 - OpenWetWare
Session 4 - OpenWetWare

... Our ability to engineer biology depends on our ability to move DNA into and out of cells; today we will focus on out. Isolating small DNA (plasmids) from cells is a frequent procedure in molecular biology. Vector sources are maintained in strains for ease of mass production through culturing. Vector ...
Chapter 13
Chapter 13

... Manipulating DNA Removing the code: extraction; DNA is separated from the other parts of the cell ◦ Extraction of DNA is done by rupturing the cells and adding a precipitating reagent such as ethanol, then DNA can be spooled onto a glass rod or sucked out with a pipette.  Cutting DNA into pieces i ...
RC 2 Student Sheet
RC 2 Student Sheet

... 20. ATTCGTTAGC ...
< 1 ... 449 450 451 452 453 454 455 456 457 ... 657 >

Replisome



The replisome is a complex molecular machine that carries out replication of DNA. The replisome first unwinds double stranded DNA into two single strands. For each of the resulting single strands, a new complementary sequence of DNA is synthesized. The net result is formation of two new double stranded DNA sequences that are exact copies of the original double stranded DNA sequence.In terms of structure, the replisome is composed of two replicative polymerase complexes, one of which synthesizes the leading strand, while the other synthesizes the lagging strand. The replisome is composed of a number of proteins including helicase, RFC, PCNA, gyrase/topoisomerase, SSB/RPA, primase, DNA polymerase I, RNAse H, and ligase.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report