Download The expression of a chromoplast-specific lycopene beta cyclase

Journal of Experimental Botany, Vol. 61, No. 1, pp. 105–119, 2010
doi:10.1093/jxb/erp283 Advance Access publication 18 September, 2009
RESEARCH PAPER
The expression of a chromoplast-specific lycopene beta
cyclase gene is involved in the high production of saffron’s
apocarotenoid precursors
Oussama Ahrazem1, Angela Rubio-Moraga1, Raquel Castillo López2 and Lourdes Gómez-Gómez1,*
1
Departamento de Ciencia y Tecnologı́a Agroforestal y Genética, ETSIA, Universidad de Castilla-La Mancha, Campus Universitario s/n,
E-02071 Albacete, Spain
2
VITAB Laboratorios, Polı́gono Industrial Garysol C/ Pino, parcela 53, La Gineta, E-02110 Albacete, Spain
Received 11 June 2009; Revised 27 August 2009; Accepted 30 August 2009
Abstract
Crocus sativus is a triploid sterile plant characterized by its long red stigmas, which produce and store significant
quantities of carotenoid derivatives formed from the oxidative cleavage of b-carotene and zeaxanthin. The present
study reports on the genomic structures of two lycopene-b-cyclase genes, CstLcyB1 and CstLcyB2a, and on their
transcription patterns in different C. sativus tissues. Phylogenetic analysis showed that both proteins are located in
different groups: CstLcyB2a encodes chromoplast-specific lycopene cyclases, with an expression analysis showing
strongly in flower stigmas where it activates and boosts b-carotene accumulation. The CstLcyB1 transcript,
however, was present in leaves, tepals, and stigmas at lower levels. In vivo assays in transgenic Arabidopsis
demonstrated lycopene b-cyclase activity of CstLcyB2a. CstLcyB2a is a CstLcyB1 paralogue derived through a gene
duplication event, while promoter analysis showed that both genes have diverged in their regulatory sequences after
duplication. Furthermore, it was found that the CstLcyB2a gene was absent from Crocus kotschyanus and, although
present in C. goulimyi and C. cancellatus, the absence of transcripts suggests that transcriptional regulation of
CstLcyB2a is responsible for the low apocarotenoid content in these species.
Key words: Apocarotenoids, Crocus sativus, gene expression, lycopene, lycopene b-cyclase, promoter, stigma.
Introduction
Carotenoids are widely distributed isoprenoid pigments
fulfilling diverse functions in all taxa (Britton, 1998). Due
to their vital role in protecting the photosynthetic apparatus
from photo-oxidation, carotenoids are synthesized in all
photosynthetic organisms. Moreover, carotenoids represent
essential structural components of the light-harvesting
antenna and reaction centre complexes (Horton et al.,
1996) and are accumulated in many flowers and fruits
providing distinct yellow, orange, and red colours, thus
contributing substantially to plant–animal communication
(Hirschberg, 2001; DellaPenna and Pogson, 2006). In
addition, the colours of many carotenoid-accumulating
fruits and flowers also contribute to an increase in their
economic value (Fraser and Bramley, 2004; Botella-Pavı́a
and Rodriguez-Concepción, 2006; Giuliano et al., 2008).
Apart from these functions, carotenoids serve as precursors
of several physiologically important compounds, synthesized through oxidative cleavage and generally known as
apocarotenoids. Representative examples are the ubiquitous
chromophore retinal, the phytohormone abscisic acid, and
strigolactones (DellaPenna and Pogson, 2006; Leyser,
2008).
Carotenoid biosynthesis and its regulation have been
studied in various plant species, such as Zea mays (Harjes
et al., 2008; Li et al., 2008a, b), Daucus carota (Clotault
et al., 2008), Tagetes erecta (Moehs et al., 2001; Del-VillarMartinez et al., 2005), Crocus sativus (Castillo et al., 2005),
Prunus armeniaca (Marty et al., 2005), Citrus (Kato et al.,
2004; Rodrigo et al., 2004), Gentiana lutea (Zhu et al., 2002,
2003), Arabidopsis (Pogson et al., 1996; Park et al., 2002),
* To whom correspondence should be addressed: E-mail: [email protected]
ª The Author [2009]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved.
For Permissions, please e-mail: [email protected]
106 | Ahrazem et al.
Solanum lycopersicum (Giuliano et al., 1993; Fraser et al.,
1994; Ronen et al., 1999; Isaacson et al., 2002), Capsicum
annuum (Romer et al., 1993), Nicotiana tabacum (Busch
et al., 2002), and in an alga (Steinbrenner and Linden,
2001). These studies have demonstrated that carotenoid
accumulation is mainly controlled by the transcriptional
regulation of carotenoid biosynthetic genes.
Carotenoid biosynthesis and sequestration take place
within the plastids of higher plants (reviewed by Cunningham
and Gantt, 1998). Carotenoids are C40 isoprenoids that
derive from the common C20 precursor, geranygeranyldiphosphate (GGDP). The first committed step in the
plastid-localized biosynthetic pathway is mediated by the
nuclear-encoded phytoene synthase, which catalyses the
formation of phytoene from geranylgeranyl diphosphate
(Fig. 1). Phytoene is converted to all-trans lycopene by four
desaturation reactions (mediated by phytoene desaturase,
PDS, and f-carotene desaturase, ZDS) and by an isomerization reaction mediated by CRTISO and ZISO (Isaacson
et al., 2002; Li et al., 2007). The first branch point of this
pathway occurs at the cyclization of lycopene, where the
action of lycopene beta cyclase (Lcyb) at both ends of the
linear lycopene produces a molecule with two b rings,
b-carotene. Alternatively, the co-action of Lcyb and lycopene epsilon cyclase (Lcye) generates a-carotene. Beta- and
a-carotene are redundantly hydroxylated by non-haem
(CHY1, CHY2) as well as cytochrome P450 (CYP97A and
CYP97C) hydroxylases. Hydroxylation of b-carotene generates zeaxanthin that is converted to violaxanthin via
antheraxanthin by zeaxanthin epoxidase. In the last step of
the carotenoid biosynthesis pathway, violaxanthin is transformed into neoxanthin by the activity of the enzyme
neoxanthin synthase.
Fig. 1. Schematic apocarotenoid biosynthetic pathway in
C. sativus stigma. Enzymatic reactions are represented by arrows.
GGPP, geranyl geranyl diphosphate; PSY, phytoene synthase;
PDS, phytoene desaturase; ZDS, f-carotene desaturase; ZISO
and CRTISO, carotene isomerases; LCYe, lycopene e-cyclase;
LCYb, lycopene b-cyclase; eCH, e-carotene hydroxylase; ZEP,
zeaxanthin epoxidase; VDE, violaxanthin de-epoxidase; NXS, neoxanthin synthase; CCD, carotenoid cleavage dioxygenase; HTTC,
2,6,6-trimethyl-4-hydroxy-1-carboxaldehyde-1-cyclohexene.
