Lecture 15
... GC content regions. The transposon-based agents show a bias toward insertions near the translation start codons of genes, while the T-DNAs show a preference for the putative transcriptional regulatory regions of genes. The transposon-based agents also have higher insertion site densities in exons th ...
... GC content regions. The transposon-based agents show a bias toward insertions near the translation start codons of genes, while the T-DNAs show a preference for the putative transcriptional regulatory regions of genes. The transposon-based agents also have higher insertion site densities in exons th ...
Finding orthologous groups
... and Orthology Two genes in two species are orthologous if they derive from one gene in their last common ancestor • Orthologous genes are likely to have the same function • Much stronger than “tend to have similar function” ...
... and Orthology Two genes in two species are orthologous if they derive from one gene in their last common ancestor • Orthologous genes are likely to have the same function • Much stronger than “tend to have similar function” ...
What are transcription factors?
... 1 STAT protein (monomer) In your house, this light switch is high up on the wall; luckily there are 2 tall people living at your house. It is also a difficult light switch to turn on, so 2 people need to work together to turn it on. In order to make light/gene product, you need the STAT to exi ...
... 1 STAT protein (monomer) In your house, this light switch is high up on the wall; luckily there are 2 tall people living at your house. It is also a difficult light switch to turn on, so 2 people need to work together to turn it on. In order to make light/gene product, you need the STAT to exi ...
... plants like rice and Arabidopsis and some other organisms has been made easier by the availability of the sequenced genome. While complete genomes are available for many commercially important organisms and a number of model organisms, they are still not available for most other organisms like cyano ...
Evolution of Development (EvoDevo) •Development is the process
... (with the exception of gametes, which only have half the DNA, and certain cells in the immune system, where the immune genes have been scrambled to create new diversity). If the genes in each cell are the same, how, then, do different parts of our body look become so plainly different? ...
... (with the exception of gametes, which only have half the DNA, and certain cells in the immune system, where the immune genes have been scrambled to create new diversity). If the genes in each cell are the same, how, then, do different parts of our body look become so plainly different? ...
Comprehensive analysis of CpG islands in human
... set the standard definition of what a CpG island is: a 200 base pair stretch of DNA with 50% G + C content and an observed CpG/expected CpG ratio of at least 0.6. In “Comprehensive analysis of CpG islands in human chromosomes 21 and 22,” Takai and Jones suggest that the standard definition may not b ...
... set the standard definition of what a CpG island is: a 200 base pair stretch of DNA with 50% G + C content and an observed CpG/expected CpG ratio of at least 0.6. In “Comprehensive analysis of CpG islands in human chromosomes 21 and 22,” Takai and Jones suggest that the standard definition may not b ...
And can we predict these positions by analysing
... Positions conserved among all fungal species. May indicate that eukaryotic genomes direct the transcriptional machinery to functional sites by encoding unstable nucleosomes over these elements. ...
... Positions conserved among all fungal species. May indicate that eukaryotic genomes direct the transcriptional machinery to functional sites by encoding unstable nucleosomes over these elements. ...
- Wiley Online Library
... in the COG protein sequence database were not assigned to any of the COG functional categories. Some of these genes are found in clusters of two or three genes (Table S3). The set included periplasmic 5.4 kDa peptide (UNIPROT: P94818) (Dohra et al., 1997) and 89 kDa periplasmic protein associated wi ...
... in the COG protein sequence database were not assigned to any of the COG functional categories. Some of these genes are found in clusters of two or three genes (Table S3). The set included periplasmic 5.4 kDa peptide (UNIPROT: P94818) (Dohra et al., 1997) and 89 kDa periplasmic protein associated wi ...
Microbial Genetics Lab
... 1) To provide ‘hands-on’ experience in the investigation and manipulation of microorganisms and their genes. 2) To develop the ability to think critically and devise genetic strategies that might be used to address interesting biological problems. A variety of experimental approaches will be introdu ...
