• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Extreme Evolution
Extreme Evolution

... changes thereby gained a strong survival or reproductive advantage. We found that even the tilapia species we sequenced, which is an evolutionarily unremarkable cichlid compared with its brethren, had more such mutations than the sticklebacks. And the cichlids from the hyperdiverse groups in Lake Ma ...
Repression of E-cadherin by the Polycomb Group Protein
Repression of E-cadherin by the Polycomb Group Protein

... forward pimer 5’- ATTTTAGTAATTTTAGGTTAGAGGGTTA -3’ and reverse primer 5’- ACCACAACCAATCAACAAC -3’ which is biotinylated. Bisulfite-modified DNA was amplified in a 24-µL reaction with the primer set and HotStarTaq DNA Polymerase system (Qiagen). Samples were heated to 95°C for 15 min and then amplifi ...
Macromolecules of Life
Macromolecules of Life

... Macromolecules of Life Proteins and Nucleic Acids Chapter 5 ...
Biosynthesis of Nucleotides Biosynthesis of Nucleotides
Biosynthesis of Nucleotides Biosynthesis of Nucleotides

... Cytidine deaminase (activated by dCTP inhibited by dTTP) Of the 4 dNTPs, only dCTP does not interact with the regulatory sites on ribonucleotide reductase, instead it interacts with dCMP deaminase. ...
Product Information Sheet Product Information
Product Information Sheet Product Information

File - Prader
File - Prader

... most common genetic cause of obesity in children. PWS individuals progress through two main stages of symptoms: The first is characterized by decreased muscle tone and the second by insatiable hunger and increased weight, among other symptoms(1). PWS is caused by a deletion on the paternal chromosom ...
Meiosis and mitosis
Meiosis and mitosis

... of genes in a linear array ...
Wide Hybridization in Plant Breeding
Wide Hybridization in Plant Breeding

... If misdivision products of the two chromosomes (in essence, one arm from each chromosome) end up in the same cell (gamete? embryo?), they fuse to produce a centric (whole arm) translocation. ...
Document
Document

... (segregate) together during meiosis (not independently=dependently). Genes linkage • Makes an exception to Mendel’s law of independent assortment. • Linkage ≠ independent assortment ...
Types of mutation
Types of mutation

... genome that sit between genes, and usually they have no effect. When variations occur within genes, there is more often a consequence, but even then mutation only rarely causes death or disease. Mutation also generates new variations that can give an individual a survival ...
Fri 1110 Jackson-Cook - Association of Genetic Technologists
Fri 1110 Jackson-Cook - Association of Genetic Technologists

... The study of heritable changes in phenotype (appearance) or gene expression caused by mechanisms other than changes in the underlying DNA sequence, hence the name epi- (Greek: επί- over, above) -genetics. These changes may remain through cell divisions for the remainder of the cell's life and may al ...
Cloning and sequencing of the S RNA from a Bulgarian isolate of
Cloning and sequencing of the S RNA from a Bulgarian isolate of

... proteins encoded by the homologous ORFs were compared and aligned, it became obvious that the changes at the nucleic acid level also led to substantial differences between the two proteins; the TSWV-L3 sequence had an insertion of four amino acids (residue 234) and a deletion of one amino acid (resi ...
Dravets_LETM1 - Medicinal Genomics
Dravets_LETM1 - Medicinal Genomics

... sequencing approaches without finding the causative mutation. However, in our diagnostic protocol all cases that result negative at the NGS epilepsy platform are then investigated by array-CGH with a 180k platform. This way we were able to pick up the genomic imbalance at the bases of the phenotype o ...
Combinatorial Chemistry and High Throughput Screening
Combinatorial Chemistry and High Throughput Screening

Life: The Science of Biology, 10e
Life: The Science of Biology, 10e

... • An artificial ribozyme has been developed that can catalyze assembly of short RNAs into a longer molecule that is an exact copy of itself. ...
Kodaq 2X PCR MasterMix
Kodaq 2X PCR MasterMix

... exceptional 3’ to 5’ exonuclease activity that endows it with superior accuracy over competitor polymerases. This novel enzyme has intrinsically high processivity and is engineered to have an improved binding affinity for DNA resulting in highly successful PCR. abm’s Kodaq 2X PCR MasterMix is a read ...
protein review
protein review

