Download Tps1 regulates the pentose phosphate pathway, nitrogen

Tps1 regulates the pentose phosphate pathway, nitrogen metabolism and fungal
virulence
Richard A. Wilson, Joanna M. Jenkinson, Robert P. Gibson, Jennifer A. Littlechild,
Zheng-Yi Wang1 and Nicholas J. Talbot*
School of Biosciences, University of Exeter, Geoffrey Pope Building, Stocker Road, EX4
4QD, United Kingdom.
Supplementary data.
Materials and methods.
Strains, manipulations and physiological tests.
Glucose minimal media (GMM) contains nitrate as sole nitrogen source, unless otherwise
stated. For spore counts, 10 mm2 blocks of mycelium were transferred to the centre of
each plate, and the strains grown for 10 days at 26 oC. Colony diameters were measured
at this time, and the spores harvested in sterile distilled water, vortexed vigorously and
counted on a haemocytometer (Corning). Spores were counted independently four times.
The yeast strains used in this study were tps1::ura3:GAL1(p):MgTPS1:URA3
(yeast tps1 deletion strain transformed with MgTPS1), tps1::ura3:GAL1(p): URA3
(yeast tps1 deletion strain transformed with empty vector), W303 (isogenic strain of S.
cerevisiae with functional TPS1 gene) and tps1::ura3 (tps1 deletion strain MB062).
Rice plant infections were made as described previously (Talbot et al., 1993).
using a susceptible dwarf Indica rice (Oryza sativa) cultivar, CO-39 (Valent et al., 1991).
Fungal spores were isolated from 12 –14 day-old plate cultures and spray-inoculated onto
rice plants of cultivar CO-39 in 0.2 % gelatin at a concentration of 5 x 104 spores / ml and
disease symptoms allowed to develop for 96-144 hrs.
Nucleic acid, protein, trehalose and sugar phosphate extractions.
DNA was extracted, as described previously (Talbot et al., 1993), from lyophilised
samples of mycelium following 48 hr growth in liquid complete media at 26 oC. RNA
extraction from mycelium followed the method of Timberlake (1980).
Total cell protein was extracted from known amounts of dry mycelium using a
modification of the method described by Cove (1966). Following grinding of mycelium
in eppendorf tubes using sterilised tooth picks, 1 ml of 0.1 M Na2HPO4, pH 7.5, was
added, and the sample vortexed briefly before centrifugation at 17,000 x g for 5 min.
Each sample was extracted in triplicate, and the supernatant stored at – 80 oC.
Trehalose and trehalose-6 - phosphate was extracted from lyophilised mycelium
following 48 hr growth in complete media. A known amount of mycelium was ground to
a fine powder using a mortar and pestle. 10 ml of a solution of six parts methanol
(Fisher) to 2.5 parts methylene dichloride (BDH) to 1.5 parts sterile distilled water was
added, followed by incubation of the sample at 4 oC for 30 min. Following 20 minutes
centrifugation at 1240 x g, the supernatant was decanted and the pellet re-extracted with 5
ml of the methanol: methylene dichloride: water solution. The resulting supernatants
were pooled and 7.5 ml deionised water and 7.5 ml methylene dichloride was added.
After 20 minutes centrifugation at 3440 x g, the aqueous phase was removed and
lyophilised. The extract was re-suspended in 1 ml deionised water and stored at – 20 oC.
All other mycelial sugar phosphates were extracted for HPAE-PAD analysis as
follows. Following growth in liquid media, mycelium was harvested rapidly on Miracloth
(Calbiochem) and plunged into ice cold buffered methanol (0.1 M HEPES pH 7.5, 60 %
methanol). Samples were kept below – 20 oC in a dry ice and ethanol bath for three min
before centrifugation at 5000 x g at – 20 oC for six min. The methanol layer was
removed and the samples lyophilised. 20 – 100 mg of dry mycelium was ground and
added to 2.5 ml of buffered ethanol solution (10 mM HEPES, pH 7.5, 75 % ethanol),
followed by incubation at 80 oC for 5 min. 0.5 mM mannose–6-phosphate was added as
internal standard. The samples were evaporated at 45 oC for 2 hours, followed by
resuspension in 200 l HPLC electrochemical grade water (Fisher Scientific). These
samples were then further purified using a StraraTM anion-exchange SAX column
(Phenomenex) followed by elution in 800 l HPLC grade water. Samples were stored at
– 20 oC in split-septum vials (Dionex).