The conversion of lycopene to b-carotene is catalysed by
the b cyclase enzyme (Cunningham et al., 1994; Hugueney
et al., 1995; Pecker et al., 1996). The e and b cyclase
enzymes are products of related genes, but the e cyclase
only adds one e ring to lycopene, whereas the b cyclase can
add two b rings. Carotenoids with two e rings are not
commonly found in plants. An exception is lactucaxanthin
from lettuce. The lettuce Lcye produces the bicyclic
e,e-carotene (Cunningham et al., 1996). The lettuce enzyme,
together with the e and b cyclases, is similar in sequence to
cyanobacterial b cyclase enzymes, and these cyclases are
related to another group of carotenoid cyclase enzymes
which includes such chromoplast-targeted Lcyb enzymes as
the tomato (Ronen et al., 2000) and Citrus enzymes
(Alquézar et al., 2009), the capsanthin-capsorubin synthase
(Ccs) of pepper (Bouvier et al., 2000), and the neoxanthin
synthase (NSY) gene from potato (Al-Babili et al., 2000).
Recent data demonstrate a central role for gene duplication in the development of a chromoplast-specific carotenoid biosynthesis pathway (Galpaz et al., 2006; Giorio et al.,
2008). Gene and genome duplications have been shown to
be particularly prominent in plant genomes and have
greatly influenced genomes organization and evolution
(Otto and Whitton, 2000; Wendel, 2000; De Bodt et al.,
2005; Maere et al., 2005). These duplication events also
have profound effects on gene function and regulation.
Gene duplication, as an important driving force for
generating evolutionary novelty, enables genes to diverge in
function or expression through neofunctionalization, where
the gene acquires a new function or expression pattern, or
subfunctionalization, a process in which functions or
expression patterns are partitioned between duplicate genes
(Prince and Pickett, 2002), as seems to be the case for the
carotenogenic genes in tissues containing chromoplasts.
Thus, in order to study the effects of gene duplication and
their influence on gene regulation, it is of interest to carry
out a comparative analysis of the promoters of these
duplicated genes.
Saffron, the dried red stigmas of C. sativus, is one of the
oldest natural food additives used as a flavouring and
a colouring agent. C. sativus is characterized by its long red
stigmas, which produce and store significant quantities of
carotenoid derivatives, formed from the oxidative cleavage
of b-carotene and zeaxanthin (Rubio et al., 2009) (Fig. 1).
Interest in the impact of saffron carotenoids on human
health is growing due to its high antioxidant capacity
(Verma and Bordia, 1998), and recent studies show that
saffron may offer some protection against major diseases
such as coronary heart diseases and cancer (Abdullaev,
2002). The quantitative and qualitative changes in the
carotenoid and the apocarotenoid profile in C. sativus
stigmas have been studied previously (Castillo et al., 2005;
Rubio et al., 2009), and it has been shown that transcriptional regulation of a b-carotene hydroxylase gene is
involved in the observed changes. In this study, the isolation
and the characterization of two different lycopene cyclase
genes in C. sativus are described in order to study the
involvement of these lycopene cyclase genes in the synthesis
Saffron LYC subfunctionalization | 107
of b-carotene in C. sativus stigmas and, therefore, in
apocarotenoid accumulation. The expression patterns of
both genes were followed during stigma development and
compared with the changes in the carotenoid levels. In
addition, the genomic structure of these genes and their
regulation in other Crocus species, which differ in their
carotenoid and apocarotenoid content have been studied.
Materials and methods
Plant material
For this study, eight species of Crocus were used. All the specimens
were obtained from private collections in the UK (Potterton
Nursery). Plant tissues were independently harvested and frozen in
liquid nitrogen and stored at –80 C until required. Stigmas were
collected at seven developmental stages defined according to Rubio
et al. (2008).
Seeds of Arabidopsis wild-type, ecotype Columbia (Col), and
transgenic lines were sown in pots containing vermiculite and
watered with nutrient solution under a controlled environment
with 16/8 h light/dark cycles at 22 C. Seeds from transformed
Arabidopsis plants were surface-sterilized by rinsing them in 70%
(v/v) ethanol for 1 min, followed by a 15 min treatment in 10% (v/
v) bleach+0.05% (v/v) Triton X-100 with three rinses in sterile
distilled water.
Cloning of C. sativus lycopene cyclase coding genes
Genomic DNA extracts were prepared from Crocus leaves by
using a CTAB (hexadecyltrimethylammonium bromide) method
(Doyle and Doyle, 1990). The genomic sequences were obtained by
genome walking with the Universal Genome Walker Kit (Clontech, Palo Alto, CA) using the primers described in Table 1. PCR
with gene-specific primers from the identified gDNA clones were
used to isolate the full open reading frames. Total RNA was
isolated from developing C. sativus stigmas by using Ambion
PolyAtrack and following manufacturer’s protocols (Ambion,
Inc.). This was done by using 1 lg of poly(A)+ RNA from stigmas
to synthesize the first-strand cDNA with a Superscript II reverse
transcriptase supplied in the SMART RACE cDNA Amplification Kit (Clontech). The gene-specific primers described in Table 1
were used with the following cycling program: one cycle at 94 C
for 3 min, 10 cycles at 94 C for 20 s, 66 C –0.2 C/cycle for 20 s,
and 72 C for 2 min, 30 cycles at 94 C for 20 s, 64 C for 20 s, and
72 C for 2 min, and a final extension at 72 C for 5 min. The
amplified PCR products were analysed by electrophoresis in 1%
agarose gel. The PCR products were then cloned into pGEM-T
(Promega, Madison, WI, USA). The ligated DNA was transformed into E. coli strain JM109. The clones (50 colonies) were
picked individually and amplified in 3 ml of LB medium at 37 C
overnight. The plasmid DNA from each clone was extracted using
a DNA plasmid Miniprep kit (Promega, Madison, WI, USA) and
then analysed by EcoRI restriction digestion.
