View PDF
... position of restriction sites of ribosomal genes [2]. Another example is the Amplified Fragment Length Polymorphism (AFLP), which combines restriction with the PCR technique and uses primers containing the sequences of nucleotides of specific restriction sites. Finally, when the differences in the r ...
... position of restriction sites of ribosomal genes [2]. Another example is the Amplified Fragment Length Polymorphism (AFLP), which combines restriction with the PCR technique and uses primers containing the sequences of nucleotides of specific restriction sites. Finally, when the differences in the r ...
Molecular and Functional Characterization of Human P2X2 Receptors
... For the human P2X3 cloning, PCR reactions were performed on oligo(dT)-primed cDNA derived from polyA1 RNA of human pituitary tissue using primers (sense, CACCATGAACTGCATATC CGACTTC; antisense, CTAGTGGCCTATGGAGAAGGC) and Pfu polymerase essentially as described above for the full-length P2X2 receptor. ...
... For the human P2X3 cloning, PCR reactions were performed on oligo(dT)-primed cDNA derived from polyA1 RNA of human pituitary tissue using primers (sense, CACCATGAACTGCATATC CGACTTC; antisense, CTAGTGGCCTATGGAGAAGGC) and Pfu polymerase essentially as described above for the full-length P2X2 receptor. ...
Quantitative RT-PCR Platform to Measure Transcript Levels of C and
... the resulting candidates in silico or in vivo; either one of these two methods may be used to obtain ...
... the resulting candidates in silico or in vivo; either one of these two methods may be used to obtain ...
The endogenous molecular clock orchestrates the temporal
... use is commonly linked with the fed/fasted and active/inactive behaviors, these changes in storage and use are also aligned with the 24-h (circadian) light/dark cycles attributed to the rising and setting of the sun and feeding/activity behavior [16]. At the core of circadian rhythms is a mechanism ...
... use is commonly linked with the fed/fasted and active/inactive behaviors, these changes in storage and use are also aligned with the 24-h (circadian) light/dark cycles attributed to the rising and setting of the sun and feeding/activity behavior [16]. At the core of circadian rhythms is a mechanism ...
Discovery of genes in the Pacific oyster (Crassostrea gigas) involved
... environmental conditions experienced by intertidal species, such as C. gigas, ceramide signaling could be a key component in the cellular response to these environmental changes. Information on the specific physiological mechanisms that are affected by environmental stress could help to pinpoint how ...
... environmental conditions experienced by intertidal species, such as C. gigas, ceramide signaling could be a key component in the cellular response to these environmental changes. Information on the specific physiological mechanisms that are affected by environmental stress could help to pinpoint how ...
Database search and pairwise alignments
... Two proteins are “distant” 1 PAM unit if they differ for a single amino acid out of 100, and if the mutation is accepted, i.e. it does not result in a loss of functionality In other words… two sequences s1 and s2 are distant 1 PAM if s1 can be transformed into s2 with a point ...
... Two proteins are “distant” 1 PAM unit if they differ for a single amino acid out of 100, and if the mutation is accepted, i.e. it does not result in a loss of functionality In other words… two sequences s1 and s2 are distant 1 PAM if s1 can be transformed into s2 with a point ...
PDF - FEMS Microbiology Letters
... The gene coding for this putative decarboxylase was expressed in Escherichia coli in order to assign an unequivocal function. The gene was PCR amplified from Ent. faecium RM58 using Pfu DNA polymerase and the two synthetic primers 57 and 58, and cloned into pIN-III(lppp-5)A3. The resulting plasmid p ...
... The gene coding for this putative decarboxylase was expressed in Escherichia coli in order to assign an unequivocal function. The gene was PCR amplified from Ent. faecium RM58 using Pfu DNA polymerase and the two synthetic primers 57 and 58, and cloned into pIN-III(lppp-5)A3. The resulting plasmid p ...
The complete nucleotide sequence of the RNA coding for the
... long and a total genome length of at least 8,100 nucleotides. The nucleotide composition and dlnucleotide frequency of the coding region are consistent with the data previously obtained for the region of the genome coding for the structural proteins (11). In particular the base composition shows a b ...
... long and a total genome length of at least 8,100 nucleotides. The nucleotide composition and dlnucleotide frequency of the coding region are consistent with the data previously obtained for the region of the genome coding for the structural proteins (11). In particular the base composition shows a b ...
The Structural Basis of Molecular Adaptation
... of a number of mammalian taxa. They used a parsimony algorithm to infer the ancestral sequences in a phylogeny of 21 species of artiodactyls (fig. 3) determined by Beintema et al. (1986). Site-directed mutagenesis was used to construct 13 of the ancestral sequences, each of which was expressed in Es ...
... of a number of mammalian taxa. They used a parsimony algorithm to infer the ancestral sequences in a phylogeny of 21 species of artiodactyls (fig. 3) determined by Beintema et al. (1986). Site-directed mutagenesis was used to construct 13 of the ancestral sequences, each of which was expressed in Es ...