Enzyme activity assays.
Determination of nitrate reductase activity followed Cove (1966), in which nitrite
produced from 10 mM nitrate in the presence of cell protein extract was reacted with
sulphanilamide and (1-Naphthyl) ethylenediamine dihydrochloride to form a nitrite
coloured complex which could be quantified at A540nm. The reaction was performed in
the presence of 2.5 mM sodium sulphate to inhibit nitrite reductase activity (Garrett and
Cove, 1976), and 2 mM NADPH. Quantification of the nitrite colour complex at two
time points allowed calculation of nitrate reductase activity.
Enzymatic activities of phosphoglucose isomerase (modified from Noltmann et
al., 1961), fructose-6-phosphate kinase (Noltmann et al., 1961), glyceraldehyde-3phosphate (Duggleby and Dennis, 1974), glutamine synthetase (Kingdon et al., 1968) and
glycogen synthase (Danforth, 1965) were determined by measuring NADH consumption,
at A340, at two time points.
Hexokinase (Bergmeyer et al., 1983), glycogen
phosphorylase (Mayer et al., 1992), glucose-6-phosphate dehydrogenase (Noltmann et
al.,
1961),
6-phophogluconic
phosphoglucomutase (Lowry
dehydrogenase
(Bergmeyer
et
al.,
1974)
and
and Passonneau, 1969) activities were determined by
measuring NADPH production, at A340, at two time points. In these reactions, product
formation is stoichiometric to changes in NADPH or NADH concentration. Protocols
were obtained from the Sigma website (www.sigma.com).
Determination of hexokinase inhibition by T6P followed Eastmond et al 2002.
Metabolite identification and quantification.
Sugar phosphates were quantified using HPAED-PAD analysis on mycelial extracts
using a BioLC system (Dionex) consisting of a Dionex GP50 gradient pump, a Dionex
AS50 autosampler and a Dionex ED50A electrochemical detector attached to a
Chromeleon data management system.
Sugar phosphates were separated for prior
filtration before final analysis using a CarboPac PA-100 column (4 x 250 mm, Dionex)
and a CarboPac PA-100 guard column (4 x 50 mm, Dionex). Two running buffers were
required: 10 mM sodium hydroxide with 50 or 100 mM sodium acetate. A column
temperature of 22 oC and a flow of 1 ml min-1 were routinely used. Standard solutions,
necessary for sugar phosphate quantification, were prepared using the highest available
grade (Sigma). Glucose-6-phosphate and fructose-1,6-bisphosphate levels were also
quantified enzymatically. Extracts from each strain were heated to 65
oC
for 15 minutes
before incubating with NADP and G-6-PDH (sigma), to measure glucose-6-phosphate
(modified from Noltmann et al., 1961), or NADH, aldolase (Sigma) and
glycerophosphate dehydrogenase/ triosephosphate isomerase (Sigma) for measuring
fructose-1,6-bisphosphate (modified from Kelly et al 1985)
Glycogen was extracted from mycelium in 0.1 M Na2HPO4, pH 7.5. 50 l of cell
extract was then incubated overnight at 37oC with 29 l amyloglucosidase (Roche) and
10 l -amylase (Sigma) to generate glucose from glycogen. The supernatant from each
sample was analysed with a glucose assay kit (Roche) and compared to control reactions
where amyloglucosidase and -amylase were replaced with distilled water. The
difference in glucose concentrations between the two treatments gives the amount of
glycogen present in the sample.
After grinding dry mycelium in 0.1 M Na2HPO4, pH 7.5, 50 l of cell extract was
added to a 1 ml solution of excess nitrate in the presence of excess purified nitrate
reductase (Sigma) and in the absence of exogenous NADPH. The reaction proceeded to
completion (ie the complete consumption of endogenous NADPH) and the resulting
nitrite was reacted with sulfanilamide and (1-Naphthyl) ethylenediamine, as described
above, to determine nitrite concentration.
The concentration of nitrite formed was
therefore directly equivalent to the amount of NADPH in the extract.