DNA sequencing and analysis of DNA sequences
Plasmids were sequenced using an automated DNA sequencer
(ABI PRISM 3730xl, Perkin Elmer) at Macrogen Inc. (Seoul,
Korea). Computer analysis of the DNA and amino acid sequences
were carried out using the Kalign multiple sequence alignment
algorithm (Lassmann and Sonnhammer, 2005). Relative molecular
masses were calculated from the deduced amino acid compositions
with the Compute Mw tool available at the ExPASy Molecular
Biology Web server (Geneva, Switzerland). Subcellular sorting was
Table 1. Primer sequences used for CsLcyB1 and CsLcyB2 genes cloning and analysis
Primers for CstLcyB1 full-length isolation
and RT-PCR expression analysis
Primers for CstLcyB2a/b full-length
isolation and RT-PCR expression analysis
Primers for 3# and 5# RACE-PCRs
Primers for promoter isolation and analysis
Primers for cloning CstLcyB2a in expression vector
cDNAa
Sequence 5#–3#
LcyB1-f
ATGGATCCGCTCTTGAGAAC
LcyB1-r
LcyB2-f
CTATCCTTCTCGTATAGTTCT
CATGATGATCTCTAGTCTTCA
LcyB2-r
LcyB1-f1
LcyB1-f2
LcyB1-r1
LcyB1-r2
LcyB2-f1
LcyB2-f2
LcyB2-r1
LcyB2-r2
P-LcyB1-r1
P-LcyB1-r2
P-LcyB2-r1
P-LcyB2-r2
P-LcyB2-f
LcyB2-att-sense
TCCACTGTCAATAACAGATCA
GCAATGCCCTTCTCTTCAAA
TGAAGAGCATTGAAGAGGATGA
CATTCCTGCAGTCCTCCAAT
TCCCTCCAATCCATGAAGAC
TCTTAGCCGAGGTCGAGTCTC
AGCGAGAGCTTTGAGAGCG
CCATTAGTACCATCTTGTCGA
CAGATCGCATCGAAGCAGTCATC
AGTGACTTTCTGCCAATTTGTGA
TGGGTTCTCAAGAGCGGATCCAT
GTCTGGACGTTGGGGTAAGAT
GGAAATGAAGACTAGAGATCAT
AGGTTAGGACTTGTAAGTTGA
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGA
AGGAGATAGAACCATGGCAATCTCTAGTCTTCA
GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA
TCCACTGTCAATAACAGAT
LcyB2-att-antisense
a
f, forward; r, reverse.
108 | Ahrazem et al.
predicted at the PSORT Web server for analysing and predicting
protein-sorting signals at the Institute for Molecular and Cellular
Biology (Osaka, Japan). Phylogenetic analysis and tree construction was carried out using the Clustal W program at the
EBI
(http://www.ebi.ac.uk/Tools/clustalw2/index.html),
and
the Phylodendron program (http://iubio.bio.indiana.edu/treeapp/
treeprint-form.html).
Nucleotide replacement (Ka) and synonymous (Ks) substitutions were estimated using the WSPMaker tool (Lee et al., 2008).
Expression analysis
For RT-PCR, total RNA was isolated from C. sativus anthers,
leaves, tepals, and stigma (pre-anthesis), and from the other
seven Crocus species stigmas (pre-anthesis) by grinding fresh
tissue in liquid nitrogen to a fine powder and extracting in 1 ml
of Trizol reagent (Gibco-BRL) per 100 mg of tissue fresh weight,
according to the protocol of the manufacturer. The RNA was
resuspended in 100 ll of RNase-free water and treated with RQ1
RNase-free DNase (Promega, Madison, WI). The DNase was
heat inactivated before RT-PCR. The RNA was quantified with
a spectrophotometer at OD of 260 and 280 and stored at –80 C.
Various initial concentrations of treated RNA, ranging over
10-fold difference, were used to demonstrate the differential
accumulation of the RNA in the tissues analysed in the RT-PCR
experiments. Total RNA samples were reverse transcribed with
a first-strand cDNA synthesis kit (Amersham Biosciences) and
random primers (Promega, Madison, WI, USA). The gene
expression levels were evaluated using specific primer pairs for
each gene (Table 1). The PCR reactions were carried out using
10 lM of each primer, 200 lM dNTPs, and 2 units of Taq
polymerase (Invitrogen). After an initial denaturation step for 2
min, the PCR reactions were performed for 30 cycles at 94 C
for 20 s, 58 C for 20 s, and 72 C for 1 min. As an internal
control, the mRNA level of the constitutively expressed ribosomal protein 18 was used (Moraga et al., 2004). The program
PhotoCaptMw was used to quantify the intensity of the
ethidium bromide-stained DNA bands from the positive images
of the gel.
a dynamic range from ultraviolet to visible region (190–700 nm)
set to scan from 250 nm to 540 nm, along with a Sugerlabor
Inertsil ODS-2 5-lm C18 column (25034.6 mm), and developed
using a methanol, tert-methyl butyl ether gradient system (Fraser
et al., 2000).
Carotenoids were identified by their retention time, absorption,
and fine spectra (Rouseff et al., 1996; Britton, 1998). The
carotenoid peaks were integrated at their individual maximum
wavelength and their content was calculated using calibration
curves of b-carotene (Sigma), lutein (Sigma), and neoxanthin
(Extrasynthese).
Promoter isolation and comparison
Promoters of CstLcyB1 and CstLcyB2a were obtained by genome
walking using the Universal Genome Walker Kit (Clontech, Palo
Alto, CA) and the primers described in Table 1. Promoters were
analysed by the Mobyle programme CONSENSUS for the
identification of consensus patterns in unaligned DNA sequences
(Hertz and Stormo, 1995) and by FOOTPRINTER (Blanchette and
Tompa, 2003). The FOOTPRINTER takes into account the evolutionary relationships and distances between the genes compared (based
on a phylogenetic tree). In order to choose adequate motif sizes,
we proceeded as previously reported (De Bodt et al., 2005). To
compare known sites for transcription factors with those detected
by our approach, the Plant-Care (Lescot et al., 2002) database was
scanned.
For promoter amplification from different Crocus species, the
gene-specific primers p-lycB2-f and p-LycB2-r2 described in
Table 1 were used, with the following cycling program: one cycle
at 94 C for 3 min, 35 cycles at 94 C for 20 s, 50 C for 20 s, and
72 C for 1 min, and a final extension at 72 C for 5 min. The
amplified PCR products were analysed by electrophoresis in 1%
agarose gel.
Results
Cloning and sequence analysis of C. sativus cyclases
Vector construction and Arabidopsis transformation
To produce transgenic plants in which the CstLcyB2a protein was
expressed under the control of the 35S promoter, the vector
pGWB8 was used (Nakagawa et al., 2007). The strategy followed
for cloning CstLcyB2a in this vector was based on Gateway
Technology and the oligonucleotides used are indicated in Table 1.
The CstLcyB2a cDNA was amplified with the att-primers (Table
1) and introduced into the vector pDONR221 (Invitrogen) by
a BP recombination reaction, and from this vector to the plant
expression vector pGWB8 by an LR recombination reaction, using
Gateway Technology (Invitrogen, Carlsbad, CA). The recombinant pGWB8 vector was transferred into Agrobacterium tumefaciens strain GV3101 by electroporation and bacteria were selected
on YEB agar with 50 lg ml1 kanamycin and hygromicin and 100
lg ml1 rifampicin and 25 lg ml1 gentamicin. Arabidopsis plants
were transformed by floral dipping (Clough and Bent, 1998) and
transformants selected on Murashige and Skoog agar with 50 lg
ml1 kanamycin and hygromicin.
HPLC analysis of carotenoids extracted from transgenic
Arabidopsis lines
Extraction of carotenoid pigments was performed as described by
Fiore et al. (2006), using canthaxanthin as the internal standard.