PhoR, PhoP and MshC: Three essential proteins of Mycobacterium
... Mycothiol is the low molecular weight thiol responsible for protection against oxidative stress and electrophilic toxins in actinomycetes. Previous studies suggest MSH is critical for the survival of M.tb, leading to its attractiveness as a potential drug target. MshC is the penultimate enzyme of th ...
... Mycothiol is the low molecular weight thiol responsible for protection against oxidative stress and electrophilic toxins in actinomycetes. Previous studies suggest MSH is critical for the survival of M.tb, leading to its attractiveness as a potential drug target. MshC is the penultimate enzyme of th ...
Streptococcus pneumoniae Senses a Human-like Sialic Acid
... shown that, after Sia uptake, Neu5Ac and Neu5Gc are metabo310 Cell Host & Microbe 20, 307–317, September 14, 2016 ...
... shown that, after Sia uptake, Neu5Ac and Neu5Gc are metabo310 Cell Host & Microbe 20, 307–317, September 14, 2016 ...
evidence indicating independent assortment of
... (25). Sequences that have not been determined for an entire FR segment were generally not used except when an invariant Cys 23 was lacking, and the sequences fell into an F R or C D R set with other members. All chains with the identical sequence for an FR or C D R segment were grouped together as a ...
... (25). Sequences that have not been determined for an entire FR segment were generally not used except when an invariant Cys 23 was lacking, and the sequences fell into an F R or C D R set with other members. All chains with the identical sequence for an FR or C D R segment were grouped together as a ...
Immunohistochemical localization of fatty acid transporters and
... while MCT1 was weak in those cells. Analyses of CD36-deficient mice and humans did not show any apparent skin abnormalities (9). In accordance, our mouse model with genetic deletion of CD36 did not affect the essential expression of MCT1 or fatty acid binding proteins in the sebaceous glands. The e ...
... while MCT1 was weak in those cells. Analyses of CD36-deficient mice and humans did not show any apparent skin abnormalities (9). In accordance, our mouse model with genetic deletion of CD36 did not affect the essential expression of MCT1 or fatty acid binding proteins in the sebaceous glands. The e ...
Table xx - Hindawi
... Axon guidance: The pathway shows three subpathways leading to input for the “Regulation of actin cytoskeleton” pathway. Chicken line differences resulted in a higher expression of all three subpathways in line B compared to line A. Following Salmonella infection both lines show up regulation of the ...
... Axon guidance: The pathway shows three subpathways leading to input for the “Regulation of actin cytoskeleton” pathway. Chicken line differences resulted in a higher expression of all three subpathways in line B compared to line A. Following Salmonella infection both lines show up regulation of the ...
Expanded roles of leucine-responsive regulatory protein in
... involved in the control of the transport of branchedchain amino acids (Anderson et al., 1976). Subsequently, mutations in the lrp gene were found to influence the expression of operons involved in the biosynthesis and degradation of some more amino acids (Lin et al., 1992; Platko et al., 1993), sugg ...
... involved in the control of the transport of branchedchain amino acids (Anderson et al., 1976). Subsequently, mutations in the lrp gene were found to influence the expression of operons involved in the biosynthesis and degradation of some more amino acids (Lin et al., 1992; Platko et al., 1993), sugg ...
FEBS Letters
... the non-mevalonate pathway in cyanobacteria. It was intended to isolate the 1-deoxy-D-xylulose 5-phosphate (DXP) reductoisomerase gene (dxr), as this gene encodes the enzyme which catalyzes a pathway-specific, indicative step of this pathway. For this purpose, a segment of dxr was amplified from Syn ...
... the non-mevalonate pathway in cyanobacteria. It was intended to isolate the 1-deoxy-D-xylulose 5-phosphate (DXP) reductoisomerase gene (dxr), as this gene encodes the enzyme which catalyzes a pathway-specific, indicative step of this pathway. For this purpose, a segment of dxr was amplified from Syn ...
Embden–Meyerhof–Parnas and Entner–Doudoroff pathways in
... and glyceraldehyde, generated by KDG aldolase, are the characteristic intermediates of the pathway [3]. Surprisingly, an unusual ED cluster was identified in the T. tenax genome which comprises genes coding for gluconate dehydratase, KD(P)G [2-keto-3-deoxy-(6-phospho-)gluconate] aldolase, KDG kinase ...
... and glyceraldehyde, generated by KDG aldolase, are the characteristic intermediates of the pathway [3]. Surprisingly, an unusual ED cluster was identified in the T. tenax genome which comprises genes coding for gluconate dehydratase, KD(P)G [2-keto-3-deoxy-(6-phospho-)gluconate] aldolase, KDG kinase ...
Localization of Low-sulfur Keratin Proteins in the Wool Follicle Using
... The location of proteins in thin sections of sheep skin reacting with the panel of monoclonal antibodies was investigated using indirect immunofluorescent. The results are listed in Table I and shown schematically in Fig. 3. Despite the disadvantage that the monoclonal antibodies all recognize more ...