Mycelial concentrations of NADPH were determined enzymatically.
After
grinding dry mycelium in 0.1 M Na2HPO4, pH 7.5, 50 l of cell extract was added to a 1
ml solution of excess nitrate in the presence of excess purified nitrate reductase (Sigma)
and in the absence of exogenous NADPH. The reaction proceeded to completion (ie the
complete consumption of endogenous NADPH) and the resulting nitrite was reacted with
sulfanilamide and (1-Naphthyl) ethylenediamine, as described above, to determine nitrite
concentration. The concentration of nitrite formed was therefore directly equivalent to
the amount of NADPH in the extract.
Mycelial concentrations of ATP were determined enzymatically. Following
grinding of dry mycelium in 0.1 M Na2HPO4, pH 7.5, 50 l of cell extract was added to a
1 ml solution of excess glucose in the presence of 14 mM NADP and an enzyme solution
containing hexokinase and glucose-6-phosphate dehydrogenase (Roche).
NADPH
production was monitored spectrophotometrically at 340 nm, and the reaction was run to
completion. The amount of NADPH formed was equivalent to the concentration of ATP
in the sample.
Construction of targeted gene replacement and TPS1 complementation vectors.
Gene replacement of TPS3 employed the hygromycin phosphotransferase encoding gene
Hph under the control of the A. nidulans TrpC promoter (Carroll et al., 1994). The
HXK1 gene replacement vector, and tps1 complementation vectors encoding variants of
the Tps1 protein, utilised the M. grisea ILV1 gene conferring sulphonylurea urea
resistance (Carroll et al., 1994).
The MgTps1 yeast complementation vector was constructed using the open
reading frame of a sequenced 2.2 kb cDNA MgTps1 clone (N.J. Talbot and A.J. Foster,
unpublished results). Primers were designed to amplify the TPS1 coding sequence and
introduce
a
BamHI
restriction
site
at
the
5'
end
(TPS1CBAM5:
GGCGGATCCATGGGCAGCGTTGAA, BamHI site underlined) and a EcoRI restriction
site at the 3' end (TPS1CECO3N: GGTGAATTCTCAGTTTCCCTCCGT, EcoRI site
underlined). The resulting amplicon was subcloned into pYES2 (Invitrogen).
Transformation of S. cerevisiae tps1 strain MB062 with pYES2+MgTPS1 to give
tps1::ura3:GAL1(p):MgTPS1:URA3followed standard procedures (Agatep et al., 2000).
The coding sequence of TPS3, designated MG08707.5, was identified from the
M. grisea genome sequence by homology to S. cerevisiae TPS3 (accession number
NC_001145)
using
the
BLAST
facility
at
the
Broad
Institute
(http://www.broad.mit.edu/cgi-bin/annotation/magnaporthe/blast). Pairwise alignments
of M. grisea TPS3 to S. cerevisiae TPS1, TPS2, TPS3 and TSL1 gene sequences
confirmed this gene was more closely related to yeast TPS3 (not shown). The coding
sequence of M. grisea TPS3, including 1 kb of sequence lying up- and downstream of the
gene, was then retrieved from the database and two primers were synthesised from the
sequence: TPS3F2 encoding GGCCATCCCACATGGG, and TPS3R1 encoding
GCAGTGCTTGCTGCCG. These primers, in conjunction with 5 ng of Guy-11 DNA
and TaqPlusR polymerase (Stratagene), following the manufacturers PCR protocol and
annealing temperatures of 55 oC, were used to amplify a 7.8 kb PCR fragment which was
subcloned into pGEM-T (Promega), following the manufacturers protocol, to give
pRAW1. A 5.7 kb EcoRV-EcoRV fragment, containing the complete TPS3 coding
sequence, was digested out of pRAW1 to leave the 1 kb flanks. These were incubated
with Taq polymerase (Promega) at 74 oC for 30 min in the presence of 0.2 mM dTTP to
produce T-tail overhangs at the 5’ ends of the digested vector, and were then ligated to
the A-tailed Hph cassette to give pRAW2, representing Hph flanked by 1 kb of TPS3 upand downstream sequences.
transformation.
pRAW2 was linearised with ApaI and SalI prior to
tps3 mutants were selected initially on the basis of hygromycin
resistance.