Carotenoid composition of each sample was analysed by reverse
phase HPLC using a Hewlett Packard 1100 HPLC (Palo Alto,
CA) connected on line with a photodiode array detector, with
As part of an ongoing effort to isolate genes involved in
carotenoid biosynthesis in C. sativus stigmas, two partial
sequences with homology to carotenoid cyclases were
isolated: LcyB1(GenBank accession number AJ888515) and
LcyB2 (this work). A genome walker approach allowed the
isolation of three full-length gDNA clones, one for LcyB1,
CstLcyB1 (GenBank accession number GQ202143); and
two for LcyB2, CstLcyB2a (GenBank accession number
GQ202141) and CstLcyB2b (GenBank accession number
GQ202142). Specific oligonucleotides were generated from
the predicted coding region of these three clones and used
for RT-PCR experiments on different tissues. Expression
was observed only for CstLcyB1 and CstLcyB2a. Comparison of the obtained cDNA sequences with the gDNA
sequences revealed no introns.
The isolated CstLcyB1 cDNA is 1491 bp, and the
predicted amino acid sequence specifies a polypeptide of
497 amino acids in length with a molecular mass of 56.7
kDa. The isolated CstLcyB2a full-length cDNA is 1538 bp.
The predicted amino acid sequence specifies a polypeptide
of 469 amino acids in length with a molecular mass of 51.94
kDa. The CstLcyB2b shows high homology with
CstLcyB2a, but contains a deletion of 78 amino acids close
Saffron LYC subfunctionalization | 109
to the N-terminal region (Fig. 2A). The predicted amino
acid sequence specifies a polypeptide of 391 amino acids in
length with a molecular mass of 43.6 kDa.
The substrate and product of lycopene cyclases are
hydrophobic, and many carotenogenic enzymes are tightly
associated with plastid membranes (Bonk et al., 1997;
Cunningham, 2002). Transmembrane region analysis of
C. sativus proteins using the SOSUI (Hirokawa et al., 1998)
and the TMHMM (Moller et al., 2001) programmes
predicted the presence of two transmembrane helices of 23
amino acids (368–390) and (453–475) in CstLcyB1, whereas
CstLcyB2a and CstLcyB2b amino acid sequences have no
hydrophobic domains. Using other empirically based analyses employing databases of known helical membrane-spanning domains (Hofmann and Stoffel, 1993) it seems that two
regions of the plant cyclases are likely to form transmembrane helices in CstLcyB2a and CstLcyB2b. The outer
boundaries or limits of the predicted transmembrane helical
regions are approximate, and we do not mean to imply that
these two regions are certain to form transmembrane helices
or that they are the only regions that may do so.
Data analysis with the PSORT programme (Horton et al.,
2006) predicted a plastid location for both proteins. Transit
peptides of 54 bp and 23 bp were predicted for CstLcyB1 and
CstLcyB2a, respectively (Fig. 2A). The C. sativus proteins
CstLcyB1 and CstLcyB2a contain a domain close to the Nterminus that bind dinucleotides as NAD(P) or FAD, with
the characteristic amino acid sequence DX4GXGXAX4A
(Wierenga et al., 1986; Cunningham et al., 1994), which is
missing in the CstLcyB2b protein (Fig. 2A), although all
three contain four further motifs with unknown function
(Fig. 2A) (Krubasik and Sandman, 2000), but probably
involved in their catalytic activity (Cunningham et al., 1996).
CstLcyB1 exhibited 79% identity at the amino acid level
with a Vitis vinifera lycopene b-cyclase (CAN69313) and 77%
and 71% identity with the characterized citrus and tomato
lycopene b-cyclases. However, CstLcyB2a and CstLcyB2b
are similar to chromoplast specific lycopene-b-cyclases such
as the tomato (Ronen et al., 2000) and Citrus (Alquézar
et al., 2009), to the pepper capsanthin–capsorubin synthase
(Ccs) (Bouvier et al., 1994), and to the neoxanthin synthase
gene from potato (Al-Babili et al., 2000) (Fig. 2B). Phylogenetic analysis based on the alignment of available full-length
protein sequences of plant lycopene cyclases show three main
branches corresponding to b-cyclases, e-cyclases, and a third
branch containing Ccs (Bouvier et al., 1994), which also
possesses a lycopene b-cyclase activity (Hugueney et al.,
1995), the neoxanthin synthase enzyme from Solanum tuberosum (Al-Babili et al., 2000), the tomato chromoplast-specific
b-cyclase gene (Ronen et al., 2000), and the chromoplastspecific lycopene b-cyclase from Citrus (Alquézar et al.,
2009), in addition to other plant enzymes with activities yet
to be characterized (Fig. 2B).
Driving forces for genetic divergence
A common origin by duplication of an ancestral Lcy-B gene
has been proposed for chromoplast-specific b-cyclases
(Krubasik and Sandmann, 2000). To explore whether
Darwinian positive selection was involved in driving gene
divergence of CstLcyB1 and CstLcyB2a after duplication,
the number of synonymous substitutions per synonymous
site, Ks, and the number of non-synonymous substitutions
per non-synonymous site, Ka, between both genes were
analysed. The level of replacement and synonymous site
nucleotide divergence ratio (Ka/Ks¼0.1943) indicates that
this gene pair is likely to be undergoing a purifying
selection, which strongly indicates high function constraint
of protein evolution. To detect interesting evolutionary
signatures, subregions of both protein-coding DNA sequences were scanned and the selection pressure calculated
(estimated by Ka/Ks) (Fig. 3). The output showed many
grey-coloured regions, indicating that these regions have
undergone neutral evolution. However, there were exceptions in some regions, where the red colour indicated Ka/Ks
values higher than one, hence suggesting that these regions
have undergone amino acid fixations during evolution, a fact
that indicates that these particular positions are functionally
important. These regions do in fact codify for domains
involved in catalytic activity (Fig. 2A).
Stable expression of the CstLcyB2a gene in
Arabidopsis thaliana
The function of lycopene-b-cyclase has been demonstrated
for many of the enzymes shown in the phylogenetic tree
(Fig. 2B). However, the activity of the enzymes present in
the CstLcyB2a and CstLcyB2b group seems to be more
heterogeneous. Therefore, the function of the CstLcyB2a
enzyme in transgenic Arabidopsis plants was assayed. In
a first approach, lycopene-accumulating E. coli cells,
carrying a lycopene biosynthetic plasmid (pACCRT-EIB;
Misawa and Shimada, 1998) were cotransfected with
plasmids expressing the cDNA of CstLcyB2a and
CstLcyB2b. Carotenoids were extracted and analysed by
HPLC. Expression of CstLcyB2a brought about synthesis
of b-carotene in E. coli, whereas the CstLcyB2b was unable
to transform lycopene into b-carotene (data not shown).
Due to these results, Agrobacterium tumefaciens-mediated
transformation of Arabidopsis flowers (Col-0) was performed only with the plasmid CstLcyB2a-pGWB8, in which
CstLcyB2a was driven by the cauliflower mosaic virus
(CaMV) 35S constitutive promoter. Transgenic plants
showed no morphological difference from untransformed
plants. In order to determine the carotenoid alteration
generated by the overexpression of CstLcyB2a, carotenoids
were extracted from 6-d-old transgenic seedlings (15 seedlings per line in three batches of five) and analysed by
HPLC. Eight transgenic (T3) lines were analysed, with two
of them showing carotenoid levels similar to the wild type;
whereas the other six showed increase accumulation of
b-carotene, with three of these six showing an increase in
lutein content (Fig. 4). In none of the transgenic lines were
the levels of neoxanthin and violaxanthin significantly
affected (data not shown) suggesting the lack of neoxanthin
synthase activity for CstLcyB2a.
