• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
IMPaLA  tutorial  1.  Introduction
IMPaLA tutorial 1. Introduction

... with over-representation is that once an item passes your statistically signifcant threshold and is included in the list, it will be treated with identical weight to all the other items in the list. Therefore, it is important to use multiple-testing correction when selecting your threshold, so that ...
2011_InstructorSlidesR
2011_InstructorSlidesR

... Programs or Undergraduate Courses ...
VGEC: Student Notes RESTRICTION ENZYME MAPPING OF THE λ
VGEC: Student Notes RESTRICTION ENZYME MAPPING OF THE λ

... Restriction endonucleases are powerful tools for the molecular analysis of complex genomes such as those of mammals. These enzymes can be isolated from a wide variety of micro-organisms and have the property of cutting both strands of double-stranded DNA only at a specific nucleotide sequence, usual ...
Molecular Diagnosis of Fish Diseases: a Review
Molecular Diagnosis of Fish Diseases: a Review

... outbreak could be prevented. Thus antibiotic treatment can be reduced therefore; creation of antibiotic resistant bacteria may be eliminated. Antimicrobial resistance of bacteria in the fish farms has been intensively studied (Alderman and Hastings, 1998). In the aquaculture, antimicrobial agents ar ...
Exam notes for bio250 semester one
Exam notes for bio250 semester one

... sample, run gel, collect data, or read sequence by hand. Many genomes have been sequenced, and one amazing discovery has been the diversity of protists. The genome is an organisms entire DNA sequence, organelles. A large genome size does not mean more genes as there is non-coding DNA. Genome sequenc ...
introduction to cave microbiology: a review for the non
introduction to cave microbiology: a review for the non

... all the previously understood conventions of life (that it relies on plant-derived material), Winogradsky’s discoveries were again considered a curiosity, and most microbiologists continued to concentrate on just a handful of microbes responsible for human disease. Of course, once again it was prove ...
Talk4EmpiricalEvaluationHorvath
Talk4EmpiricalEvaluationHorvath

... meaningful gene lists than a standard statistical analysis based on significance testing? • Here we address this question for the special case when multiple data sets are available. • This is of great practical importance since for many research questions multiple gene expression or other -omics dat ...
DNA Technology - De Anza College
DNA Technology - De Anza College

... What has r DNA technology done for skiing? Increase expression of a bacterial protein Called SnowMax Used in snow making machines Mix cold water and protein & huge amounts of snow are produced Activity: Applications of DNA technology ...
A dps-Like Gene with the Host Bacterium Revealed by Comparative
A dps-Like Gene with the Host Bacterium Revealed by Comparative

... the surrounding genes. It is even higher than the GC3 of the whole Streptomyces coelicolor genome (92%), while the GC content of S. coelicolor genome is 72.1%. The GC content of the first base of codons (GC1) and of the second base of the codons (GC2) of aah were extremely low (Supplementary Figure ...
Chapter 13
Chapter 13

... A person wishes to raise guinea pigs with black fur, the dominant trait. She selects a male black guinea pig and performs a test cross with a female that has white fur, the recessive trait. What is the black guinea pig’s genotype if any of the offspring are white? ...
The Florida State University College of Arts and Sciences
The Florida State University College of Arts and Sciences

... agarose gel at 140V for 30 minutes. Tgs5 samples were run with EcoRI from Promega and digested for 1, 4, and 6 hours at 37°C. Samples with confirmed insert size were then sent for sequencing. DNA Methylation Analysis M13F primers were used for sequencing. The sequencing results were analyzed using K ...
Algorithm to extract REP sequences Pattern
Algorithm to extract REP sequences Pattern

... CGCGGCGGCGCCCTATAAAACCCAGCGGCGCGACGCGCCA ...
software development and application in bioinformatics: single
software development and application in bioinformatics: single

... over another? It is also an important step toward implementing more accurate and more efficient algorithms for SNPs detection. This work can also be used toward improving an already existing application. I present some of the most commonly used applications for SNP discovery as well as how and when ...
A Simple Mouthwash Method for Obtaining Genomic DNA in
A Simple Mouthwash Method for Obtaining Genomic DNA in

... or brushes, and saline rinse) or do not yield an adequate amount (urine, hair roots, and saliva) or quality (paraffin blocks) of DNA. Also, some of these methods require the samples to be stored in a preservative solution that is toxic, which makes it problematic for use by mail (buccal brushes and ...
as a PDF
as a PDF

