Nucleotides, nucleic acids and the genetic material
... • 3. DNA polymerase proceeds along a single-stranded molecule of DNA, recruiting free dNTP's • (deoxy-nucleotide-triphosphates) to hydrogen bond with their appropriate complementary dNTP on the single strand (A with T and G with C), and to form a covalent phosphodiester bond with the previous nucleo ...
... • 3. DNA polymerase proceeds along a single-stranded molecule of DNA, recruiting free dNTP's • (deoxy-nucleotide-triphosphates) to hydrogen bond with their appropriate complementary dNTP on the single strand (A with T and G with C), and to form a covalent phosphodiester bond with the previous nucleo ...
BIOL 222 - philipdarrenjones.com
... 2. Diagram a DNA replication bubble and label it using the following terms wherever appropriate (may be used more than once): helicase, topoisomerase, 5’, 3’, DNA polymerase, ligase, replication fork, leading strand, lagging strand, single strand binding protein, origin of replication, Okazaki fragm ...
... 2. Diagram a DNA replication bubble and label it using the following terms wherever appropriate (may be used more than once): helicase, topoisomerase, 5’, 3’, DNA polymerase, ligase, replication fork, leading strand, lagging strand, single strand binding protein, origin of replication, Okazaki fragm ...
Chapter 16 Review - Blue Valley Schools
... there are four double helices. each new DNA double helix consists of two new strands. each new DNA double helix consists of one old DNA strand and one new DNA strand. each of the four DNA strands consists of some old strand parts and some new strand parts. one DNA double helix consists of two old st ...
... there are four double helices. each new DNA double helix consists of two new strands. each new DNA double helix consists of one old DNA strand and one new DNA strand. each of the four DNA strands consists of some old strand parts and some new strand parts. one DNA double helix consists of two old st ...
Chapter 9 DNA: THE Genetic Material
... wrong nucleotide added DNA polymerases “proofreading role” – can backtrack and correct Proofreading reduces errors – DNA replication about one error per 1 billion nucleotides ...
... wrong nucleotide added DNA polymerases “proofreading role” – can backtrack and correct Proofreading reduces errors – DNA replication about one error per 1 billion nucleotides ...
three possibile models for replication
... Prokaryotic organisms (ex: bacteria) have a single origin of replication on their circular chromosome, whereas eukaryotic organisms have multiple starting places on their linear chromosomes (because they have so much DNA and it needs to be copied efficiently). 16. At the origin of replication, the D ...
... Prokaryotic organisms (ex: bacteria) have a single origin of replication on their circular chromosome, whereas eukaryotic organisms have multiple starting places on their linear chromosomes (because they have so much DNA and it needs to be copied efficiently). 16. At the origin of replication, the D ...
Vocabulary handout
... to the chromosome and it is in a characteristic position that is constant for different types of chromosomes. Thus the centromere is important for studying and identifying chromosomes. The centromere also contains a small ring of protein called a kinetochore which is important in the movement of chr ...
... to the chromosome and it is in a characteristic position that is constant for different types of chromosomes. Thus the centromere is important for studying and identifying chromosomes. The centromere also contains a small ring of protein called a kinetochore which is important in the movement of chr ...
ANSWERS TO REVIEW QUESTIONS – CHAPTER 10
... Telomeres are highly repetitive DNA regions that may be many thousands of base pairs in length, located at the ends of linear chromosomes in eukaryotes. They are important in the replication of the 5' end of the DNA strands. (b) How are they maintained? (pp. 226–227) In somatic cells the telomerases ...
... Telomeres are highly repetitive DNA regions that may be many thousands of base pairs in length, located at the ends of linear chromosomes in eukaryotes. They are important in the replication of the 5' end of the DNA strands. (b) How are they maintained? (pp. 226–227) In somatic cells the telomerases ...
DNA Basics
... So both new cells will have the correct DNA 2. When does replication occur? During interphase (S phase). 3. Describe how replication works. Enzymes unzip DNA and complementary nucleotides join each original strand. 4. Use the complementary rule to create the complementary strand: ...
... So both new cells will have the correct DNA 2. When does replication occur? During interphase (S phase). 3. Describe how replication works. Enzymes unzip DNA and complementary nucleotides join each original strand. 4. Use the complementary rule to create the complementary strand: ...
Ch 14- 17 Unit Test - Akron Central Schools
... • During meiosis, a defect occurs in a cell that results in the failure of microtubules, spindle fibers, to bind at the kinetochores, a protein structure on chromatids where the spindle fibers attach during cell division to pull sister chromatids apart. Which of the following is the most likely res ...