110 | Ahrazem et al.
Fig. 2. Characteristics of the saffron beta lycopene cyclase proteins. (A) Alignment of deduced amino acid sequences of CstLcyB2a,
CstLcyB2b, and CstLcyB1 using the Kalign multiple sequence alignment algorithm. Numbers on the left denote the number of amino
acid residues. Residues identical for all sequences in a given position are in white text on a black background, those identical in two of
the three or similar in the three sequences are on a grey background. The most likely points for chloroplast precursor cleavage are
indicated with arrows. Characteristic regions of plant LCYs are indicated as boxes, the di-nucleotide binding signature, motifs (M) I to IV
(Hugueney et al., 1995; Cunningham et al., 1996). (B) Unrooted phylogenetic tree based on the amino acid sequences of algae and plant
lycopene cyclase proteins. Only full-length members of the family are included. The predicted protein sequences were initially clustered
using ClustalW. Accession numbers for non-photosynthetic plant b-cyclases: Capsicum annuum, Q42435; Citrus sinensis AAF18389;
Daucus carota, ABB52072; Solanum lycopersicum, AAG21133; Solanum tuberosum, CAB92977; Crocus sativus-a (CstLcyB2a),
GQ202141; Crocus sativus-b (CstLcyB2b), GQ202142. Accession numbers for alga b-cyclases: Haematococcus pluvialis, AY182008;
Dunaliella salina, ACA34344. Accession numbers for plant e-cyclases: Arabidopsis thaliana, AAF82389; Vitis vinifera, CAN68182.1;
Citrus sinensis, AA548096; Adonis palestina, AAK07431.1; Solanum lycopersicum, ACB28618. Accession numbers for plant
Saffron LYC subfunctionalization | 111
Expression analysis of CstLcyB1 and CstLcyB2a
The expression pattern of both genes was examined in
different organs. CstLcyB1 was highly expressed in leaves
and stigma tissue, and at lower levels in tepals (Fig. 5A). By
contrast, CstLcyB2a was only detected in the stigma tissue
(Fig. 5A). Under the conditions tested the expression of
CstLcyB2b could not be detected.
During the development of C. sativus, stigmas change in
colour from white to scarlet, passing through the yellow and
orange stages. These changes parallel stigma growth and
carotenoid and apocarotenoid accumulation (Castillo et al.,
2005; Rubio et al., 2009). The carotenoid b-carotene was
already detected in the yellow and orange stages, but
reached its highest levels in the scarlet stages. Due to the
active accumulation of b-carotene in C. sativus stigmas, and
the high expression levels detected in the tissue for
CstLcyB2a, RT-PCR analysis was performed with RNA
isolated from different stages of stigma development. The
CstLcyB2a transcript was detected in all the stages, with the
highest levels of expression in the days previous to anthesis
(Fig. 5B). The expression levels of CstLcyB1 were also
followed and transcripts were detected in the red and preanthesis stages (Fig. 5B). The levels were much lower than
the ones observed for CstLcyB2a.
Promoter divergence after duplication in C. sativus
In order to determine the origin of the differential
expression of both genes, the promoter region of CstLycB1
and CstLycB2a genes was isolated and analysed. In silico
promoter analysis (Table 2) showed that CstLcyB1 possesses several motifs involved in stress response such as
defense/stress responsiveness, MeJA, ABA, anoxia, and
light responsiveness. By contrast, the CstLycB2a promoter
possesses motifs involved in ABA, light responsiveness, and
circadian regulation. This result suggests that while both
genes are involved in b-carotene biosynthesis, CstLcyB1
expression might be modulated under biotic stress conditions. In addition, these promoters were compared with
other promoter sequences from different LycB genes and
the Ccs gene (Fig. 6A). Sequence analysis of CstLycB1 and
CstLycB2a promoters revealed the lack of similarity between both promoters. Interestingly, the phylogenetic
analysis showed that promoters of chromoplast specific
Lycb genes grouped together, with the exception of Citrus,
where both promoters showed a 51% identity. The promoters for the chromoplast-specific genes were extracted
and analysed for conserved motifs. The number of motifs
uncovered among Citrus, Crocus, and tomato or pepper
reflects the difference in the overall degree of conservation
(Fig. 6B). No motifs of size 11 bp or 12 bp were detected
among the promoters analysed due to the increase in
nucleotide substitutions, reflecting promoter divergence. In
addition, the promoters of CYC-b from tomato and Ccs
from pepper were clearly more conserved than the other
two promoters showing a one-to-one relationship, as seven
motifs of size 10 bp can be uncovered, while only five and
two of these seven conserved motifs can be identified in the
other two promoters (Fig. 6B).
Promoter structure and expression of the specific
lycopene cyclase in Crocus species with different
stigma colours
Due to the specific expression of CstLcyB2a in the stigma
tissue, its expression patterns were analysed in different
Crocus species before anthesis. These expression patterns
are characterized by their different carotenoid concentration
and composition (Castillo et al., 2005) along with a great
Fig. 3. WSPMarker results for lycopene cyclase genes. The calculated Ka/Ks ratios are plotted as slim bars within a sliding window size
of nine nucleotides.
b-cyclases: Cryptomeria japonica, BAE43526; Narcissus pseudonarcissus, Q40424; Adonis palestina, AAK07430; Citrus sinensis,
AAR89632; Sandersonia aurantica, AAL92175; Daucus carota, ABB52071; Capsicum annuum, Q43415; Solanum lycopersicum,
Q43503; Gentiana lutea, ABK57115; Arabidopsis thaliana, NP_187634; Vitis vinifera, CAO23330; Lycium barbarum, AAW88382;
Medicago truncatula, ABN07986; Carica papaya, ABD91578; Nicotiana tabacum, Q43578; Tagetes erecta, AAG10429; Oryza sativa,
BAD16478; Bixa orellana, CAD70565; Zea mays, AAO18661; Crocus sativus (CstLcyB1), GQ202143.
112 | Ahrazem et al.
deletions and changes (data not shown). The promoter
region was not amplified from C. kotschyanus.
Discussion
Fig. 4. Transgenic T3 CstLcyB2a Arabidopsis plants showed
increased levels of b-carotene. Comparison of b-carotene and
lutein content from cotyledon extracts of wild-type and eight
transgenic plants (line 4, 1, 17, 12, 18, 23, 19, and 15). Data
represent the average of b-carotene and lutein content (6SD) of
three batches of five seedlings each per transgenic line.
variety in stigma coloration (Fig. 7A). C. goulimyi has a pale
yellow stigma primarily due to a low concentration of total
carotenoids, with only phytofluene and f-carotene detected
after HPLC profile magnification (Castillo et al., 2005). The
same was observed for C. kotschyanus (data not shown),
which has a stigma similar in colour to C. goulimyi
(Fig. 7A). C. cancellatus showed high levels of phytofluene
and f-carotene, and low levels of b-carotene were detected
only after HPLC profile magnification (Castillo et al., 2005).