... 1) To provide ‘hands-on’ experience in the investigation and manipulation of microorganisms and their genes. 2) To develop the ability to think critically and devise genetic strategies that might be used to address interesting biological problems. A variety of experimental approaches will be introdu ...
File S2 - Genes | Genomes | Genetics
... Genetically, mating-type specificities in the basidiomycetes segregate generally as one (bipolar) or two loci (tetrapolar). Bipolars have mostly two or a limited number of allelic mating-type specificities (the pairing of which results in viable progeny) whereas tetrapolars often have significantly ...
... Genetically, mating-type specificities in the basidiomycetes segregate generally as one (bipolar) or two loci (tetrapolar). Bipolars have mostly two or a limited number of allelic mating-type specificities (the pairing of which results in viable progeny) whereas tetrapolars often have significantly ...
Document
... Homologues are similar sequences in two different organisms that have been derived from a common ancestor sequence. Homologues can be described as either orthologues or paralogues. Orthologues are similar sequences in two different organisms that have arisen due to a speciation event. Orthologs ...
... Homologues are similar sequences in two different organisms that have been derived from a common ancestor sequence. Homologues can be described as either orthologues or paralogues. Orthologues are similar sequences in two different organisms that have arisen due to a speciation event. Orthologs ...
Homework1_23
... Finally, determine the number of sites in the gene at which allelic variants, or mutations, are known to occur. These mutations are often the result of a single base substitution, also known as Single Nucleotide Polymorphism, or SNP. Mutations can also be caused by deletion or insertion of one or mo ...
... Finally, determine the number of sites in the gene at which allelic variants, or mutations, are known to occur. These mutations are often the result of a single base substitution, also known as Single Nucleotide Polymorphism, or SNP. Mutations can also be caused by deletion or insertion of one or mo ...
The Human Genome.
... ortholog by only two amino acid substitutions; nearly one third of human genes have exactly the same protein translation as their chimpanzee ...
... ortholog by only two amino acid substitutions; nearly one third of human genes have exactly the same protein translation as their chimpanzee ...
iclicker - University of Colorado-MCDB
... A. inhibit expression of all C. elegans genes B. Inhibit gene expression in other organisms C. Inhibit gene expression in the next generation in C. elegans D. Completely eliminate the expression of a C. elegans gene E. None of above ...
... A. inhibit expression of all C. elegans genes B. Inhibit gene expression in other organisms C. Inhibit gene expression in the next generation in C. elegans D. Completely eliminate the expression of a C. elegans gene E. None of above ...
Prashanth-Leaflet
... formation in Populus woody model plant, and in Arabidopsis, a nonwoody model may be a fruitful approach to understanding mechanisms of wood formation. The wood-forming transcription factor network involves upstream NACdomain master regulators called VND7, NST1 and SND1, an intermediate regulator, MY ...
... formation in Populus woody model plant, and in Arabidopsis, a nonwoody model may be a fruitful approach to understanding mechanisms of wood formation. The wood-forming transcription factor network involves upstream NACdomain master regulators called VND7, NST1 and SND1, an intermediate regulator, MY ...
Web resources
... from other organisms such as humans or E. coli. For this we use BLAST. This is a program that finds sequence homologies. BLAST is available at SGD but only for looking at the yeast genome. BLAST at NCBI at the NLM can search a wider array of sequences and databases. You may encounter a sequence and ...
... from other organisms such as humans or E. coli. For this we use BLAST. This is a program that finds sequence homologies. BLAST is available at SGD but only for looking at the yeast genome. BLAST at NCBI at the NLM can search a wider array of sequences and databases. You may encounter a sequence and ...
Reading frame
... • a series of codons in DNA/RNA that specify the amino acid sequence of the protein that the gene codes for ...
... • a series of codons in DNA/RNA that specify the amino acid sequence of the protein that the gene codes for ...
Nucleic Acids Research
... from one another, and that hinge regions have evolved rapidly since that divergence. What is not clear is the nature of the genetic event(s) giving rise to the identical Cy genes which were the ancestors of the present-day genes. There are two likely alternatives for the generation of two or more id ...