... • During meiosis, a defect occurs in a cell that results in the failure of microtubules, spindle fibers, to bind at the kinetochores, a protein structure on chromatids where the spindle fibers attach during cell division to pull sister chromatids apart. Which of the following is the most likely res ...
DNA polymerase
... CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACC CTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAG AGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGG CCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGC TGGGATCCTGGA ...
... CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACC CTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAG AGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGG CCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGC TGGGATCCTGGA ...
DNA (Deoxyribonucleic Acid)
... 1. Why is replication necessary? G---C So both new cells will have the correct C---G DNA T---A 2. When does replication occur? A---T During interphase (S phase). G---C 3. Describe how replication works. A---T Enzymes unzip DNA and complementary G---C nucleotides join each original strand. C---G 4. U ...
... 1. Why is replication necessary? G---C So both new cells will have the correct C---G DNA T---A 2. When does replication occur? A---T During interphase (S phase). G---C 3. Describe how replication works. A---T Enzymes unzip DNA and complementary G---C nucleotides join each original strand. C---G 4. U ...
DNA - Lockland Schools
... 1. Why is replication necessary? G---C So both new cells will have the correct C---G DNA T---A 2. When does replication occur? A---T During interphase (S phase). G---C 3. Describe how replication works. A---T Enzymes unzip DNA and complementary G---C nucleotides join each original strand. C---G 4. U ...
... 1. Why is replication necessary? G---C So both new cells will have the correct C---G DNA T---A 2. When does replication occur? A---T During interphase (S phase). G---C 3. Describe how replication works. A---T Enzymes unzip DNA and complementary G---C nucleotides join each original strand. C---G 4. U ...
Human Chromosomes
... 7. a. If a cell has homologous pairs is it diploid or haploid? ___________ b. What kinds of your cells are diploid? ________________ c. What kinds of your cells are haploid? __________________ ...
... 7. a. If a cell has homologous pairs is it diploid or haploid? ___________ b. What kinds of your cells are diploid? ________________ c. What kinds of your cells are haploid? __________________ ...
Lecture 4a (1/28/13) "Central Dogma"
... Chicken & Egg Problem Have already shown that If DNA is long and therefore very stable, how can it replicate itself without an enzyme (to lower the activation energy)? (Nowadays, it uses DNA polymerase, which is an enzyme, i.e. protein.) The answer won a Nobel prize! Involves RNA… implications for t ...
... Chicken & Egg Problem Have already shown that If DNA is long and therefore very stable, how can it replicate itself without an enzyme (to lower the activation energy)? (Nowadays, it uses DNA polymerase, which is an enzyme, i.e. protein.) The answer won a Nobel prize! Involves RNA… implications for t ...
DNA Replication
... grew from a single cell. And DNA replication is happening in your cells right now. Replication happens very fast. As you can see in the figure, the process starts at many different places along a eukaryotic chromosome. DNA replication is also very accurate. There are very few errors—only about one e ...
... grew from a single cell. And DNA replication is happening in your cells right now. Replication happens very fast. As you can see in the figure, the process starts at many different places along a eukaryotic chromosome. DNA replication is also very accurate. There are very few errors—only about one e ...
DNA - Snow Elementary School
... 1. Why is replication necessary? G---C So both new cells will have the correct C---G DNA T---A 2. When does replication occur? A---T During interphase (S phase). G---C 3. Describe how replication works. A---T Enzymes unzip DNA and complementary G---C nucleotides join each original strand. C---G 4. U ...
... 1. Why is replication necessary? G---C So both new cells will have the correct C---G DNA T---A 2. When does replication occur? A---T During interphase (S phase). G---C 3. Describe how replication works. A---T Enzymes unzip DNA and complementary G---C nucleotides join each original strand. C---G 4. U ...
DNA
... 1. DNA unwinds 2. DNA HELICASE enzyme unzips the weak hydrogen bonds between base pairs 3. Complementary RNA PRIMERS are added to the DNA to begin copying. 4. DNA POLYMERASE enzyme matches up DNA nucleotides to 3’-5’ end continuously(“leading strand”) and later the RNA primers are replaced with DNA ...
... 1. DNA unwinds 2. DNA HELICASE enzyme unzips the weak hydrogen bonds between base pairs 3. Complementary RNA PRIMERS are added to the DNA to begin copying. 4. DNA POLYMERASE enzyme matches up DNA nucleotides to 3’-5’ end continuously(“leading strand”) and later the RNA primers are replaced with DNA ...
DNA Replication and DNA Repair Study Guide Focus on the
... i. Beginning point of replication ii. Prokaryotes (bacteria)- 1 origin of replication iii. Eukaryotes- 1 to 2000 origins of replication per chromosome b. Direction- two forks proceed in opposite directions c. Forks i. Replication sites ii. Proceed in one direction (one for each direction) iii. Repli ...