The pattern for C. medius is similar but low levels of
b-carotene have been detected without HPLC profile
magnification. By contrast, C. pallasii, C. hadriaticus,
C. cartwrightianus, and C. sativus all have a dark red
stigmas and showed a high carotenoid content in b-carotene
(Castillo et al., 2005). Transcripts for CstLcyB1 were
detected in all the stigmas tested with the exception of
C. goulimyi and C. kotschyanus (Fig. 7B). High expression
levels of CstLcyB2a were detected in C. hadriaticus,
C. cartwrightianus, C. pallasii, and C. sativus. By
contrast, the transcript of CstLcyB2a was undetectable in
C. goulimyi, C. kotschyanus, and C. cancellatus (Fig. 7B).
The presence of CstLcyB2a homologues in these species was
determined by PCR amplification over gDNA, and only for
C. kotschyanus was no amplification product obtained. By
contrast, the CstLcyB1 gene was detected in all the samples
tested (Fig. 7C). The PCR products obtained for both genes
from the analysed species were sequenced and compared
with the products obtained by RT-PCR, which do correspond to the expected genes.
To investigate further the absence of expression of
CstLcyB2a in C. goulimyi and C. cancellatus, the promoter
regions of different Crocus species were examined to
determine whether defects in the promoter structure could
account for the observed differences. As shown in Fig. 7D,
genomic PCR analysis of the different Crocus samples
reveals that the CstLcyB2a promoter region is equivalently
sized in C. sativus, C. hadriaticus, C. pallasi, C. cartwrightianus, and C. medius but differs in C. goulimyi and
C. cancellatus, whose promoter regions showed multiple
The increasing characterization of carotenogenic enzymes that
are specifically expressed in chromoplastic tissues represents
an important breakthrough for the study of carotenogenesis
regulation in these tissues of high economic value. In the case
of lycopene cyclation, it represents a key branching point in
the carotenoid biosynthetic pathway that profoundly affects
carotenoid composition (Cunningham, 2002). C. sativus
stigmas are characterized by the massive accumulation of
apocarotenoids derived from zeaxanthin and b-carotene
cleavage (Rubio et al., 2009). In this work, the isolation of
two different lycopene cyclase genes, namely CstLcyB1 and
CstLcyB2a is reported. CstLcyB2a was expressed in the
stigma tissue where it seems to play a major function in the
massive apocarotenoid biosynthesis and accumulation. The
expression analysis of CstLcyB2a in different Crocus species
indicates that transcriptional regulation of this gene affects
carotenoid and apocarotenoid content in the stigma tissue.
Furthermore, analysis of the promoter region indicates that
its structure determines whether or not high levels of total
apocarotenoids are produced in the different Crocus species.
Thus, these species are useful experimental models to investigate the molecular mechanism regulating carotenoid
concentration and composition in the stigma.
The polypeptides of CstLcyB1 and CstLcyB2a differ in
size, and their amino acid sequence is only 47% identical.
Phylogenetic analysis of CstLcyB1 and CstLcyB2a showed
that both are present in different groups: CstLcyB1 was
related to the initially characterized group of LcyBs whereas
CstLcyB2 was more closely related to chromoplastic cyclases
(CYC-B and CCS). Although two different CstLycB2 genes
were isolated, CstLycB2a and CstLycB2b, the CstLycB2b
protein showed a deletion of 78 aa in the N-terminal region,
which contains the dinucleotide binding signature, an
important domain present in all the LycB enzymes. Furthermore, expression for CstLycB2b in the tissues analysed
could not be detected, and protein expression assays did not
show any activity, thus suggesting that CstLycB2b is not
a functional gene in C. sativus. By contrast, CstLycB2a
showed lycopene b-cyclase activity in transgenic Arabidopsis
plants, which showed increased levels of b-carotene. In
several transgenic lines, an increase in lutein levels was
observed, which is in agreement with previous observations
suggesting that LCYe activity is not rate-limiting for lutein
levels (Diretto et al., 2006; Yu et al., 2008).
The expression of CstLcyB2a was restricted to the stigma
tissue, while the up-regulation of the CstLcyB2a gene
parallels b-carotene accumulation and the massive accumulation of apocarotenoids in the stigma tissue of C. sativus
(Castillo et al., 2005; Rubio et al., 2009). The presence of
two LcyB genes, one with a chromoplast-specific expression,
has previously been reported in other carotenogenic tissues,
mainly in fruits. The CYC-B gene from tomato is
Saffron LYC subfunctionalization | 113
Fig. 5. Expression analysis of CstLcyB1 and CstLcyB2a by RT-PCR in different tissues. (A) Expression levels in leaves, stigma, tepals,
and anthers and relative transcript levels (normalized to 18S rRNA) were determined by reverse transcriptase (RT)-PCR. (B) Stigma tissue
of C. sativus in different developmental stages: yellow (Y), orange (O), red (R), one day before anthesis (–1da), anthesis (da), two days
after anthesis (+2da), and three days after anthesis (+3da) and relative transcript levels (normalized to 18S rRNA) determined by reverse
transcriptase (RT)-PCR. All the RT-PCR experiments were repeated three times, and representative results are shown. The RPS18 gene
for 18S RNA was amplified as a control. The PCR products were separated by 1% (w/v) agarose gel electrophoresis and visualized by
ethidium bromide staining.
transiently expressed in fruit and petals, whereas it is
undetectable in roots, leaves, and stem (Ronen et al., 2000).
The orthologous CYC-B gene from watermelon might be an
essential flesh colour determinant in this fruit (Tadmor
et al., 2005), while in orange the Csb-LCY2 plays a key role
in the carotenogenesis of citrus fruits by redirecting the flux
of carotenes into the b,b-branch to lead to the accumulation
of xanthophylls characteristic of orange fruit ripening
(Alquezar et al., 2009). Therefore, the involvement of
a second chromoplastic-specific LcyB gene in the regulation
of carotenoid composition appears to be a frequent mechanism in carotenoid rich tissues. Interestingly, no homologues to this chromoplast specific lycopene b-cyclases have
been identified in Arabidopsis and rice whose genomes are
fully sequenced, probably due to the absence of tissues rich
in carotenoids in these species. Although the complete
genome has been duplicated several times in both plants in
their evolutionary past, fewer than 27% of A. thaliana
(Blanc et al., 2003) and 15.4% of rice genes (Wu et al., 2008)
have been retained as duplicates. In fact, loss is the most
likely fate of a duplicated gene (Walsh, 1995; Lynch and
Connery, 2003), and retention has often been explained by
functional divergence occurring by either neo- or subfunctionalization. Among the groups of duplicated genes with
high retention rates are those involved in secondary
metabolism (Maere et al., 2005). Evolutionarily, a common
origin by duplication of an ancestral Lcy-B gene has been
proposed for chromoplast-specific b-cyclases (Krubasik and
Sandmann, 2000). Retention of both genes could be
explained by a selective advantage acquired through the
functionally redundant activity of duplicated genes (Osborn
et al., 2003) increasing the levels of the gene product in
114 | Ahrazem et al.
