Download Transcriptional activation by the nuclear protein Hap50

RESEARCH ARTICLE
1839
Transcriptional activation by the human Hsp70associating protein Hap50
Yilmaz Niyaz, Matthias Zeiner and Ulrich Gehring*
Ruprecht-Karls-Universität Heidelberg, Biochemie-Zentrum Heidelberg, Biologische Chemie, Im Neuenheimer Feld 501, D-69120 Heidelberg,
Germany
*Author for correspondence (e-mail: [email protected])
Accepted 22 February 2001
Journal of Cell Science 114, 1839-1845 © The Company of Biologists Ltd
SUMMARY
We investigated human Hap50, the large isoform of the
previously characterized Hsp70/Hsc70-associating protein
Hap46, also called BAG-1, for effects on transcriptional
activities. Overproduction by transient transfection led
to enhanced expression of reporter gene constructs in
various cell types using different promoters, suggesting
independence of promoter type. Similarly, overexpression
of Hap50 resulted in increased levels of poly(A)+ mRNAs in
HeLa, COS-7, 3T3 and HTC cells. Concomitantly, the
expression of some selected endogenous genes, such as
those coding for c-Jun and the glucocorticoid receptor, was
enhanced significantly relative to actin. Nuclear runoff
transcription assays using HeLa cells showed that the effect
is caused by increased transcription rates rather than
mRNA stabilization. Activation of transcription by Hap50
occurred at 37°C and did not require prior thermal stress,
as is the case for Hap46. In accordance with these biological
effects, Hap50 is localized exclusively in the nuclear
compartment of different cell types, whereas Hap46 is
mostly cytoplasmic in unstressed cells, as revealed by use
of fusion constructs with green fluorescent protein. High
cellular levels of Hap50 were found to make cells less
susceptible to adverse environmental effects such as heat
stress. Our data suggest that Hap50 is a nuclear protein
that acts in cells to increase the transcription of various
genes.
INTRODUCTION
Although binding to Hsp70s involves the C-terminal region
of Hap46/BAG-1 (Takayama et al., 1998; Takayama et al.,
1999), a function for the N-terminal portion of the polypeptide
has only recently been recognized. Direct interaction with
DNA makes use of this part of the molecule (Zeiner et al.,
1999), which contains clusters of basic amino acid residues
and glutamic acid-rich repeats (Zeiner and Gehring, 1995).
Furthermore, Hap46 can stimulate overall transcription in vitro
but, in intact cells, heat stress was found to be a prerequisite
for transcriptional activation (Zeiner et al., 1999).
Mammalian cells can express several isoforms of
Hap46/BAG-1 proteins (Packham et al., 1997; Takayama et al.,
1998; Yang et al., 1998), but the relative levels of individual
forms vary largely between cell lines (Brimmell et al., 1999).
The largest of these isoforms was first detected by
immunoblotting and was found to originate from a noncanonical CUG translational start codon (Packham et al.,
1997). Because it has an apparent molecular mass of about 50
kDa we call it Hap50, implying close relation to Hap46. This
large isoform has previously been detected in several cell lines
and tissues (Packham et al., 1997; Takayama et al., 1998; Yang
et al., 1998; Yang et al., 1999a; Yang et al., 1999b; Crocoll et
al., 2000). Compared with Hap46, the isoform Hap50 is longer
at the N-terminus by 71 amino acid residues (Packham et al.,
1997). We wondered whether Hap50 may similarly affect
transcriptional activities in cells upon overexpression. This is
indeed what we observed in the present study; however, in
striking contrast to Hap46, thermal stress is not required for
The ubiquitously expressed mammalian protein Hap46, also
called BAG-1, BAG-1M or p46 BAG-1, has been described to
interact with a great variety of proteins, most notably with
various transcription factors such as nuclear receptors c-Jun, cFos, CREB and c-Myc (Zeiner and Gehring, 1995; Zeiner et
al., 1997; Froesch et al., 1998; Kullmann et al., 1998; Liu et
al., 1998; Kanelakis et al., 1999, Schneikert et al., 2000; Guzey
et al., 2000). Significantly, Hap46/BAG-1 was found to
associate directly with members of the 70 kDa heat shock
protein family (i.e. stress-inducible Hsp70 and constitutively
expressed Hsc70) (reviewed by Höhfeld, 1998), hence the
designation Hap46 for Hsp70/Hsc70-associating protein of
apparent molecular mass 46 kDa (Gebauer et al., 1997; Zeiner
et al., 1997). Most likely, the majority of the above interactions
with factors that are structurally very different are mediated by
Hsp70 or Hsc70 (Zeiner et al., 1997; Bimston et al., 1998;
Gebauer et al., 1998), as these molecular chaperones complex
with a great variety of proteins by making use of their highly
homologous carboxy terminal substrate binding domains. By
contrast, Hap46/BAG-1 interacts with the amino terminal ATPbinding domain of Hsp70 or Hsc70 (Höhfeld, 1998; Takayama
et al., 1998; Petersen et al., 2001). Thus Hap46/BAG-1 together
with Hsp70s and various other proteins can readily form
ternary complexes, as was demonstrated in vitro for several
model proteins (Zeiner et al., 1997; Bimston et al., 1998),
including c-Jun.