... i. Beginning point of replication ii. Prokaryotes (bacteria)- 1 origin of replication iii. Eukaryotes- 1 to 2000 origins of replication per chromosome b. Direction- two forks proceed in opposite directions c. Forks i. Replication sites ii. Proceed in one direction (one for each direction) iii. Repli ...
DNA
... Orientation of DNA The 5’ phosphate of one nucleotide is attached to the 3’ hydroxyl group of the previous nucleotide The directionality of a DNA strand is due to the orientation of the phosphate-sugar backbone ...
... Orientation of DNA The 5’ phosphate of one nucleotide is attached to the 3’ hydroxyl group of the previous nucleotide The directionality of a DNA strand is due to the orientation of the phosphate-sugar backbone ...
PowerPoint - Project-based Applied Learning
... • Helicases removes H-bonds holding two strands together. • DNA polymerase connects new complementary bases. • DNA ligase fills in any small gaps between adjacent nucleotides so that fragments are attached into one single strand Many chemotherapy agents stop replication (topoisomerases) ...
... • Helicases removes H-bonds holding two strands together. • DNA polymerase connects new complementary bases. • DNA ligase fills in any small gaps between adjacent nucleotides so that fragments are attached into one single strand Many chemotherapy agents stop replication (topoisomerases) ...
Name
... 44. Prokaryotic chromosomes have a ___________ replication bubble, while eukaryotic cells have ___________ bubbles. 45. What enzyme uncoils DNA so it can be replicated or copied? 46. What other job does this enzyme perform? 47. What is the job of single-strand binding proteins? ...
... 44. Prokaryotic chromosomes have a ___________ replication bubble, while eukaryotic cells have ___________ bubbles. 45. What enzyme uncoils DNA so it can be replicated or copied? 46. What other job does this enzyme perform? 47. What is the job of single-strand binding proteins? ...
TEL1, a Gene Involved in Controlling Telomere Length in S
... (TEL1 CDC27 ura3) and SLK29-3C (tell-1 cdc27 ura3). Transformed diploids in which the DNA fragment integrated into the TEL1 c h r o m o s o m e acquired the phenotype of short telomeres, indicating that the long ORF was the TEL1 gene (Figure 2a). Spores containing a disruption of TEL1, either the mi ...
... (TEL1 CDC27 ura3) and SLK29-3C (tell-1 cdc27 ura3). Transformed diploids in which the DNA fragment integrated into the TEL1 c h r o m o s o m e acquired the phenotype of short telomeres, indicating that the long ORF was the TEL1 gene (Figure 2a). Spores containing a disruption of TEL1, either the mi ...
Slide 1
... • Amino acid sequence of a polypeptide is programmed by a unit of inheritance called a gene • Genes are found on chromosomes. ...
... • Amino acid sequence of a polypeptide is programmed by a unit of inheritance called a gene • Genes are found on chromosomes. ...
Gene Section TCL1B (T-cell leukemia/lymphoma 1B) Atlas of Genetics and Cytogenetics
... 6.5 kb TCL1B cDNA. 4 exons (181, 171, 69, 697 bp); centromere - exons 1 to 4 - telomere orientation; only the first three exons are coding. Located 15-16 kb centromeric of TCL1A. ...
... 6.5 kb TCL1B cDNA. 4 exons (181, 171, 69, 697 bp); centromere - exons 1 to 4 - telomere orientation; only the first three exons are coding. Located 15-16 kb centromeric of TCL1A. ...
Nucleus and Chromosomes
... Telomerase is found in germ cells, not in somatic cells. The telomere length of adult is shorter than that of younger. Telomere shortening is thought to activate a suicide program. ...
... Telomerase is found in germ cells, not in somatic cells. The telomere length of adult is shorter than that of younger. Telomere shortening is thought to activate a suicide program. ...
Telomere
A telomere is a region of repetitive nucleotide sequences at each end of a chromatid, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (τέλος) 'end' and merοs (μέρος, root: μερ-) 'part.' For vertebrates, the sequence of nucleotides in telomeres is TTAGGG. This sequence of TTAGGG is repeated approximately 2,500 times in humans. During chromosome replication, the enzymes that duplicate DNA cannot continue their duplication all the way to the end of a chromosome, so in each duplication the end of the chromosome is shortened (this is because the synthesis of Okazaki fragments requires RNA primers attaching ahead on the lagging strand). The telomeres are disposable buffers at the ends of chromosomes which are truncated during cell division; their presence protects the genes before them on the chromosome from being truncated instead.Over time, due to each cell division, the telomere ends become shorter. They are replenished by an enzyme, telomerase reverse transcriptase.