Table 2. List of motifs found in the promoter regions of CstLcyB1 and CstLcyB2a genes
Motif
Sequence
Function
CstLcyB1
promoter a
CstLcyB2a
promoter a
A-Box
CCAAT-box
Circadian
GA motif
GT1-motif
G-Box
MNF1
Sp1
CATT motif
GAG motif
W-box
CCGTCC
CAACGG
CAANNNNATC
AAGGAAGA
GGTTAA
CACGTG/CACGTT
GTGCCC(A/T)(A/T)
CC(G/A)CCC
GCATTC
GGAGATG
TTGACC
–
–
–
–
–
x
x
x
x
x
x
X
x
x
x
x
x
x
x
–
–
–
Box-W1
TTGACC
x
–
ARE
CGTCA-motif
TGACG-motif
ABRE
TATA BOX
CAAT box
TGGTTT
CGTCA
TGACG
CACGTG
Cis-acting regulatory element
MYBhv binding site
Circadian regulation
Light response element
Light response element
Light responsiveness
Light response element
Light response element
Light response element
Light response element
Elicitor, wounding and
pathogen response element
Fungal elicitor response
element
Anoxia response element
MeJA response element
MeJA response element
ABA responsiveness
Core promoter element
Common cis-acting element
x
x
x
x
x
x
–
–
–
x
x
x
a
x, Present; –, absent.
Fig. 6. Promoter analysis of lycopene cyclase genes. (A) Phylogenetic tree of lycopene b-cyclases, the Ccs and chromoplast-specific
lycopene b-cyclases genes generated by multiple alignments of the nucleotide sequences in the 5#-upstream region. The accession
numbers used are: Citrus Csb-Lcy1, AY094582.1; Citrus Csb-Lcy2, AF169241; pepper Ccs, DQ907615.1; tomato CYCb, AC2110461;
Carica papaya CpLcyb1, DQ415894.1; Medicago truncatula MtLcyb1, AC153128.1; Arabidopsis thaliana AtLcyb AC009400.4; Oryza
sativa OsLcyb, AP005849.3; Zea mays ZmLcyb, AC265536; C. sativus CstLcyb1, GQ202145, and C. sativus CstLcyb2-a, GQ202145.
(B) Visual representation of motifs detected by FOOTPRINTER in the promoters of Ccs pepper and Citrus, tomato, and Crocus chromoplastspecific lycopene b-cyclases (FOOTPRINTER parameters: motif size: 10, allowed mutations 2, losses).
a particular tissue or time (Force et al., 1999; Osborn et al.,
2003). Therefore, recruitment of carotenoid metabolism in
plant tissues with a high carotenoid content could have
occurred later on in evolution through gene subfunctionalization, suggesting it was the case for CstLcyB2a during
stigma development and for CYC-B and Csb-LCY2 during
Saffron LYC subfunctionalization | 115
Fig. 7. Pigmentation levels of stigmas from different Crocus
species are associated with CstLcyB2a transcript accumulation.
(A) Photographs showing the external pigmentation of stigmas of
several Crocus species: from left to right and from top to bottom:
C. cancellatus, C. hadriaticus, C. cartwrightianus, C. sativus, C.
pallasii, C. goulimyi, C. medius, and C. kotschyanus. (B) Detection
of CstLcyB1 and CstLcyB2a transcripts by RT-PCR in preanthesis
stigmas in different Crocus species and relative transcript levels
(normalized to 18S rRNA). Number from 1 to 8 correspond to: C.
cancellatus, C. hadriaticus, C. cartwrightianus, C. sativus, C.
pallasii, C. goulimyi, C. medius, and C. kotschyanus. The levels of
constitutively expressed RPS18 coding gene were assayed as
controls. (C) PCR amplification of CstLcyB1 and CstLcyB2a
genes from the genomes of the indicated Crocus species. Both
genes were amplified in the genomic region corresponding to
their cDNAs. (D) PCR amplification of the CstLcyB2a promoter
from the genomes of the indicated Crocus species. Promoters
were amplified from a region corresponding to 759 bp upstream
of the translational start site (GenBank GQ202144) of C. sativus
promoter. The PCR products were separated by 1% (w/v)
agarose gel electrophoresis and visualized by ethidium bromide
staining.
fruit development. The acquisition of distinct expression
patterns could be explained by the analysis of the respective
promoters. The results obtained indicate that similar gene
expression patterns should be expected for the most
conserved promoters, a fact which has been experimentally
confirmed for the tomato and pepper genes (Hugueney
et al., 1995; Ronen et al., 2000). The poor degree of
conservation of the analysed promoters with the Crocus
sequence suggests that it has acquired distinct expression
patterns, as confirmed in the present study, with high
expression levels in the stigma tissue.
In previous studies, it was found that Crocus species
showing dark red stigmas accumulate increasing levels of
total carotenoids and apocarotenoids during development,
whereas Crocus species with non-dark red stigmas accumulate lower levels of total carotenoids and apocarotenoids.
The observed expression patterns of CstLcyB2a in different
Crocus species suggest that previously observed b-carotene
and apocarotenoid accumulation (Castillo et al., 2005; Rubio
et al., 2009) were regulated, in part, at CstLcyB2a transcriptional level, together with b-carotene hydroxylase 1 (Castillo
et al., 2005). Nevertheless, it should be noted that, in the case
of the species in which CstLycB2a transcripts were absence,
the accumulation of phytofluene and f-carotene suggests that
upstream enzymes in the pathway are also affected, and that
the chromoplast-specific pathway in these species has been
lost during evolution. Our current data, which indicates that
the expression levels of the carotenoid biosynthetic genes are
the key regulators of the high levels of total carotenoid
accumulation in Crocus stigmas, are in good agreement with
previous results obtained in other tissues of different plants.
In other carotenogenic tissues such as fruits, the regulation
of chromoplast specific lycopene b-cyclase has been shown to
be critical in the specific accumulation of b-carotene in
tomato (Ronen et al., 2000). The pale orange coloration of
Beta mutant fruits is due to an important increase in the
transcription of this gene, which leads to a higher accumulation of b-carotene than in wild-type fruit. By contrast, the
old-gold mutant carries a null allele of this chromoplast
specific LcyB resulting in a reduction of b-carotene (Ronen
et al., 2000). In pepper, the high expression levels of the Ccs
gene are correlated with high levels of capsanthin (Bouvier
et al., 1994). In Citrus, the up-regulation of a chromoplast
specific lycopene cyclase gene, Csb-LCY2, parallels the
massive accumulation of b,b-xanthophylls accompanying
orange fruit maturation (Rodrigo et al., 2004).