A single hexokinase-encoding HXK1 gene sequence, MG09289, was retrieved
from the M. grisea genome using BLASTX with the yeast HXK2 gene (accession
number AAA34699). It has high identity (54 %) to the yeast HXK2 gene, and southern
blot analysis suggested the gene was single copy (not shown). A hypothetical protein
encoded in the M. grisea genome, MG03041, has 64 % identity to a glucokinase from
Hypocrea jecorina (not shown), and likely encodes a the sole glucokinase gene of M.
grisea. A 4.64 kb amplicon containing the 1.7 kb HXK1 gene plus 1.81 kb and 1.15 kb
flanking regions was amplified from genomic DNA using the primers HEXCOSAC5 and
HEXCOSAC3
(CAATTGCCCCGCGGTATCCCTC
and
CTTGAAGGCCGCGGTCGTCGCC respectively, natural SacII sites underlined),
digested with SacII and ligated into pGEM5Zf (Promega). the The HXK1 gene was
excised as a 2.56 kb EcoRI – BglII fragment and replaced with the ILV1 gene to form the
hxk1 knock-out vector pHEX-KO.
Functional analysis of the Tps1 protein was achieved by complementation of the
tps1 mutant with full-length TPS1 coding sequences carrying nucleotide changes that
would translate into amino acid substitution of residues involved in trehalose
biosynthesis. Foster et al. (2003) had demonstrated an 8 kb PstI fragment containing the
TPS1 coding sequence with flanking regions was sufficient to complement the tps1
mutant in vivo. We subcloned the 8 kb PstI fragment into the sulphonylurea-carrying
vector pCB1532 (Carroll et al., 1994) to give pRAW8, and removed a 2 kb SmaI
fragment to give pRAW9. To facilitate site directed mutagenesis, a 2.8 kb NotI and NdeI
fragment was digested from pRAW9 and subcloned into pGEM5Zf to give p2.1.
Following mutagenesis of p2.1, the 2.8 kb NotI-NdeI fragment was liberated from p2.1
and ligated back into pRAW9 to generate the suite of mutant TPS1 genes which were
subsequently transformed into tps1. tps1 strains carrying the TPS1 variants were
selected initially by resistance to sulphonylurea.
Site directed mutagenesis was performed on p2.1 using the GenEditorTM site
directed mutagenesis kit of Promega, following the manufacturers protocol. Mutagenic
primers were designed to introduce nucleotide changes to the TPS1 coding region,
resulting in amino acid substitution. In addition, novel restriction sites were incorporated
that would expedite identification, by Southern analysis, of tps1 strains carrying the
mutagenic TPS1 sequences after transformation. The primers used were as follows:
GACTTTTGCTCATCTCCAATTGCCTGCCCATCACCATCAAG, introducing an MfeI
restriction
site
(underlined)
and
encoding
the
amino
acid
change
R22G.
GTCCTCTGGTGCACTGGTCACCGGCCTG, introducing an ApaLI restriction site
(underlined)
and
encoding
the
amino
acid
change
G22A.
GCCGACAGGCACGTGAACGGGTTTGCCAG, introducing a PmlI restriction site
(underlined)
and
encoding
the
amino
acid
change
Y99V.
GATTTGGGTCCACGTGTACCACCTGATG, introducing a PmlI restriction site
(underlined)
and
encoding
the
amino
acid
change
D153G.
GCAGACTCGATCCTCAGCCCACTTTTCCACTAC, introducing a BbvCI restriction
site (underlined) and encoding the amino acid change W108S.
ScTPS1 and otsA complementation vectors were constructed as follows. ScTps1
(accession number EF110520) was amplified from yeast cells using the primers
Yeasttps1F
(ATGACTACGGATAACG)
and
Yeasttps1R
(TCAGTTTTTGGTGGCAGAGG). otsA (accession number AY587539) was amplified
from
E.
coli
strain
DH5
using
(ATGAGTCGTTTAGTCGTAGTATCTAACCGG)
the
primers
OtsAF1
and
OtsAR1
(CTACGCAAGCTTTGGAAAGGTAGCACGACATAGTCAATG).
