Download SBI4U Translation

Protein Synthesis:
Translation
The Ribosome: Key Points
•
•
•
•
Consists of 2 subunits
Large Subunit (60S)
Small Subunit (40S)
mRNA is clamped by
the subunits
http://www-tc.pbs.org/wgbh/nova/photo51/images/pict-2001ribosome.jpg
The Ribosome: Key Points
• Ribosome moves toward the 3’ end of the
mRNA (5’ to 3’) direction
• Reads codons and adds amino acids to a
growing polypeptide chain
• Reading Frame – determines the
sequence in which the codons are read
5’
3’
CAUGCAUGGCAUC
• This is what the ribosome sees
• It reads the mRNA in codons in a 5’ to 3’ direction
(the ribosome moves toward the 3’ end of the
mRNA molecule)
• There are three possible “phases” the codons can
be read
5’
Here
Here
And here
3’
CAUGCAUGGCAUC
• There are three possible phases the codons can be
read
• This can lead to three completely different sequences!
• Thus it is vital that the mRNA is positioned correctly
within the ribosome  Why?
Try This!
• The following is the sequence of the coding DNA
strand in a prokaryote
• Determine the sequence of the transcribed mRNA
• Then, using the Genetic Code on p240, determine
the polypeptide chain
• How do you know where to start?
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3’
tRNA
• Delivers the
amino acids to
the ribosome
• How does a tRNA
know when to join
the ribosome?
tRNA
• The anticodons of some tRNAs recognize
more than one codon
• This is possible because the rules for base
pairing between the third base of the codon
and anticodon are relaxed (called the
wobble hypothesis)
– At the wobble position, U on the anticodon can
bind with A or G in the third position of a codon
• Why would this be beneficial?
The Wobble Hypothesis
http://www.mun.ca/biology/scarr/MGA2-03-30.jpg
• Ability of tRNA to recognize 2 or 3 different mRNA
codons
• The 3rd base of the tRNA anticodon “wobbles”, meaning
that it can hydrogen bond with more than one type of base
in the 3rd position of the codon
Elongation (refer to Fig 4 on p252)
• After the start codon is recognized (AUG –
methionine) the subsequent amino acids are
added
• The ribosome has two sites for tRNA
– A site (acceptor)
– P site (peptide)
• The “charged” tRNA carrying the next amino acid
in sequence enters the A site
• Then the ribosome moves to the next codon and
the “uncharged” tRNA is moved to the P site (the
exception to this rule is the start tRNA with
methionine that enters the P site directly)
• A peptide bond forms between the amino acids
and the uncharged tRNA is recycled back to the
cytoplasm
Translation
Elongation
• tRNA translocates to allow a new tRNA to bind to ribosomemRNA complex
http://library.thinkquest.org/C0123260/basic%20knowledge/images/basic%20knowledge/RNA/translation%20steps.jpg
Termination (refer to Fig 4 e & f on p252)
• Once the stop codon (UGA, UAG, or UAA)
is reached, the ribosome will come to a
halt (there are no corresponding tRNA’s)
• Then, a protein release factor comes in to
aid the release of the polypeptide chain
from the ribosome
• Translation of the gene of interest ends
• Alterations may occur – read p253
Homework
• Read section 5.4 which starts on page 250
• On page 254, do questions #1-4,6-9,10