Key words: BAG-1, c-Jun, c-Fos, Estrogen receptor, Glucocorticoid
receptor, Hap46, Hap50, Hsp70, Hsc70
1840
JOURNAL OF CELL SCIENCE 114 (10)
Hap50 to produce this effect. This observation coincides with
the localization of Hap50 in cell nuclei under normal
physiological conditions.
MATERIALS AND METHODS
Plasmids
The cDNA encoding Hap50 was amplified by PCR from the original
template (Zeiner and Gehring, 1995) using primers 5′ ATAGAAGCTTCAAGTGCGGGCATGGCTCAGCG 3′ and 5′ TGGAATTCTGCTACACCTCACTCGGC 3′, thereby introducing HindIII and EcoRI
restriction sites. The Hap50 cDNA was inserted into HindIII and
EcoRI sites of plasmid pcDNA3.1/HisA (Invitrogen) from which the
polyhistidine coding sequence had been removed with HindIII.
The fusion construct of Hap50 with the green fluorescent protein
(GFP) was generated by PCR from the original cDNA template with
primers 5′ ATAGAAGCTTCAAGTGCGGGCATGGCTCAGCG 3′
and 5′ AAAGGATCCACACCTAACTCGGCCAG 3′, followed by
inserting the Hap50 cDNA into HindIII and BamHI sites of pEGFPN1 (CLONTECH). The CTG initiation codon was hereby changed to
ATG in both constructs to improve expression of the Hap50 isoform.
The Hap46-GFP construct was the same as before (Zeiner et al.,
1999).
The
vector
pcDNA3/CAT
(Invitrogen)
contains
the
chloramphenicol acetyltransferase (CAT) gene under control of the
cytomegalovirus (CMV) promoter. CAT expression from reporter
plasmid pBL8 CAT is driven by the Herpes simplex type 1 thymidine
kinase (TK) promoter coupled to glucocorticoid response elements
(GREs). The pColl reporter plasmid codes for CAT under control of
the human collagenase promoter (Angel et al., 1987).
Cell culture and transfections
Human HeLa, monkey COS-7, mouse Swiss 3T3, and rat HTC
hepatoma cells were grown in RPMI 1640 medium supplemented
with 10% fetal calf serum. Cell viability was ascertained by trypan
blue exclusion. For detailed microscopic analysis, a Leica TCS SP
MP instrument (Leica) was used. For metabolic labelling, cells were
treated as above but, 6 hours before harvesting, received phosphatefree medium supplemented with 200 µCi [33P]phosphoric acid (4000
Ci/mmol, ICN) per 50 mm plate
Transfections were with 15 µl FuGENE 6 Transfection Reagent
(Roche Molecular Biochemicals) and 5 µg Hap50 expression or
control vector (either the empty vector or vector containing Hap50
DNA in antisense orientation) per 50 mm plate. Typically, 50-70% of
cells turned out to be transfected, as determined by use of the GFP
cDNA. In experiments with reporter plasmids, 4 µg Hap50 expression
vector and 1 µg reporter plasmid were used. For testing reporter gene
expression under control of the collagenase promoter or the TK
promoter coupled to GREs, cells were cultured in the presence of 50
nM 12-O-tetradecanoylphorbol-13-acetate (TPA) (Sigma) or 1 µM
dexamethasone (Sigma), respectively. Omitting induction by TPA or
dexamethasone resulted in negligible levels of CAT activity (0.03 to
0.05% of controls). Cells were harvested 48 hours after transfection
either for RNA isolation or for CAT assays (Ausubel et al., 1995). In
some experiments (Fig. 3; Fig. 5), 24 hours after transfection a 42°C
heat shock was applied for 2 hours and cells were then further
incubated at 37°C for another 24 hours before analysis. In the
experiment in Fig. 3, COS-7 cells were co-transfected with expression
vector pSV2Wrec (1 µg) encoding the murine glucocorticoid receptor.
Immunoblotting
Cell extracts were prepared in buffer containing 2% SDS, analyzed
by electrophoresis in 10% polyacrylamide gels and transferred to
Immobilon-P membranes (Millipore) as before (Zeiner and Gehring,
1995). Hap50 was detected by mouse monoclonal antibody CC9E8
(Yang et al., 1998), peroxidase-conjugated secondary antibody
(Sigma), and enhanced chemiluminescence (ECL) (Amersham).
