• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
FEMS Microbiology Ecology
FEMS Microbiology Ecology

... The lichen symbiosis allows a self-sustained life under harsh environmental conditions, yet symbiotic integrity can be affected by fungal parasites. Nothing is known about the impact of these biologically diverse and often specific infections on the recently detected bacterial community in lichens. ...
Article PDF
Article PDF

... equilibration, the number of these sites is exceedingly small and has little effect on the primary conclusions of this work. 2.3. Analysis of Counterions with All-Atom MD. A standard method for analyzing counterion distribution in solution is to compute a radial distribution function (RDF). The firs ...
DNA Methylation Maintains Allele-specific KIR Gene Expression in
DNA Methylation Maintains Allele-specific KIR Gene Expression in

... synthesized using random hexamer primers. 3DL1 cDNA was PCR amplified using locus-specific primers, ttcttggtccagagggccgtt and ctgtaggtccctgcaagggaaa, and cloned into plasmid. Alleles were typed by BsaAI and SspI digestion. KIR 2DL4, 3DL1, and 3DL2 allele expression was assessed independently in dono ...
Chapter 13 Mutation, DNA Repair, and Recombination
Chapter 13 Mutation, DNA Repair, and Recombination

... Mismatch Repair in E. coli  Mismatching or mispairing of G and T (DNA polymerase/exonuclease proofreading activity)  The A in GATC sequences is methylated subsequent to DNA replication.  In newly replicated DNA, the parental strand is methylated, but the new strand is not. This difference allows ...
The presence of two UvrB subunits in the UvrAB complex ensures
The presence of two UvrB subunits in the UvrAB complex ensures

... and the Ku70/80 complex are bound to a 1020 bp and a 1500 bp DNA fragment, respectively. No protein complexes other than those bound to the damaged site were observed on the 1020 bp damaged DNA fragment, indicating that no exchange of the Ku70/80 protein complexes occurs during the deposition proced ...
Presentation
Presentation

... • The amino acid sequence of a protein contains information about its organelle destination. • Typically, the information can be found within a short segment of 20 to 100 amino acids preceding the cleavage site. • Signal-based methods (e.g. TargetP) can determine the cleavage site location ...
Radiation Hybrid Mapping: A Somatic Cell Genetic Method for
Radiation Hybrid Mapping: A Somatic Cell Genetic Method for

... several million base pairs. Pulsed-field gel electrophoresis (PFGE), which can separate DNA fragments of several million base pairs in agarose gels, provides a potentially powerful means for constructing long-range physical maps of human chromosomes when used in conjunction with restriction enzymes ...
mRNA Expression Analysis
mRNA Expression Analysis

... system that can perform gene expression analysis and next generation sequencing. The mRNA-Seq application uses Illumina sequencing technology to provide essentially unlimited discovery and profiling of the entire mRNA universe. With no probes or primers to design, mRNA-Seq is free to deliver unbiase ...
University of Groningen DNA-based asymmetric catalysis
University of Groningen DNA-based asymmetric catalysis

... using a combination of chemical and genetic engineering.29-31 A critical choice in the design of a biohybrid catalyst is the mode of attachment of the catalyst to the protein, which can be in a covalent, dative, or non-covalent fashion.32 1.2.1 Covalent anchoring strategies The catalyst can be bound ...
Molecular cloning, characterization, and homologous
Molecular cloning, characterization, and homologous

... °C for 3 min. The final extension was performed for 10 min at 72 °C. Reaction mixtures were run in a 0.8% agarose gel. PCR products were extracted from the gel and ligated to pGEM-T Easy Vector (Promega). Ligation product was then transferred into the competent E. coli DH5α cells, which were prepare ...
Methylation and Glutathione, Keys to Chronic
Methylation and Glutathione, Keys to Chronic

... Why do these pathogenetic processes take place in the people who develop CFS, but not in other people? • A major factor is likely to be differences in the combinations of inherited genetic polymorphisms. • There has not yet been a complete genome study of the polymorphisms that are more frequent in ...
Methylation and Glutathione, Keys to Chronic Fatigue Syndrome
Methylation and Glutathione, Keys to Chronic Fatigue Syndrome

This article was published in an Elsevier journal. The attached copy
This article was published in an Elsevier journal. The attached copy

... erated. We took advantage of an efficient recombination system for chromosome engineering in E. coli DY380 strain (Yu et al., 2000). A defective lambda prophage supplies the function that protects and recombines linear DNA. This system is highly efficient and allows recombination between homologies ...
Trawling DNA Databases for Partial Matches: What is the FBI Afraid
Trawling DNA Databases for Partial Matches: What is the FBI Afraid