... Health Grants NS23740 and HD18658. The costs of publication of generation of skeletal muscle isoformdiversity is as yet unexthis article were defrayed in part by the payment of page charges. plained. In humans, only one gene has been identified, that This article must therefore be hereby marked “adv ...
Woods Hole – Zebrafish Genetics and Development Bioinformatics
Woods Hole – Zebrafish Genetics and Development Bioinformatics

... BAC in the bottom box, and hit “Align”. Where does the coding sequence (ie. query) begin and end in the BAC sequence? Hit the ‘Dot Matrix’ view for a graphical look. The next steps would involve creating a targeting vector for homologous recombination. In this case, you could PCR sequences (1 – 1.5 ...
Phylogeography
Phylogeography

... particular clade) Dn – Nested clade distance (geographic relationship to other same level categories) I-T – average distance between interior and tip clades within nested group Use random permutation testing to test significance of associations ...
Assembly of microarrays for genome-wide measurement of
Assembly of microarrays for genome-wide measurement of

... amplification of mixtures of subclones from BACs, but found the ligation-mediated PCR procedure to be superior. Array printing. We used a custom built printer, employing a 4 x 4 array of quartz capillary tubes spaced on 3 mm centers to print ~70-100 μm diameter spots on 130 μm centers. We printed e ...
2/9/2014 Lab 2: Identifying Algae and Protists Objective
2/9/2014 Lab 2: Identifying Algae and Protists Objective

... organisms that couldn’t be seen with the naked eye. This experiment will help us see if there are any organisms because the contents we collected in the jar act as a mini “ecosystem”. The serial dilutions will help us further examine the types of organisms in the jar. Materials and Methods- 1) First ...
Myriad myPath® Melanoma Technical Specifications
Myriad myPath® Melanoma Technical Specifications

... Quality Control Measures A minimum of one no-RNA control and one human RNA control (with a previously determined Score) are run with each sample and analyzed to verify expected results. Housekeeper genes are also used as internal controls to measure the quality of a sample. Limitations of the Assay ...
6 Possible Alleles
6 Possible Alleles

... • Electrophorese PCR products • Analysis and interpretation of results ...
Prediction of Gene Function Using Gene Clusters and Genomic
Prediction of Gene Function Using Gene Clusters and Genomic

... promoters and terminators are not completely characterized. (2) Another methods uses a combination of gene expression data, functional annotation and other experimental data, which is primarily applicable to well studied genomes such as E.coli. (3) Finally, some methods rely on intergenic distance b ...
On the Mutational Topology of the Bacterial Genome
On the Mutational Topology of the Bacterial Genome

... repeated sequences [insertion sequence (IS) elements, rRNA operons, and other smaller repeat sequences] could not be defined and thus were excluded from the data. To account for this complication, we eliminated all the gaps that included IS or rRNA operons (other repeated sequences are too small to b ...
Expressing_CENH3_Orthologs
Expressing_CENH3_Orthologs

... kinetochore (1). The main protein that recruits other kinetochore proteins and assembles a functional centromere is the centromere-specific histone H3 (CENH3) which replaces the canonical histone H3 in centromeric chromatin (2). Conventional histone H3 is highly conserved due to its importance in DN ...
PAT
PAT

... PAT is a collaborating project between Ceres and San Diego Supercomputer Center: http://pat.sdsc.edu ...
< 1 ... 125 126 127 128 129 130 131 132 133 ... 359 >

Metagenomics



Metagenomics is the study of genetic material recovered directly from environmental samples. The broad field may also be referred to as environmental genomics, ecogenomics or community genomics. While traditional microbiology and microbial genome sequencing and genomics rely upon cultivated clonal cultures, early environmental gene sequencing cloned specific genes (often the 16S rRNA gene) to produce a profile of diversity in a natural sample. Such work revealed that the vast majority of microbial biodiversity had been missed by cultivation-based methods. Recent studies use either ""shotgun"" or PCR directed sequencing to get largely unbiased samples of all genes from all the members of the sampled communities. Because of its ability to reveal the previously hidden diversity of microscopic life, metagenomics offers a powerful lens for viewing the microbial world that has the potential to revolutionize understanding of the entire living world. As the price of DNA sequencing continues to fall, metagenomics now allows microbial ecology to be investigated at a much greater scale and detail than before.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report