Amplification
followed manufacturer's protocol and annealing temperatures of 65 oC. Both amplified
fragments were subcloned into pGEM-T (Pomega) and oriented with the PstI site of the
polycloning site located downstream of the ScTps1 and otsA coding sequences. A 2.8 kb
SalI fragment encoding ILV1 was then introduced into the vector. Next, the TPS1
terminator sequence was introduced at the 3' PstI site following amplification of Guy-11
genomic
DNA
with
(CATCTGCGGTCTCTCTTTCATAAACAGGTTGTGCC)
3'Tps1-pst1-F1
and
3'Tps1-pst1-R1
(GATTCTGCAGAACGACGCCGA). Finally, the 5' promoter region of MgTPS1 was
amplified
from
Guy-11
genomic
DNA
(CTCCGCGGATCTGCCCCCGCCCAGGATTGAA)
using
and
Tps1promF1
Tps1promR1
(GAGCCGCGGTTGACGAGTGTGCTGGAGCTTGATTCTTG) and subcloned into the
SacII site to the 5' of ScTPS1 and otsA coding sequences.
Protein Modelling
The M. grisea TPS1 and E.coli OtsA amino acid sequences were aligned using ClustalW
(Higgins et al 1994) with the BLOSUM64 matrix to produce a truncated version of the
TPS1 enzyme (residues Gly14 – Leu479) for homology modelling. OtsA complexes
(1gz5, 1uqu & 1uqt, Gibson et al 2002; Gibson et al 2004) provided the structural
templates for the homology modelling program MODELLER to construct geometrically
refined, energy minimised models (Sali and Blundell, 1993). Iterative rounds of
refinement were necessary for loop regions of the model with the final model chosen to
minimise unfavourable electrical and steric clashes. Evaluation of the models was
conducted using the internal DOPE energy scoring function and the protein validation
software PROCHECK (Laskowski et al 1993). Visualisation and figures of the model
structure was performed using the PyMOL molecular graphics suite (DeLano, 2002).
Expression analysis.
MPG1 gene expression was examined by Northern blot analysis using a 3.75 kb XbaIHindIII genomic DNA fragment of the MPG1 gene (Soanes et al., 2002). NMR1, NIA1,
NII1, -tubulin and PTH11 gene expression was examined using semi-quantitative RT-
PCR (one-step RT-PCR kit purchased from Clontech). MG00156.4, encoding MgNMR1,
and MG05871.4, encoding PTH11, were identified from the M. grisea genome using
BLASTX against the A. nidulans gene nmrA (Accession number AF041976) and the
genome sequence of PTH11 (Accession number AF119672), respectively. Primers for
RT-PCR
of
MgNMR1
(NMRF1:
GGCGGCTCAATCGTTG
and
NMRR1:
CAACCACTCAGCCCAGG) and PTH11 (PTH11F1: GGTTGCATTCACCCGG and
PTH11R: GGCGACAAGACCAATGG) were designed from the sequences and used to
amplify gene fragments from 50 ng of RNA using 25-35 cycles of PCR, following
manufacturers protocol, and annealing temperatures of 55
o
C.
NIA1 (encoding
MG06062) was amplified using primers NIA1F (TGGCAACCGAACAGAGGAAGAC)
and
NIAR1
(TCAGAAAAACAACAAATCATCATCCTTCC).
NII1
(encoding
MG00634) was amplified using primers NIIF1 (CTCTCCATCGCCACCTTTGAGG)
and NIIR1 (TCACCAATCCGGCGCG). -tubulin (encoding MG00604) was amplified
using the primers b-TUBF1 (CCCGCGGCCTCAAGATGTCGT) and b-TUBR1
(GCCTCCTCCTCGTACTCCTCTTCCTCC). PCR cycles were as above but with
annealing temperatures of 63 oC. Quantification of the resulting cDNA bands used the
ImageMaster TotalLab software programme, and normalisation of expression data was
achieved by quantification of actin expression using the primers ACTR1 and ACTRT2
(GTCACCATGGTATCATGATT and AGATCTTCATCAGGTAGTCG, respectively)
designed from the actin coding sequence MG03982.4.