... DNA evidence is often presented as the "gold standard"for forensic science. But this was not always the case. For years, eminent scientists complained that the estimates of the tiny frequencies of DNA types were unfounded. It took scores of research papers, dozens of judicial opinions, and two commi ...
Molecular cloning and nucleotide sequence of another variant of the
Molecular cloning and nucleotide sequence of another variant of the

... toxin of Shigella dysenteriae type 1 in immunological cross-reactivity and biological activity and is nearly identical to this toxin in nucleotide and amino acid sequence (Jackson et al., 1987b; Calderwood et al., 1987; De Grandis et al., 1987; Strockbine et al., 1988; Kozlov et al., 1988). SLTII an ...
Analysis of the mitochondrial COI gene and its
Analysis of the mitochondrial COI gene and its

... markers used in molecular systematics. Portions of this gene are often used to infer phylogenies. In addition, COI is currently the focus of considerable interest, especially its 5' portion, which is used by the DNA Barcoding Consortium (Hebert et al., 2003; Stoeckle, 2003). This region is comprised ...
Sequence±structure±function studies of tRNA
Sequence±structure±function studies of tRNA

... It has been deposited in the PDB under accession numbers 1SQG and 1SQF, but not released prior to publication of this work. Neither of these structures was solved in the presence of a RNA substrate. Moreover, the limited functional analyses reported for RsmB did not include mutagenesis of the presum ...


... were isolated with a tightly linked RAPD marker, and subsequently the regions flanking the Rps1 locus were nearly saturated with AFLP markers. Identification and mapping of RAPD markers linked to the Rps1 locus. The screening of 400 decamer primers against the cultivar Williams (rps1-k) and its NIL ...
Bacterial genome replication at subzero temperatures in permafrost
Bacterial genome replication at subzero temperatures in permafrost

... 2720 thermocycler. A small volume of this first round of amplification product (2 ml) was used as a template for the second round of PCR using identical amplification parameters. During the second amplification, aliquots were collected at different cycle numbers (16, 18, 20, 22, 25 and 30 cycles) to ...
Agrobacterium-mediated transformation of banana Musa acuminata
Agrobacterium-mediated transformation of banana Musa acuminata

Nucleotide Polymorphisms in the 2 Gene Define
Nucleotide Polymorphisms in the 2 Gene Define

... region of the a2 gene might harbor elements important in the regulation of a2 expression. a2 allele genotyping using Bgl II/Nde I restriction analysis. We have developed a strategy to type individuals for each of the three alleles using the polymorphic Bgl II and Nde I restriction sites described ab ...
Large-Scale Variation Among Human and Great Ape Genomes
Large-Scale Variation Among Human and Great Ape Genomes

... in proportion to the estimated divergence times of each species (Goodman 1999), as orangutan showed the greatest number of ratio differences and the chimpanzee species demonstrated the fewest ratio differences. We chose a subset of the 63 putative variant sites for detailed experimental validation a ...
Identification and characterisation of Bacillus subtilis as cellulase
Identification and characterisation of Bacillus subtilis as cellulase

... that there was no significant differences in FPase activity amongst the 3 isolates (p >0.05). Results from this analysis further strengthened the report of Desvaux (2005) who stated that a single cellulase gene is difficult to degrade cellulose even though it may have high activity under specific co ...
Ionic distribution around simple DNA models. I
Ionic distribution around simple DNA models. I

... which has its origin in the DNA axis, about 9 Å. With respect to the DNA charged site, the mobile ion behaves as a pointlike charge, and collapses into it. In most simulations of discretely charged structures the problem does not arise due to the use of hard potentials.13 Gordon and Goldman23 simula ...
Short Tandem Repeat Polymorphism and Cancer Risk: Influence of
Short Tandem Repeat Polymorphism and Cancer Risk: Influence of

... 197 bp; bottom, molecular size standards without DNA samples. from the 5V end and stopped at the 3V end where the last CA did not overlap with other bases. For the long allele, the count began at the same position as the short allele but ended at the CA repeat that overlapped with other bases. The s ...
< 1 ... 26 27 28 29 30 31 32 33 34 ... 353 >

Bisulfite sequencing



Bisulphite sequencing (also known as bisulfite sequencing) is the use of bisulphite treatment of DNA to determine its pattern of methylation. DNA methylation was the first discovered epigenetic mark, and remains the most studied. In animals it predominantly involves the addition of a methyl group to the carbon-5 position of cytosine residues of the dinucleotide CpG, and is implicated in repression of transcriptional activity.Treatment of DNA with bisulphite converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. Thus, bisulphite treatment introduces specific changes in the DNA sequence that depend on the methylation status of individual cytosine residues, yielding single- nucleotide resolution information about the methylation status of a segment of DNA. Various analyses can be performed on the altered sequence to retrieve this information. The objective of this analysis is therefore reduced to differentiating between single nucleotide polymorphisms (cytosines and thymidine) resulting from bisulphite conversion (Figure 1).
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report