RNA analysis
Equal numbers of cells were ruptured by use of QIAShredder spin
columns (Qiagen) in RLT chaotropic lysis buffer (Qiagen). [33P]labelled poly(A)+ mRNA was isolated on Oligotex oligo-dT affinity
matrix (Qiagen). Aliquots (1/50 of total) were used for direct
scintillation counting of Cerenkov radiation, whereas the major portion
of samples were run on formaldehyde-containing 1% agarose gels,
transferred onto nylon filters (Ausubel et al., 1995) and submitted to
autoradiography with a 16 hour exposure. After radioactive decay for
at least two half-lives, the same filters were used for hybridizations
under high stringency conditions (Ausubel et al., 1995) with human
cDNAs for glucocorticoid receptor, c-Jun and β-actin labelled with
[32P]CTP (3000 Ci/mmol, ICN). Electrophoresis was in formaldehydecontaining 1.2% agarose gels with 0.2 µg/ml ethidium bromide.
For nuclear runoff transcription assays, nuclei from 3×107
transfected and control HeLa cells were prepared by Dounce
homogenization in lysis buffer containing 0.5% NP-40 (Ausubel et
al., 1995). Runoff transcription in the presence of [32P]UTP (3000
Ci/mmol, ICN) was carried out according to a standard protocol
(Ausubel et al., 1995). After rupturing nuclei by QIAShredder spin
columns and DNase I treatment, total labelled RNA was extracted by
use of the RNeasy Mini Kit (Qiagen) and used for hybridization with
cDNA probes spotted onto nylon membranes (Ausubel et al., 1995).
RESULTS
Hap50 is localized in nuclei of various cell types in
contrast to Hap46
We first checked the cell lines used in this study for the
presence of Hap46 and the large isoform Hap50. By
immunoblotting of total cell extracts, we observed that the
levels of these proteins varied greatly between cell types.
Although untransfected HeLa human cervical carcinoma cells
and HTC rat hepatoma cells yielded distinct Hap46 and Hap50
immunosignals, murine 3T3 fibroblasts and COS-7 monkey
kidney cells were found to contain only minute amounts of
immunochemically detectable levels of Hap46/BAG-1
isoforms (data not shown).
To investigate the intracellular distribution of Hap50 and
Hap46 isoforms, we used the respective cDNAs and coupled
them to cDNA encoding GFP from the jellyfish Aequorea
victoria. The plasmids were transfected into HeLa, 3T3 and
HTC cells, and in situ analysis was by confocal laser-scanning
microscopy (CLSM) (Fig. 1). In cells expressing the Hap50GFP fusion protein, the GFP signal was exclusively localized
within nuclei (Fig. 1, upper panels). As controls, the same live
cells were viewed by differential interference contrast
microscopy (DICM) to visualize the respective cell shapes and
nuclei (Fig. 1, middle panels). Our observation of exclusive
nuclear localization of Hap50 conforms with and extends
previous results of cell fractionation studies (Packham et al.,
1997; Takayama et al., 1998; Yang et al., 1998; Brimmell et
al., 1999). By contrast, cells transfected with the Hap46-GFP
construct and kept at 37°C showed predominantly cytoplasmic
fluorescence (Fig. 1, lower panels).
Hap50 stimulates the expression of reporter gene
constructs
To check for the effects on reporter gene expression, various
Transcriptional activation by the nuclear protein Hap50
1841
experiments with a tetracycline-regulated
system for the expression of Hap50 (data not
shown), we obtained effects on reporter gene
expression comparable with those presented in
Fig. 3.
Hap50 stimulates the expression of
selected endogenous genes
The above observed stimulation of reporter
gene expression prompted us to ask whether
Hap50 elicits overall effects on the
transcription of endogenous genes. Gene
transfer-mediated overexpression of Hap50
resulted in two- to fivefold levels of
total
poly(A)+
[33P]phosphate-labelled
mRNAs in HeLa, COS-7, 3T3 and HTC
cells, as quantified by scintillation counting.
Gel electrophoretic analysis of mRNA
preparations disclosed somewhat different
patterns amongst cell lines, as shown for HeLa
and COS-7 cells (Fig. 4A), which is consistent
with cell type specificity in gene expression.
Interestingly, there were no gross changes
detectable in the individual mRNA patterns
upon Hap50 overproduction, but the levels of
Fig. 1. Intracellular localization of Hap50 and Hap46. HeLa, 3T3, and HTC cells were
gene expression were increased (Fig. 4A).
transfected either with Hap50-GFP or Hap46-GFP constructs, as described in
We also checked some of the above
Materials and Methods. After 24 hours, cells were used either for CLSM (upper and
lower panels) or for DICM (middle panels), using the same optical fields for both
poly(A)+ mRNA preparations for individual
techniques in the case of cells transfected with cDNA for Hap50-GFP. For better
messages using specific hybridization probes.
analysis, optical fields containing only few transfected cells were selected. DICM
Clearly, the specific mRNAs for the
photographs also depict all the nontransfected cells within the respective fields.
glucocorticoid receptor and c-Jun were
Control experiments with cDNA encoding solely GFP showed uniform distribution of
present at significantly higher levels upon
the fluorescence signal throughout cells.
overexpression of Hap50, while the abundance
of actin messages remained unaffected (Fig.
cell lines were transiently transfected with Hap50 cDNA.
