Download Star Review

Star Review
What is Science Ch. 1
1. What is the difference between a hypothesis and a theory?
2. What are the benefits and drawbacks of models and theories?
3. What makes an experiment valid?
Biochemistry Ch. 6
4. What are enzymes?
5. What does the activity of an enzyme depend on? (4 things)
6. What are the four organic compounds, and what are the monomers of each?
7. How do proteins differ from one another? (2 things)
Cells Ch. 7
8. What is a semi-permeable membrane? Where do you find them?
9. What are the differences between prokaryotic and eukaryotic cells?
10. What do the endoplasmic reticulum (er) and the golgi apparatus do for the secretion of proteins?
11. What is the job of chloroplasts? (process)
12. What is the job of mitochondria? (process?)
13. How do cells maintain homeostasis?
Photosynthesis / Cellular Respiration Ch. 8
14. How do organisms get energy? Autotrophs / heterotrophs
15. What is the original source of energy for all organisms?
16. Where does photosynthesis take place?
17. What is photosynthesis? Explain and state the equation.
18. Where does respiration take place?
19. What is respiration? Explain and state equation (formula)
Cell Division Ch. 10
20. What is meiosis?
21. What cells undergo meiosis?
22. What accounts for variation among organisms on a genetic/meiosis level?
23. What is a zygote and when does it form?
24. How is an individuals sex determined?
Genetics Ch. 10/11
25. How do you determine what alleles are possible from a parent?
26. Rr x Rr …..what is the outcome of that cross if it is a regular complete dominant cross?
27. What would change if R were an X-linked trait?
28. Explain the law of segregation and Independent Assortment.
29. What is a pedigree and how do you use it? Draw a simple one to explain.
30. Why can alleles that are lethal in a homozygous individual be carried in a heterozygote and be
maintained in a gene pool?
Protein synthesis (transcription / translation) Ch. 12
31. What is transcription?
32. What is translation?
33. What is the matching RNA code for: TTGACCTCGATCAACTCTGAG?
34. What are the possible effects of a mutation in DNA?
35. Explain the structural differences between DNA and RNA?
36. What is the matching DNA code for: TTGACCTCGATCAACTCTGAG?
37. What is cell specialization? What are the actual differences between the cell’s activity?
Inheritance Ch. 11/13
Ch. 11
38. What does it mean if an allele is X-linked?
39. What does it mean if an allele is co-dominant?
40. What does it mean if an allele is incomplete dominant?
Ch. 13
41. How is genetic engineering (biotechnology) used to produce new biomedical and agricultural
products?
42. What is a restriction enzyme?
43. What is gel electrophoresis?
44. How do you insert a gene from an organism into bacterial DNA?
Evolution Ch. 15
45. Why does natural selection act on phenotype rather than genotype?
46. Explain the process of natural selection.
47. Why does variation within a species increase the likelihood that at least some members of a
species survive changing environmental conditions?
48. How can you analyze fossil evidence?
49. What is the difference between adaptation and evolution?
50. When are mutations formed and how?
51. What are the possible effects of genetic drift on the diversity of organisms in a population?
52. What types of populations are most affected by genetic drift?
53. What affect will reproductive or geographic isolation have on a population?
Ecology Ch. 4/2/5
Ch. 4
54. How are fluctuations in population size determined by the relative rates of birth, immigration,
emigration, and death?
Ch. 2
55. Nutrients are _______, while energy is ________?
56. Draw a simple carbon, water, and nitrogen cycle.
57. How much energy is passed from one trophic level to the next, what happens to the rest of the
energy?
Ch. 5
58. What is biodiversity?
Human Body Systems Ch. 32/33/34/35/37
Ch. 32
59. Explain muscle contraction using: actin, myosin, Ca2+, and ATP.
60. What is the role of the skin in fighting against infection?
61. How do the skeletal system, muscle system, and integumentary system help your body maintain
homeostasis?
Ch. 34
62. How do the respiratory and circulatory system help your body maintain homeostasis?
Ch. 37
63. What is the role of antibodies in the response to infection?
64. How do vaccines work?
65. What are the differences between bacteria and viruses? (talk about requirements for growth and
replication, body’s primary defense, infections, and treatments)
66. What does a person with AIDS eventually die from?
67. How does the immune system help the body maintain homeostasis?
Ch. 33
68. How does your nervous system mediate communication between your body and the outside
environment?
69. How does the nervous system send signals?
70. What are the roles of sensory neurons, interneurons, and motor neurons?
Ch. 35 71. How do feedback loops regulate conditions in the body?