References not in main text
Carroll AM, Sweigard JA, Valent B (1994) Improved vectors for selecting resistance to
hygromycin. Fungal Genet Newsl 41: 22
Bergmeyer, H.U. (1974) Methods of Enzymatic Analysis, Second Edition, Volume I,
500-501
Bergmeyer HU, Grassi M, Walter HE (1983) Methods of enzymatic analysis (Bergmeyer,
H.U. ed) 3rd ed., II: pp. 222-223, Verlag Chemie, Deefield Beach, FL
Danforth WH (1965) Glycogen synthetase activity in skeletal muscle. Interconversion of
two forms and control of glycogen synthesis. J Biol Chem 240: 588-593
DeLano W L (2002) The PyMOL Molecular Graphics System on World Wide Web
http://www.pymol.org
Duggleby RG, Dennis DT (1974) Nicotinamide adenine dinucleotide-specific
glyceraldehyde 3-phosphate dehydrogenase from Pisum sativum. Assay and steady state
kinetics. J Biol Chem 249: 167-174
Higgins D, Thompson J, Gibson T, Thompson J D, Higgins D G, Gibson T J (1994)
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment
through sequence weighting,position-specific gap penalties and weight matrix choice.
Nucleic Acids Res 22:4673-4680
Garrett RH, Cove,DJ (1976) Formation of NADPH-nitrate reductase activity in vitro
from Aspergillus nidulans niaD and cnx mutants. Mol Gen Genet 149: 179-186
Gibson RP, Tarling TA, Roberts S Withers SG, Davies GJ (2004) The donor subsite of
trehalose-6-phosphate synthase: binary complexes with UDP-glucose and UDP-2-deoxy2-fluoro-glucose at 2A resolution J Biol Chem. 16; 1950-1955
Kelly GJ, Murkerjee U, Holtum JAM, Latzko E (1985) Purification, kinetic and
regulatory properties of phosphofructokinase from Chlorella pyrenoidosa. Plant Cell
Physiol 26: 301 - 307
Kingdon HS, Hubbard JS, Stadtman ER (1968) Regulation of glutamine synthetase. XI.
The nature and implications of a lag phase in the Escherichia coli glutamine synthetase
reaction. Biochemistry 7: 2136-2142
Laskowski RA, MacArthur MW, Moss DS, Thornton J M (1993). PROCHECK: a
program to check the stereochemical quality of protein structures. J Appl Cryst 26: 283291
Lowry OH, Passonneau, JV (1969) Phosphoglucomutase kinetics with the phosphates of
fructose, glucose, mannose, ribose, and galactose. J Biol Chem 244: 910-916
Mayer D, Seelmann-Eggebert G, Letsch I (1992) Glycogen phosphorylase isoenzymes
from hepatoma 3924A and from a non-tumorigenic liver cell line. Comparison with the
liver and brain enzymes. Biochem J 282: 665-673
Noltmann EA, Gubler CJ, Kuby SA (1961) Glucose 6-phosphate dehydrogenase
(Zwischenferment). I. Isolation of the crystalline enzyme from yeast. J Biol Chem 236:
1225-1230
Šali A, Blundell TL (1993) Comparative protein modelling by satisfaction of spatial
restraints. J Mol Biol 234: 779-815
Supplemental figure legend
Supplemental Figure 1. Additional sugar phosphate analyses and determination of
enzyme activities.
A. Fructose-1,6-bisphosphate levels are not elevated in tps1. Guy-11 and tps1
strains were grown for 48 hr in CM followed by growth in GMM with nitrate
as sole nitrogen source, for 16 hr. Bars represent the standard of three
independent analyses.
B. Enzyme activities of phosphofructokinase and phosphoglucose isomerase
from Guy-11 and tps1 strains grown in CM for 48 hr followed by growth in
GMM with NO3- for 16 hr. Bars represent standard error of three independent
replicates.
C. Glucose-6-phosphate accumulation in mycelium of M. grisea Guy-11,
tps1and tps3. Mycelium was grown in CM for 48 h before transfer to
GMM with nitrate as sole nitrogen source (closed bars) or GMM with
ammonium (open bars) for 16 h. Error bars represent standard deviation of
three replications of the experiment.