... The location of proteins in thin sections of sheep skin reacting with the panel of monoclonal antibodies was investigated using indirect immunofluorescent. The results are listed in Table I and shown schematically in Fig. 3. Despite the disadvantage that the monoclonal antibodies all recognize more ...
the Gene Ontology
... Use GO for……. Determining which classes of gene products are over-represented or under-represented. Grouping gene products by biological function. Relating a protein’s location to its function. Focusing on particular biological pathways and functions (hypothesis-driven data interrogation). ...
... Use GO for……. Determining which classes of gene products are over-represented or under-represented. Grouping gene products by biological function. Relating a protein’s location to its function. Focusing on particular biological pathways and functions (hypothesis-driven data interrogation). ...
using the crispr/cas9 gene editing tool to develop a cure for
... victims. Overall, the prognosis for those diagnosed with Duchenne muscular dystrophy is an average life expectancy of approximately twenty-five to thirty years, but recent advances in medicine have increased longevity of life, and there have even been some rare cases of patients living into their fo ...
... victims. Overall, the prognosis for those diagnosed with Duchenne muscular dystrophy is an average life expectancy of approximately twenty-five to thirty years, but recent advances in medicine have increased longevity of life, and there have even been some rare cases of patients living into their fo ...
Characteristics of the gene encoding pyrroline-5-carboxylate synthase (P5CS) in Glycine max
... in plant cells was regulated through feedback inhibition mechanisms which modified the structure of the protein P5CS (Boggess et al., 1976a, 1976b) [2], [3]. In Escherichia coli, the synthesis of proline is adjusted through the inhibition of activity of the enzyme γ-GK by the end product of the cycl ...
... in plant cells was regulated through feedback inhibition mechanisms which modified the structure of the protein P5CS (Boggess et al., 1976a, 1976b) [2], [3]. In Escherichia coli, the synthesis of proline is adjusted through the inhibition of activity of the enzyme γ-GK by the end product of the cycl ...
"Using the KEGG Database Resource". In: Current Protocols in
... 2. There are many analyses that can be done with the Ortholog Table. For example, under the Organism column, each entry has links to “P | G | T” corresponding to Pathway, Genome, and Title. “P” links to the pathway map, “G” to the genome map, and “T” to a list of gene functions. Clicking “P” will in ...
... 2. There are many analyses that can be done with the Ortholog Table. For example, under the Organism column, each entry has links to “P | G | T” corresponding to Pathway, Genome, and Title. “P” links to the pathway map, “G” to the genome map, and “T” to a list of gene functions. Clicking “P” will in ...
A complete shikimate pathway in Toxoplasma gondii: an ancient
... but no likely candidates were identified for a Class I DAHP synthase. This region was amplified by PCR and used as a probe to screen a T. gondii cDNA library. This produced a number of overlapping clones that assembled to give the entire T. gondii DAHP synthase, which was confirmed by reverse-transc ...
... but no likely candidates were identified for a Class I DAHP synthase. This region was amplified by PCR and used as a probe to screen a T. gondii cDNA library. This produced a number of overlapping clones that assembled to give the entire T. gondii DAHP synthase, which was confirmed by reverse-transc ...
Saccharomyces cerevisiae.
... is between these organisms. Why can some grow only in the presence of molecular oxygen, some only in the absence, and are some able to withstand both conditions? The yeast Saccharomyces cerevisiae is one of the few yeasts with the capacity to grow rapidly both under aerobic and anaerobic conditions ...
... is between these organisms. Why can some grow only in the presence of molecular oxygen, some only in the absence, and are some able to withstand both conditions? The yeast Saccharomyces cerevisiae is one of the few yeasts with the capacity to grow rapidly both under aerobic and anaerobic conditions ...
The first true obligately syntrophic propionate
... was used for phylogenetic analysis. PCR amplification of the 16S rRNA genes from nucleic acids isolated from this culture resulted in a product of the expected size of 1?4 kb. This fragment was digested with BamHI and PstI and ligated in pUC18 linearized with the same enzymes. The ligation products ...
... was used for phylogenetic analysis. PCR amplification of the 16S rRNA genes from nucleic acids isolated from this culture resulted in a product of the expected size of 1?4 kb. This fragment was digested with BamHI and PstI and ligated in pUC18 linearized with the same enzymes. The ligation products ...
Endogenous retrovirus
Endogenous retroviruses (ERVs) are endogenous viral elements in the genome that closely resemble and can be derived from retroviruses. They are abundant in the genomes of jawed vertebrates, and they comprise up to 5–8% of the human genome (lower estimates of ~1%). ERVs are a subclass of a type of gene called a transposon, which can be packaged and moved within the genome to serve a vital role in gene expression and in regulation. Researchers have suggested that retroviruses evolved from a type of transposable gene called a retrotransposon, which includes ERVs; these genes can mutate and instead of moving to another location in the genome they can become exogenous or pathogenic. This means that all ERVs may not have originated as an insertion by a retrovirus but that some may have been the source for the genetic information in the retroviruses they resemble.