... - does not fit into 2o structure ...
Exploring a fatal outbreak of Escherichia coli using
Exploring a fatal outbreak of Escherichia coli using

... 8. You can order the protein families by the way the genes occur in a given genome. This is a good way to check for something called genomic islands, which are parts of a genome that were not directly inherited, but are obtained from different bacteria in what is described as horizontal transfer. T ...
Characterization of Two Rice MADS Box Genes That Control
Characterization of Two Rice MADS Box Genes That Control

... homology. Highlights indicate conservative sequences. (D) shows the structure of MADS box proteins. M, MADS box region; I, I region; K, K box region; C, C-terminal region; CE, C terminal end region. Alignment of the OsMADS7 and 8 proteins with other members of the AGL2 family showed that the MADS bo ...
Edouard van Beneden (Belgian, 1883)
Edouard van Beneden (Belgian, 1883)

... • Therefore position (locus) of genes fixed – Recombination percentage is a measure of distance – Bigger distance means more crossovers ...
Exercise 10 - DNA Fingerprinting - Lake
Exercise 10 - DNA Fingerprinting - Lake

... Since 1997 the Federal Bureau of Investigation (FBI) has set standards for DNA fingerprinting analysis for forensic and law enforcement purposes. To meet those standards, 13 specific genes areas (loci; singular locus) are evaluated. These loci are found on autosomes (non-sex chromosomes). A 14th loc ...
Slide 1
Slide 1

... Huntington’s Chorea – a trinucleotide repeat disorder’ – the more repeats, the more severe the expression. CAG codes for glutamine, creating a poly-glutamine region that eventually disrupts protein function. ...
Patterns of Inheritance
Patterns of Inheritance

... information to be identified. • FACT! Like all the cells in your body, saliva cells contain genetic information that is unique to you! ...
Cut, Print: Our Emerging Understanding of Alternative Splicing
Cut, Print: Our Emerging Understanding of Alternative Splicing

... Graveley, B. R. (2001). "Alternative splicing: increasing diversity in the proteomic world." Trends in Genetics 1 7(2): 100-7. Human Genome Consortium, The (2001). "Initial Sequencing and analysis of the human genome." Nature 4 0 9(15 Feburay 2 0 0 1 ) . Lopez, A. J. (1998). "Alternative splicing of ...
Nuclear Gene Trees and the Phylogenetic Relationships of the
Nuclear Gene Trees and the Phylogenetic Relationships of the

... it is inherited as a linked unit. An mtDNA tree provides an account of the evolutionary history of the mitochondrial genome, which is not necessarily the same as the evolutionary history of the species. For this reason, we collected sequences from independent regions of the nuclear genome to complem ...
< 1 ... 904 905 906 907 908 909 910 911 912 ... 2254 >

Artificial gene synthesis

Artificial gene synthesis is a method in synthetic biology that is used to create artificial genes in the laboratory. Currently based on solid-phase DNA synthesis, it differs from molecular cloning and polymerase chain reaction (PCR) in that the user does not have to begin with preexisting DNA sequences. Therefore, it is possible to make a completely synthetic double-stranded DNA molecule with no apparent limits on either nucleotide sequence or size. The method has been used to generate functional bacterial or yeast chromosomes containing approximately one million base pairs. Recent research also suggests the possibility of creating novel nucleobase pairs in addition to the two base pairs in nature, which could greatly expand the possibility of expanding the genetic code.Synthesis of the first complete gene, a yeast tRNA, was demonstrated by Har Gobind Khorana and coworkers in 1972. Synthesis of the first peptide- and protein-coding genes was performed in the laboratories of Herbert Boyer and Alexander Markham, respectively.Commercial gene synthesis services are now available from numerous companies worldwide, some of which have built their business model around this task. Current gene synthesis approaches are most often based on a combination of organic chemistry and molecular biological techniques and entire genes may be synthesized ""de novo"", without the need for precursor template DNA. Gene synthesis has become an important tool in many fields of recombinant DNA technology including heterologous gene expression, vaccine development, gene therapy and molecular engineering. The synthesis of nucleic acid sequences is often more economical than classical cloning and mutagenesis procedures.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report