4B). Levels of 18S and 28S rRNAs in total RNA preparations
Roughly a 10-fold overexpression of Hap50 was achieved in
were unaffected by overexpression of Hap50 in these cells
HeLa cells relative to endogenous levels, as detected by
(data not shown).
immunoblotting (Fig. 2, lane 3 vs 1). We observed that the
To distinguish between increased transcription rates and
levels of Hap50 were essentially the same either without added
message stability, we carried out nuclear runoff transcription
DNA (lane 1), or upon transfection with empty control vector
assays. [32P]UTP-labelled nascent RNA transcripts obtained
(not shown) or Hap50 DNA in the antisense orientation (lane
from HeLa cell nuclei after transfection with Hap50 cDNA
2).
(Fig. 4C, lower panels) or control vector (upper panels) were
Transcriptional activation was investigated by cohybridized with several specific cDNAs. Amongst nuclear
transfection of HeLa cells with CAT reporter constructs. CAT
receptors, both glucocorticoid and estrogen receptor transcripts
under the control of either the CMV promoter, the human
were found to be significantly increased (roughly tenfold).
collagenase promoter, or the TK promoter coupled to GREs,
Similarly, the message levels for the AP-1 proteins c-Jun and
produced a significant increase in CAT activity upon
c-Fos were much higher in cells upon Hap50 overexpression.
overexpression of Hap50 (Fig. 3, bars 2, 5, 8 vs 1, 4, 7,
However, the expression of other genes may not be influenced
respectively).
significantly by Hap50, as was observed for actin.
Interestingly, this transcriptional stimulation by high cellular
Upon realizing that gene transfer-mediated increases of
levels of Hap50 occurred upon maintaining the cells at 37°C
and was not further enhanced in response to a 42°C heat shock
treatment (Fig. 3, bars 3, 6, 9). This is in clear contrast to
observations with Hap46, which required thermal stress to
elicit a stimulatory effect on transcription (Zeiner et al., 1999).
To check for cell type and species specificity, we carried out
Fig. 2. Expression of Hap50 in transfected and control cells. HeLa
similar experiments with COS-7 cells and 3T3 fibroblasts. Fig.
cells were submitted to the transfection protocol either without DNA
3 (lanes 7, 8; 10, 11; 12, 13) compares the results obtained in
(lane 1), with Hap50 cDNA (lane 3) or with Hap50 DNA in the
three different cell lines using CAT under the control of the TK
antisense orientation (lane 2). Extracts from equal numbers of cells
promoter and GREs. Overexpression of Hap50 produced
(equivalent to 3.5×105 cells each) were used for specific
approximately CAT activities fivefold those of controls. In
immunoblotting.
1842
JOURNAL OF CELL SCIENCE 114 (10)
1
2
3
4
5
6
7
8
9
10
11
12
13
-
+
+
-
+
-
+
+
+
+
-
+
-
-
+
+
-
+
-
7
CAT activity [fold increase]
6
5
4
3
2
1
0
Hap50
heat shock
-
-
Fig. 3. Hap50 stimulation of reporter gene expression. HeLa cells
(bars 1-9), COS-7 cells (bars 10, 11), and 3T3 fibroblasts (bars 12,
13) were transfected with Hap50 expression vector or control vector,
as indicated, in combination with CAT constructs driven by the CMV
promoter (bars 1-3), the human collagenase promoter (bars 4-6), or
the TK promoter in conjunction with GREs (bars 7-13). In some
experiments (bars 3, 6, 9), cells received a heat shock as described in
Materials and Methods. CAT activity in cell extracts is expressed as
fold stimulation of acetylated chloramphenicol formed. Data show
averages of three independent experiments with error bars indicating
maximum deviations.
Hap50 levels may result in augmented expression of cellular
genes, we wondered whether this could lead to overall effects
on the physiology of cells. Because heat shock is known to
cause large and generalized reductions of transcriptional
activities, we examined whether Hap50 overexpression might
improve the tolerance under such stress conditions. The
viability of 3T3 fibroblasts drastically decreased following a
42°C treatment (Fig. 5, bar 3), but overexpression of Hap50
significantly reduced the extent of this effect on cell viability
(Fig. 5, bar 4). By contrast, the growth rate of unstressed cells
was not affected by Hap50 overexpression (Fig. 5, bar 2 vs 1).
We used 3T3 cells for this heat shock experiment because they
were most sensitive to thermal stress amongst the cell lines
studied here. For comparison, HeLa cells readily survived
extended treatment at 45°C (results not shown) and have been
found to express Hsp70, even at 37°C, in addition to Hsc70
(Zeiner et al., 1997).
DISCUSSION
Originally, Hap46/BAG-1 was discovered and its cDNA cloned
by interaction screening using several completely unrelated
bait proteins, all expressed in the baculovirus system
(Takayama et al., 1995; Zeiner and Gehring, 1995; Bardelli et
al., 1996). This curious convergence is explained by the fact
that crude extracts of virus-infected Sf9 cells had been used
that contained Hsp70s, and these chaperones were
subsequently found to mediate a host of interactions by
forming ternary complexes (Zeiner et al., 1997; Bimston et al.,
1998). BAG-1 was also detected by interaction screening with
an oligonucleotide sequence from a human polyomavirus
Fig. 4. Effect of Hap50 on the expression of endogenous genes.
