• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
CHAPTER 17 FROM GENE TO PROTEIN
CHAPTER 17 FROM GENE TO PROTEIN

... o In some organisms, splicing occurs without proteins or additional RNA molecules. o The intron RNA functions as a ribozyme and catalyzes its own excision. o For example, in the protozoan Tetrahymena, self-splicing occurs in the production of ribosomal RNA (rRNA), a component of the organism’s ribos ...
Biosensor - PharmaStreet
Biosensor - PharmaStreet

... natural biosensor . These can include aptasensors , where apta -sensors use aptamers as the biocomponent. Aptamers are synthetic single stranded nucleic acid that can be designed to identify or recognize amino-acids, oligosaccharides , peptides , and proteins . Aptamers have high affinity , high sel ...
Lecture 10. Glycoproteomics
Lecture 10. Glycoproteomics

... i transcriptomic, t i t i genomic, i and d proteomic t i studies t di have met with several challenges. • Representation of glycan chemical structures is difficult because of their complexity and branching patterns. The use of single alphabet codes, as employed to describe nucleic acid and amino aci ...
Methods S1.
Methods S1.

... nucleotides, including ATP and ADP, were stored at -80 until analysis by high performance liquid chromatography (HPLC). Nucleotide analysis by HPLC Nucleotide profiles were determined by ion-exchange HPLC, using a Whatman Partisphere SAX 4.6 × 125 mm column (5-µm particles) in combination with a Wh ...
PROTEIN SYNTHESIS
PROTEIN SYNTHESIS

... Unlike a newly formed DNA strand, the RNA strand does not remain hydrogenbonded to the DNA template strand. Instead, just behind the region where the ribonucleotides are being added, the RNA chain is displaced and the DNA helix re-forms. For this reason— and because only one strand of the DNA molecu ...
教案编写基本格式与要求
教案编写基本格式与要求

... increased efflux by an active transport protein pump. Second, ribosome protection due to production of proteins that interfere with tetracyclines binding to the ribosome. Third, enzymatic inactivation of tetracyclines. The most important of these is production of an efflux pump. The pump protein is ...
Characterization of the RNase A active site by Phage Panning
Characterization of the RNase A active site by Phage Panning

... bind the RNAse A active site with highest affinity. Individual phage plaques from the last round of purification were amplified and used to prepare DNA samples for sequence analysis. We analyzed the predicted amino acid sequences of active molecules for common features in order to develop hypotheses ...
Organisms` Surface Area, Volume, Shape, Size
Organisms` Surface Area, Volume, Shape, Size

... nutrients and wastes” (Campbell et al. 2006, p. 868). In such animals, circulatory systems exist to aid the transport of important molecules around the organism’s body (Campbell et al. 2006). WORM CIRC & RESP - For example, the earthworm has a simple, closed circulatory system, which involves blood ...
BS2550 Lecture Notes Steroids
BS2550 Lecture Notes Steroids

... nucleus is 5S and the monomer extracted from the cytoplasm is 4S it is clear that some event must have occurred which results in strong nuclear binding. The free 4S receptor is also much more labile than either the 9S complex or the 5S form When the steroid binds to the 9S form a conformational chan ...
Cell-Free Protein Expression Systems
Cell-Free Protein Expression Systems

... Rabbit Reticulocyte Lysate (RRL), Nuclease-Treated, is optimized for mRNA translation by the addition of several supplements. These include hemin, which prevents activation of the heme-regulated eIF-2a kinase; an energy-generating system consisting of phosphocreatine kinase and phosphocreatine; and ...
Expt. 2 Bioinformatics
Expt. 2 Bioinformatics

... recognized literature source simply because sometimes the information is not correct. Thus literature handbooks like the Dictionary of Biochemistry and Molecular Biology, Glossary of Biochemistry and Molecular Biology, Merck Index, Practical Handbook of Biochemistry and Molecular Biology, Worthingto ...
Biological Sequence Data Formats
Biological Sequence Data Formats

... You do not have to have complicated titles. It is easy to make up your own titles. For example: > Seq1 CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAA ...
Amino Acids 40 Profile
Amino Acids 40 Profile

Measuring Arsenite using E. coli reporter strains
Measuring Arsenite using E. coli reporter strains

... When arsenite enters the cell, the ArsR protein will release from its binding site, similar as for the original arsenite resistance mechanism. However, in the arsenite test bacterium release of the ArsR protein from the DNA will result in synthesis of the reporter protein. How much eGFP is being syn ...
Lesson 3
Lesson 3