D. The effect of glucose-6-phosphate on glucose-6-phosphate dehydrogenase
activity from mycelium of M. grisea Guy-11. Mycelium was grown in CM for
48 h before transfer to GMM with nitrate as sole nitrogen source (closed bars)
for 16 hr. Error bars represent standard deviation of three replications of the
experiment. Glucose-6-phosphate was added in increments up to 100 mM. A
decrease in G-6-PDH activity was only seen at this high, non-physiological
concentration.
E. Glucose-6-phosphate accumulation in mycelium of M. grisea Guy-11, tps1,
tps3, tps1::Tps1R22G, tps1::Tps1Y99V, tps1::Tps1W108S and
tps1::Tps1D153G. Mycelium was grown in CM for 48 h. Error bars represent
standard deviation of three replications of the experiment.
Supplemental Figure 2. NADPH levels are not elevated during growth of Guy-11 and
tps1 strains on nitrite-containing compared to ammonium- containing media. Strains
were grown in CM for 48 hr followed by 16 hr in nitrite or ammonium-containing media.
Bars represent standard error of three separate replicates.
Supplemental Figure 3. Cross-eyed stereo figures of the mutated residues of M. grisea
Tps1 and their effect on G6P binding. Residues in the wild type are (clockwise from top)
Trp108, Asp153, Tyr99 and Arg22. The locations of glucose-6-phosphate (green and red)
and UDP-glucose (blue) are based on the template structures to indicate their proximity
to the mutated residues All residues except Trp108 form hydrogen bonds to G6P; Asp153
forms hydrogen bonds to the 2’-OH and 3’-OH moieties of G6P; Arg22 and Tyr99 form
hydrogen bonds with the phosphate portion of G6P. Trp108 provides a possible selective
role for the alpha sugar anomer caused by steric hindrance of the indole moiety.
Hydrogen bonds are indicated by dashed yellow lines. Solvent accessible surfaces are
shown for the wild type Trp108 residue, G6P and the mutant W108S.
A. I) Close up of the wild type G6P binding pocket.
II) The amino acid change D153G results in loss of the only hydrogen bond
contacts to the 2'-OH and 3'-OH moieties of G6P.
III) The amino acid change R22G results in loss of a hydrogen contact to the
phosphate moiety of G6P.
B.IV) Wild type G6P binding site showing accessible solvent surface of Trp 108.
V) The amino acid change W103S results in a reduction of the solvent
accessible surface at this position and eliminates steric hindrance of the G6P indole
moiety.
VI) The amino acid change Y99V results in loss of a hydrogen bond contact to
the phosphate moety of G6P.
Supplemental Figure 4. Control of virulence gene expression by M. grisea Tps1.
A. Expression of MPG1 was determined by Northern blot analysis. RNA was
extracted from strains grown in CM for 48 hr followed by growth in GMM
with nitrate (NO3-) or ammonium (NH4+) as sole nitrogen source for 16 hr.
B.. PTH11gene expression was determined by RT-PCR analysis. RNA was
extracted from strains grown in CM for 48 hr followed by growth in GMM
with nitrate (NO3-) or ammonium (NH4+) as sole nitrogen source for 16 hr.
RT-PCR of PTH11 expression was performed in triplicate and values are
given relative to expression of PTH11 from Guy-11 grown in GMM with
nitrate. Values were normalised using actin, and bars represent standard error.
Supplemental Table 1. Growth of Guy-11 and tps1 on glucose minimal media
supplemented with individual amino acids. A uniform amount of Guy-11 and tps1 was
used to prepare plate cultures which were inoculated at 26 oC for 11 days.
Media Constituents
CM
GMM 1
GMM + Alanine 2
GMM + Arginine
GMM + Asparagine
GMM + Aspartate
GMM + Cysteine
GMM + Glutamate
GMM + Glutamine
GMM + Glycine
GMM + Histidine
GMM + Isoleucine
GMM + Leucine
GMM + Lysine
GMM + Methionine
GMM + Phenylalanine
GMM + Proline
GMM + Serine
GMM + Threonine
GMM + Tryptophan
GMM + Tyrosine
GMM + Valine
Guy-11
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
tps1
+++
++
++
++
+
+
++
++
+
+
+
++
+
+
+
++
+
+
+
+
1
GMM contains nitrate as nitrogen source.
2
GMM contains single amino acid supplementation in addition to nitrate as nitrogen
source.