HeLa (lanes 1, 2) and COS-7 (lanes 3, 4) cells were either transfected
with Hap50 cDNA (lanes 2, 4) or control vector (lanes 1, 3) and
metabolically labelled with [33P]phosphate. Poly(A)+ mRNA was
submitted to electrophoresis and autoradiography. Positions of 18S
and 28S rRNAs are indicated. (A) The same filters were
subsequently used for hybridization with [32P]-labelled cDNAs for
human glucocorticoid receptor (GR), c-Jun and β-actin. Detection
was by autoradiography. (B) For nuclear runoff transcription assays,
HeLa cells either transfected with Hap50 cDNA (lower panels) or
control vector (upper panels) were used. Labelled RNAs were probed
with dot-blotted cDNAs encoding the glucocorticoid receptor (GR),
the estrogen receptor (ER), c-Jun, c-Fos and actin, as indicated (C).
(Devireddy et al., 2000), suggesting the potential to interact
with nucleic acids. In fact, human Hap46 was previously
recognized to directly interact with DNA through a positively
charged region at the N-terminus (Zeiner et al., 1999). Such
DNA binding is a prerequisite for the ability of Hap46 to elicit
general transcriptional activation in in vitro assays. However,
in intact cells, thermal stress is required for Hap46 to produce
similar enhancement of transcription (Zeiner et al., 1999). This
agrees with the observation that, under normal cell culture
Transcriptional activation by the nuclear protein Hap50
1
2
3
4
Hap50
-
+
-
+
heat shock
-
-
+
+
2.5
2.0
Viable cells [×106]
conditions, Hap46 is localized mostly in the cytoplasm (Fig. 1,
lower panels) and preferentially accumulates in nuclei only
upon heat shock (Zeiner et al., 1999). Thermal stress thus
causes Hap46 to get transferred to the cell nucleus, possibly in
concert with Hsp70, which itself has long been known for such
nuclear translocation (Velazquez and Lindquist, 1984).
The large isoform Hap50 exhibits a very different cellular
distribution pattern. Biochemical fractionations disclosed
preferential nuclear localization of Hap50 in various cell types
(Packham et al., 1997; Takayama et al., 1998; Yang et al., 1998;
Brimmell et al., 1999). Using the fusion protein with GFP, we
observed in situ expression of Hap50 exclusively in the nuclear
compartment of different cell types, even under normal
temperature conditions (Fig. 1, upper panels). Interestingly, the
distribution of Hap50-GFP is not homogeneous within cell
nuclei. The speckled patterns that we observe are strongly
reminiscent of recent descriptions of nuclear clusters of RNA
polymerase II activity (Cook, 1999; Szentirmay and
Sawadogo, 2000). It will thus be interesting to find out whether
Hap50 colocalizes with such sites of active transcription or a
subset thereof.
In addition to a potential bipartite nuclear localization
sequence roughly in the middle of the Hap46 sequence (Zeiner
and Gehring, 1995), the positively charged region in Hap50
may function as another nuclear localization signal (Packham
et al., 1997; Takayama et al., 1998; Brimmell et al., 1999). This
is located exactly at the beginning of the N-terminal extension
in Hap50. These differences between Hap46 and Hap50
perfectly account for the observations presented here; in
particular, Hap50 causing transcriptional activation
independent of heat stress, as it already resides in cell nuclei
under normal physiological conditions. In nuclear runoff
transcription assays, we show for some selected genes that
overexpression of Hap50 indeed exerts a positive effect on
transcriptional activity rather than stabilizing the respective
messages (Fig. 4C). We suppose that most genes activated by
Hap50 are subject to multiple and rather subtle regulations.
This contention is strengthened by the observation that
message levels but not their patterns are changed upon
overexpression of Hap50 (Fig. 4A). Thus, the expression of
housekeeping genes such as actin (Fig. 4B,C) may not be
affected. It is possible that Hap50 exerts its effects by
interacting with other transcription factors and/or the basal
transcriptional apparatus itself. Furthermore, the effects of
Hap50 may be specific for genes transcribed by RNA
polymerase II, as we did not observe any changes in the levels
of 18S and 28S rRNAs.