... what a standard serving looks like can help you notice when portion sizes are large in other food settings. Use these skills outside of the cafeteria to decide how many servings are in a portion. Restaurant portions are not always labeled, although menus give some hints (e.g., 8-ounce steak). Often ...
- Department of Chemistry, York University
- Department of Chemistry, York University

... “We conclude that key lines necessary for an interstellar glycine identification have not yet been found.” ...
Holbert, Daniel: Detecting motifs with EMOTIF-MAKER and MASIA: A critical comparison of two tools for finding protein motifs
Holbert, Daniel: Detecting motifs with EMOTIF-MAKER and MASIA: A critical comparison of two tools for finding protein motifs

... motifs. In this paper, I describe these tools and compare selected aspects of their approaches to discovering and modeling protein motifs. ...
AFFINITY OF WARFARIN WITH CYP2C9 BY MOLECULAR DOCKING STUDY  Original Article
AFFINITY OF WARFARIN WITH CYP2C9 BY MOLECULAR DOCKING STUDY Original Article

... involved at the active site are noticed as phe100, ala 103.These residues may be involving in the metabolism of warfarin. Mutation in this CYP2C9 gene causes configurational changes in enzyme CYP2C9 and the variants at amino acid residues involved in the enzyme substrate complexes will be worked out ...
Fritz-Haber-Institut der Max-Planck
Fritz-Haber-Institut der Max-Planck

... on Lewis acid sites. In TPD experiments CO2 was retained on the surface of pure zirconia up to 823 K. Sulfated samples adsorbed little or no CO2; specifically in presence of enough sulfate and calcination at a moderate temperature of 773 K all zirconia basic sites were found covered by sulfate. Afte ...
Lac
Lac

... The casein micelle functions as a source of nutrients for the neonate: supplying amino acids, calcium and phosphate. Micelles are ~140 nanometers in diameter. They are composed of alpha- , beta-, and kappacaseins. a-Caseins are in multiphosphorylated forms. ß-Casein is a major casein in cow milk, bu ...
Immunoprecipitation protocol
Immunoprecipitation protocol

... 100 mM EDTA stock solution is made with 1.86 g EDTA dissolved into 40 mL H 2O. Add NaOH to adjust the pH to 7.4. Finally, adjust the total volume to 50 mL. ...
Agrobacterium Rhizogeneze
Agrobacterium Rhizogeneze

... activities as virE2 (ssDNA binding and nuclear targeting), or does Galls compensate for absence of virE2? Is the Galls gene regulated by virA/virG and phenolic compounds and sugars released by wounded plant cells?. Galls protein will help us learn more about gene transfer to plants. ...
Proteins, the Essence of Life
Proteins, the Essence of Life

... nucleotides. Only one side of the DNA molecule is transcribed. Transcribe the top side of the DNA molecule by base pairing the appropriate mRNA base pairs using RNA polymerase. Tape the RNA nucleotides together to make one long mRNA strand. Answer questions 8 and 9. 5. Remove the mRNA from the DNA g ...
Review of Osmotic Pressure Driven Release of Proteins from
Review of Osmotic Pressure Driven Release of Proteins from

... conformation is dependent on relatively weak, noncovalent interactions such as hydrogen bonding, electrostatic interactions, disulfide linkages, hydrophobic interactions and van der Waals interactions. When the forces of these interactions are disrupted, the protein is likely to undergo a structural ...
Making Proteins
Making Proteins

... Name the 3 steps of transcription. What is the end product of transcription? What is the difference between the sense and antisense DNA strands? 5. What is the role of RNA polymerase? 6. Describe the initiation step in transcription. 7. What are the “extra” things that happens to the mRNA in eukaryo ...
< 1 ... 25 26 27 28 29 30 31 32 33 ... 179 >

Protein adsorption



Adsorption (not to be mistaken for absorption) is the accumulation and adhesion of molecules, atoms, ions, or larger particles to a surface, but without surface penetration occurring. The adsorption of larger biomolecules such as proteins is of high physiological relevance, and as such they adsorb with different mechanisms than their molecular or atomic analogs. Some of the major driving forces behind protein adsorption include: surface energy, intermolecular forces, hydrophobicity, and ionic or electrostatic interaction. By knowing how these factors affect protein adsorption, they can then be manipulated by machining, alloying, and other engineering techniques to select for the most optimal performance in biomedical or physiological applications.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report