... from one another, and that hinge regions have evolved rapidly since that divergence. What is not clear is the nature of the genetic event(s) giving rise to the identical Cy genes which were the ancestors of the present-day genes. There are two likely alternatives for the generation of two or more id ...
Sex Chromosomes and Male Functions
... X chromosome also shows an excess recruitment of retroposed genes, contrary to the Drosophila X chromosome. The number of retropseudogenes entering the X chromosome is nearly twice that predicted by a random model, illustrating that a mutational bias exists. However, this only explains part of the o ...
... X chromosome also shows an excess recruitment of retroposed genes, contrary to the Drosophila X chromosome. The number of retropseudogenes entering the X chromosome is nearly twice that predicted by a random model, illustrating that a mutational bias exists. However, this only explains part of the o ...
DNA_fingerprinting
... these repeats vary from individual to individual. These are the polymorphisms targeted by DNA fingerprinting. E.g. there is a region of DNA just beyond the insulin gene on chromosome 11, consisting of 7 to 40 repeats, depending on the individual. E.g. TCATTCATTCATTCATTCAT is a short tandem repeat (S ...
... these repeats vary from individual to individual. These are the polymorphisms targeted by DNA fingerprinting. E.g. there is a region of DNA just beyond the insulin gene on chromosome 11, consisting of 7 to 40 repeats, depending on the individual. E.g. TCATTCATTCATTCATTCAT is a short tandem repeat (S ...
PCR amplification of the bacterial genes coding for nucleic acid
... sequence data, biologists begun to incorporate sophisticated computer tools and mathematical algorithms into their work, to analyze, interpret and predict the structure and function of many of the many identified DNA sequences Not too surprising, that the completion of the sequencing of many bacteri ...
... sequence data, biologists begun to incorporate sophisticated computer tools and mathematical algorithms into their work, to analyze, interpret and predict the structure and function of many of the many identified DNA sequences Not too surprising, that the completion of the sequencing of many bacteri ...
A Short Guide to the Human Genome
... anchoring pathway), PRIM1 (DNA primase subunit), and CDC23 (anaphase promoting complex subunit). These proteins produce relatively straightforward plots related to evolutionary distance and the intrinsic conservation of protein function. Some examples presented in later sections are more complex (se ...
... anchoring pathway), PRIM1 (DNA primase subunit), and CDC23 (anaphase promoting complex subunit). These proteins produce relatively straightforward plots related to evolutionary distance and the intrinsic conservation of protein function. Some examples presented in later sections are more complex (se ...
wk1_day1_introduction_2010
... • Fluorescent cDNA from organism is allowed to hybridise with the probes • Intensity of fluorescence per spot reflect the amount of mRNA present ...
... • Fluorescent cDNA from organism is allowed to hybridise with the probes • Intensity of fluorescence per spot reflect the amount of mRNA present ...
Basics for Bioinformatics
... some protein products. This is still true in many contexts today. More strictly, these DNA segments should be called protein-coding genes, as scientists have found that there are some or many other parts on the genome that do not involve in protein products but also play important genetic roles. Som ...
... some protein products. This is still true in many contexts today. More strictly, these DNA segments should be called protein-coding genes, as scientists have found that there are some or many other parts on the genome that do not involve in protein products but also play important genetic roles. Som ...
Transposable element
A transposable element (TE or transposon) is a DNA sequence that can change its position within the genome, sometimes creating or reversing mutations and altering the cell's genome size. Transposition often results in duplication of the TE. Barbara McClintock's discovery of these jumping genes earned her a Nobel prize in 1983.TEs make up a large fraction of the C-value of eukaryotic cells. There are at least two classes of TEs: class I TEs generally function via reverse transcription, while class II TEs encode the protein transposase, which they require for insertion and excision, and some of these TEs also encode other proteins. It has been shown that TEs are important in genome function and evolution. In Oxytricha, which has a unique genetic system, they play a critical role in development. They are also very useful to researchers as a means to alter DNA inside a living organism.