Protective effects of Hap46/BAG-1 proteins in terms of cell
survival under apoptosis-inducing conditions or heat stress
were repeatedly observed (Höhfeld, 1998; Kullmann et al.,
1998; Yang et al., 1999a; Zeiner et al., 1999; Hayashi et al.,
2000). Even though some cooperation with Bcl2 has been
described (Takayama et al., 1995; Schulz et al., 1997; EversoleCire et al., 2000), the anti-apoptotic action of Hap46 and
Hap50 may well occur independent of Bcl2, as these proteins
are not coordinately expressed in various cell lines (Brimmell
et al., 1999; Yang et al., 1999a; Yang et al., 1999b). We rather
suppose that the beneficial cellular effects of Hap46 under
stress or other adverse conditions result from the potential to
stimulate transcription (Zeiner et al., 1999). This applies in an
even more stringent way to the large isoform Hap50, which is
1843
1.5
1.0
0.5
0.0
Fig. 5. Enhanced viability of heat stressed cells overexpressing
Hap50. 3T3 cells (7×105 per 50 mm plate) were transfected with
Hap50 cDNA (bars 2, 4) or control vector (bars 1, 3). Some cultures
(bars 3, 4) received a heat shock, as detailed in Materials and
Methods. Cells excluding Trypan blue were counted as viable and
numbers per plate are given. Data show averages of two independent
experiments with error bars indicating maximum deviations.
a nuclear protein in unstressed cells and has the ability to
activate transcription in such cells (Fig. 3; Fig. 4). By contrast,
shorter isoforms, particularly in the range of 33 kDa apparent
molecular mass, mainly affect Hsp70/Hsc70-mediated protein
folding reactions (Lüders et al., 2000; Nollen et al., 2000),
whereas the intermediate form Hap46 exerts pleiotropic effects
and shows an overlap in biological activities. In the cytoplasm,
Hap46 functions as a regulator of Hsp70 chaperoning activity
(Gebauer et al., 1997; Zeiner et al., 1997; Höhfeld, 1998), and
upon transfer to the nucleus under stress conditions it can
stimulate transcription (Zeiner et al., 1999). We suppose that
Hap50, which is a nuclear protein and a transcriptional
activator, causes enhanced expression of some critical cellular
genes whose products are important for cell viability, for
example heat shock proteins (Jolly and Morimoto, 2000). In
this context, it is of interest that the messages for the AP-1
components c-Jun and c-Fos are produced at increased levels
in Hap50-overexpressing cells (Fig. 4B,C). AP-1 is known as
a transcription factor of wide importance for cellular responses
to environmental impacts (Curran and Franza, 1988) and, as
such, it may be critical for cell viability, differentiation and
apoptosis. Thus AP-1 has been implicated in the protection of
various mammalian cells against apoptosis, but its activation
may also play a role in growth suppression and induction of
cell death (Karin et al., 1997; Liebermann et al., 1998).
Similarly, upon overexpression, Hap50 may promote the
apoptotic response, depending on the specific stimulus and cell
type (Yang et al., 2000). Clearly, regulation of apoptosis is
rather complex and may depend greatly on the cell system
involved and on specific experimental conditions.
Stressful conditions under which cells grow in culture or to
which solid tumours are exposed in vivo may readily lead to
selection of subpopulations that express increased levels of
1844
JOURNAL OF CELL SCIENCE 114 (10)
Hap46/BAG-1 proteins, in particular, the large isoform Hap50.
Consequently, cells harbouring relatively large amounts of
these proteins are much better equipped to cope with
conditions of stress. Overexpression of Hap46/BAG-1 proteins
has indeed been observed in various cancer cells (Takayama et
al., 1998; Yang et al., 1998; Yang et al., 1999a; Yang et al.,
1999b; Brimmell et al., 1999; Shindoh et al., 2000). Such
survival-promoting actions may well occur in concert with
Hsp70s, which by themselves exert cytoprotective effects on
cancer cells, especially under chemotherapeutic treatment
(Jäättelä, 1999; Jolly and Morimoto, 2000). The observation
that Hap50 is expressed at increased levels in cells upon
developing multidrug resistance (Ding et al., 2000) fits closely
to the view that Hap50 exerts a rather general cell-protective
effect. Even though Hap46/BAG-1 proteins are about to
become useful in the clinics as molecular tumour markers, it
will be more important in the future to find out how their
expression can be downregulated in cancer cells.
We thank A. Pater (Memorial University of Newfoundland, St
John’s, Newfoundland, Canada) for monoclonal antibody CC9E8, P.
Chambon (CNRS, INSERM, Illkirch, France) for human estrogen and
glucocorticoid receptor cDNA constructs, and P. Angel and H.
Sültmann (German Cancer Research Center, Heidelberg, Germany)
for providing cDNAs coding for c-Fos, c-Jun, and actin. We are
grateful to M. Grabenbauer (Ruprecht-Karls-Universität Heidelberg,
Germany) for help with the confocal laser-scanning microscope. This
work was supported by the Deutsche Forschungsgemeinschaft.
REFERENCES
Angel, P., Baumann, I., Stein, B., Delius, H., Rahmsdorf, H. J. and
Herrlich, P. (1987). 12-O-tetradecanoyl-phorbol-13-acetate induction of the
human collagenase gene is mediated by an inducible enhancer element
located in the flanking region. Mol. Cell. Biol. 7, 2256-2266.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,
Smith, J. A. and Struhl, K. (1995). Current Protocols in Molecular
Biology. New York: Wiley.
Bardelli, A., Longati, P., Albero, D., Goruppi, S., Schneider, C.,
Ponzetto, C. and Comoglio, P. M. (1996). HGF receptor associates with
the anti-apoptotic protein Bag-1 and prevents cell death. EMBO J. 15,
6205-6212.
Bimston, D., Song, J., Winchester, D., Takayama, S., Reed, J. C. and
Morimoto, R. I. (1998). BAG-1, a negative regulator of Hsp70 chaperone
activity, uncouples nucleotide hydrolysis from substrate release. EMBO J.
17, 6871-6878.
Brimmell, M., Burns, J. S., Munson, P., McDonald, L., O’Hare, M. J.,
Lakhani, S. R. and Packham, G. (1999). High level expression of
differentially localized BAG-1 isoforms in some estrogen receptor-positive
human breast cancers. Br. J. Cancer 81, 1042-1051.
Cook, P. R. (1999). The organization of replication and transcription. Science
284, 1790-1795.
Crocoll, A., Blum, M. and Cato, A. C. (2000). Isoform-specific expression
of BAG-1 in mouse development. Mech. Dev. 91, 355-359.
Curran, T. and Franza, B. R. (1988). Fos and Jun: The AP-1 connection.
Cell 55, 395-397.
Devireddy, L. R., Kumar, K. U., Pater, M. M. and Pater, A. (2000). BAG1, a novel Bcl-2-interacting protein, activates expression of human JC virus.
J. Gen. Virol. 81, 351-357.
Ding, Z., Yang, X., Pater, A. and Tang, S. C. (2000). Resistance to apoptosis
is correlated with the reduced caspase-3 activation and enhanced expression
of antiapoptotic proteins in human cervical multidrug-resistant cells.
Biochem. Biophys Res. Commun. 270, 415-420.
Eversole-Cire, P., Concepcion, F. A., Simon, M. I., Takayama, S., Reed, J.
C. and Chen, J. (2000). Synergistic effect of Bcl-2 and BAG-1 on the
prevention of photoreceptor cell death. Invest. Ophthalmol. Vis. Sci. 41,
1953-1961.
Froesch, B. A., Takayama, S. and Reed, J. C. (1998). BAG-1L protein
enhances androgen receptor function. J. Biol. Chem. 273, 11660-11666.
Gebauer, M., Zeiner, M. and Gehring, U. (1997). Proteins interacting with
the molecular chaperone Hsp70/Hsc70: physical associations and effects on
refolding activity. FEBS Lett. 417, 109-113.
Gebauer, M., Zeiner, M. and Gehring, U. (1998). Interference between
proteins Hap46 and Hop/p60 which bind to different domains of the
molecular chaperone Hsp70/Hsc70. Mol. Cell. Biol. 18, 6238-6244.
Guzey, M., Takayama, S. and Reed, J. C. (2000). BAG1L enhances transactivation function of the vitamin D receptor. J. Biol. Chem. 275, 4074940756.
Hayashi, T., Sakai, K.-i., Sasaki, C., Yasuto, I. and Abe, K. (2000). Loss of
bag-1 immunoreactivity in rat brain after transient middle cerebral artery
occlusion. Brain Res. 852, 496-500.
Höhfeld, J. (1998). Regulation of the heat shock cognate Hsc70 in the
mammalian cell: The characterization of the anti-apoptotic protein BAG-1
provides novel insights. Biol. Chem. 379, 269-274.
Jäättelä, M. (1999). Escaping cell death: Survival proteins in cancer. Exp. Cell
Res. 248, 30-43.
Jolly, C. and Morimoto, R. I. (2000) Role of the heat shock response and
molecular chaperones in oncogenesis and cell death. J. Natl. Cancer Inst.
92, 1564-1572.
Kanelakis, K. C., Morishima, Y, Dittmar, K. D., Galigniana, M. D.,
Takayama, S, Reed, J. C. and Pratt, W. B. (1999). Differential effects of
the Hsp70-binding protein BAG-1 on glucocorticoid receptor folding by the
hsp90-based chaperone machinery. J. Biol. Chem. 274, 34134-34140.
Karin, M., Liu, Z. and Zandi, E. (1997) AP-1 function and regulation. Curr.
Opin. Cell Biol. 9, 240-246.
Kullmann, M., Schneikert, J., Moll, J., Heck, S., Zeiner, M., Gehring, U.
and Cato, A. C. B. (1998). RAP46 is a negative regulator of glucocorticoid
receptor action and hormone induced apoptosis. J. Biol. Chem. 273, 1462014625.
Liebermann, D. A., Gregory, B. and Hoffman, B. (1998). AP-1 (Fos/Jun)
transcription factors in hematopoietic differentiation and apoptosis. Int. J.
Oncol. 12, 685-700.
Liu, R., Takayama, S., Zheng, Y., Froesch, B., Chen, G., Zhang, X., Reed,
J. C. and Zhang, X.-k. (1998). Interaction of BAG-1 with retinoic acid
receptor and its inhibition of retinoic acid-induced apoptosis in cancer cells.
J. Biol. Chem. 273, 16985-16992.
Lüders, J., Demand, J., Papp, O. and Höhfeld, J. (2000). Distinct isoforms
of the cofactor BAG-1 differentially affect Hsc70 chaperone function. J.
Biol. Chem. 275, 14817-14823.
Nollen, E. A. A., Brunsting, J. F., Song, J., Kampinga, H. H. and
Morimoto, R. I. (2000). Bag-1 functions in vivo as a negative regulator of
Hsp70 chaperone activity. Mol. Cell. Biol. 20, 1083-1088.
Packham, G., Brimmel, M. and Cleveland, J. L. (1997). Mammalian cells
express two differently localized Bag-1 isoforms generated by alternative
translation initiation. Biochem. J. 328, 807-813.
Petersen, G., Hahn, C. and Gehring, U. (2001). Dissection of the ATP
binding domain of the molecular chaperone Hsc70 for interaction with the
cofactor Hap46. J. Biol. Chem. 276, 10178-10184.
Schneikert, J., Hübner, S., Langer, G., Petri, T., Jäättelä, M., Reed, J and
Cato, A. C. B. (2000). Hsp70-RAP46 interaction in downregulation of DNA
binding by glucocorticoid receptor. EMBO J. 19, 6508-6516.
Schulz, J. B., Bremen, D., Reed, J. C., Lommatzsch, J., Takayama, S.,
Wullner, U., Loschmann, P. A., Klockgether, T. and Weller, M. (1997).
Cooperative interception of neuronal apoptosis by BCL-2 and BAG-1
expression: prevention of caspase activation and reduction of reactive
oxygen species. J. Neurochem. 69, 2075-2086.
Shindoh, M., Adachi, M., Higashino, F., Yasuda, M., Hida, K., Nishioka,
T., Ono, M., Takayama, S., Reed, J. C., Imai, K. et al. (2000). BAG-1
expression correlates highly with the malignant potential in early lesions (T1
and T2) of oral squamous cell carcinoma. Oral Oncol. 36, 444-449.
Szentirmay, M. N. and Sawadogo, M. (2000). Spacial organization of RNA
polymerase II transcription in the nucleus. Nucleic Acids Res. 28, 20192025.
Takayama, S., Sato, T., Krajewski, S., Kochel, K., Irie, S., Millan, J. A.
and Reed, J. C. (1995). Cloning and functional analysis of BAG-1: A novel
Bcl-2-binding protein with anti-cell death activity. Cell 80, 279-284.
Takayama, S., Krajewski, S., Krajewska, M., Kitada, S., Zapata, J. M.,
Kochel, K., Knee, D., Scudiero, D., Tudor, G., Miller, G. J. et al. (1998).
Expression and location of Hsp70/Hsc-binding anti-apoptotic protein BAG1 and its variants in normal tissues and tumor cell lines. Cancer Res. 58,
3116-3131.
Transcriptional activation by the nuclear protein Hap50
Takayama, S., Xie, Z. and Reed, J. C. (1999). An evolutionarily conserved
family of Hsp70/Hsc70 molecular chaperone regulators. J. Biol. Chem. 274,
781-786.
Velazquez, J. M. and Lindquist, S. (1984). Hsp70: nuclear concentration
during environmental stress and cytoplasmatic storage during recovery. Cell
36, 655-662.
Yang, X., Chernenko, G., Hao, Y., Ding, Z., Pater, M. M., Pater, A. and
Tang, S.-C. (1998). Human BAG-1/RAP46 protein is generated as four
isoforms by alternative translation initiation and overexpressed in cancer
cells. Oncogene 17, 981-989.
Yang, X., Hao, Y., Ferenczy, A., Tang, S.-C. and Pater, A. (1999a).
Overexpression of anti-apoptotic gene BAG-1 in human cervical cancer.
Exp. Cell Res. 247, 200-207.
Yang, X., Hao, Y., Ding, Z., Pater, A. and Tang, S.-C. (1999b). Differential
1845
expression of antiapoptotic gene BAG-1 in human breast normal and cancer
cell lines and tissues. Clin. Cancer Res. 5, 1816-1822.
Yang, X., Hao, Y., Ding, Z. and Pater, A. (2000). BAG-1 promotes apoptosis
induced by N-(4-hydroxyphenyl)retinamide in human cervical carcinoma
cells. Exp. Cell Res. 256, 491-499.
Zeiner, M. and Gehring, U. (1995). A protein that interacts with members of
the nuclear hormone receptor family: Identification and cDNA cloning.
Proc. Natl. Acad. Sci. USA 92, 11465-11469.
Zeiner, M., Gebauer, M. and Gehring, U. (1997). Mammalian protein
RAP46: an interaction partner and modulator of 70 kDa heat shock proteins.
EMBO J. 16, 5483-5490.
Zeiner, M., Niyaz, Y. and Gehring, U. (1999). The Hsp70-associating protein
Hap46 binds to DNA and stimulates transcription. Proc. Natl. Acad. Sci.
USA 96, 10194-10199.