Several genetic studies have shown the relationship
between the presence of structural genes for carotenoid
biosynthesis and the phenotypic variability in carotenoid
accumulation (Thorup et al., 2000; Wong et al., 2004;
Tadmor et al., 2005; Harjes et al., 2008; Alquézar et al.,
2009). In Crocus, the relationship between the presence of
the CstLcyB2 transcript and the phenotypic variability in
stigma colours is due to alterations in the gene structure. A
similar phenomenon has been found in the tomato CYC-B
gene (Ronen et al., 2000). In pepper, several studies have
reported that the Ccs gene is either deleted or mutated in
yellow cultivars (Popovsky and Paran, 2000; Ha et al.,
116 | Ahrazem et al.
2007). In watermelon, polymorphisms in the coding region
of LcyB are determinant of the yellow or red flesh
coloration (Bang et al., 2007) while in red grapefruit amino
acid alterations are likely to be involved in the loss of
activity of a b-LCY2b Citrus allele (Alquézar et al., 2009).
The absence of coding and genomic regions of LcyB2a in
C. kotschyanus has no phenotypic manifestation in leaves
and stems, indicating that LcyB2a plays a dispensable role
in vegetative tissues under normal growth conditions, as has
been observed in the old gold tomato mutant (Ronen et al.,
2000) and in Star Ruby grapefruit (Alquézar et al., 2009). In
C. goulimyi and C. cancellatus, although the coding
sequence of LcyB2a was present, multiple deletions in the
promoter seem to impair the promoter activity.
In summary, two lycopene cyclase genes from C. sativus,
CstLcyB1 and CstLcyB2a have been identified and characterized. Based on the low sequence identity to each other, it
is likely that this gene pair arose from an old gene
duplication event. The absence of LcyB2 orthologues in
plants that do not accumulate high levels of carotenoids
suggests that LcyB2 is a LcyB1 paralogue that acquired
a new expression pattern by subfunctionalization, which
allows a tight and timely control over the synthesis of
carotenoids in specific tissues. In the stigma tissue, transcript levels of CsLcyB2a were found to correlate positively
with stigma carotenoid content in genetically diverse
Crocus, suggesting that the major regulatory control of
carotenogenesis in this tissue is at the transcriptional level.
Acknowledgements
We thank T Goode for Crocus photographs, and KA Walsh
(Escuela Técnica Superior de Ingenieros Agrónomos, Universidad de Castilla-La Mancha, Albacete, Spain) for
language revision. This work was supported by the
Ministerio de Educación y Ciencia (BIO2006/00841) and
Consejerı́a de Educación y Ciencia (PAI08-0211-6481).
References
Abdullaev FI. 2002. Cancer chemopreventive and tumoricidal
properties of saffron (Crocus sativus L.). Experimental Biology and
Medicine (Maywood, NJ) 227, 20–25.
Al-Babili S, Hugueney P, Schledz M, Welsch R, Frohnmeyer H,
Laule O, Beyer P. 2000. Identification of a novel gene coding for
neoxanthin synthase from Solanum tuberosum. FEBS Letters 485,
168–712.
Alquézar B, Zacarias L, Rodrigo MJ. 2009. Molecular and
functional characterization of a novel chromoplast-specific lycopene
b-cyclase from Citrus and its relation to lycopene accumulation.
Journal of Experimental Botany 60, 1783–1797.
Bang H, Kim S, Leskovar D, King S. 2007. Development of
a codominant CAPS marker for allelic selection between canary yellow
and red watermelon based on SNP in lycopene b-cyclase (LCYB)
gene. Molecular Breeding 20, 63–72.
Blanc G, Hokamp K, Wolfe K. 2003. A recent polyploidy
superimposed on older large-scale duplications in the Arabidopsis
genome. Genome Research 13, 137–144.
Blanchette M, Tompa M. 2003. FootPrinter: a program designed for
phylogenetic footprinting. Nucleic Acids Research 31, 3840–3842.
Bonk M, Hoffmann B, Von Lintig J, Schledz M, Al-Babili S,
Hobeika E, Kleinig H, Beyer P. 1997. Chloroplast import of four
carotenoid biosynthetic enzymes in vitro reveals differential fates prior
to membrane binding and oligomeric assembly. European Journal of
Biochemistry 247, 942–950.
Botella-Pavı́a P, Rodrı́guez-Concepción M. 2006. Carotenoid
biotechnology in plants for nutritionally improved foods. Physiologia
Plantarum 126, 369–381.
Bouvier F, D’harlingue A, Backhaus RA, Kumagai MH, Camara B.
2000. Identification of neoxanthin synthase as a carotenoid cyclase
paralog. European Journal of Biochemistry 267, 6346–6352.
Bouvier F, Hugueney P, d’Harlingue A, Kuntz M, Camara B.
1994. Xanthophyll biosynthesis in chromoplasts: isolation and
molecular cloning of an enzyme catalyzing the conversion of 5,6epoxycarotenoid into ketocarotenoid. The Plant Journal 6, 45–54.
Britton G. 1998. Overview of carotenoid biosynthesis. In: Britton G,
Liaaen-Jensen S, Pfander H, eds. Biosynthesis and metabolism,
Vol. 3. Basel: Birkhäuser Verlag, 13–148.
Busch M, Seuter A, Hain R. 2002. Functional analysis of the early
steps of carotenoid biosynthesis in tobacco. Plant Physiology 128,
439–453.
Castillo R, Fernández JA, Gómez-Gómez L. 2005. Implications of
carotenoid biosynthetic genes in apocarotenoid formation during the
stigma development of Crocus sativus and its closer relatives. Plant
Physiology 139, 674–689.
Clotault J, Peltier D, Berruyer R, Thomas M, Briard M,
Geoffriau E. 2008. Expression of carotenoid biosynthesis genes
during carrot root development. Jounal of Experimental Botany 59,
3563–7353.
Clough SJ, Bent AF. 1998. Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. The
Plant Journal 16, 735–743.
Cunningham FX. 2002. Regulation of carotenoid synthesis and
accumulation in plants. Pure and Applied Chemistry 74, 1409–1417.
Cunningham FX, Gantt E. 1998. Genes and enzymes of carotenoid
biosynthesis in plants. Annual Review of Plant Physiology and Plant
Molecular Biology 49, 557–583.
Cunningham FX, Pogson B, Sun Z, McDonald KA,
DellaPenna D, Gantt E. 1996. Functional analysis of the beta and
epsilon lycopene cyclase enzymes of Arabidopsis reveals
a mechanism for control of cyclic carotenoid formation. The Plant Cell
8, 1613–1626.
Cunningham Jr FX, Sun Z, Chamovitz D, Hirschberg J, Gantt E.
1994. Molecular structure and enzymatic function of lycopene cyclase
from the cyanobacterium Synechococcus sp. strain PCC7942. The
Plant Cell 6, 1107–1121.
De Bodt S, Maere S, Van de Peer Y. 2005. Genome duplication and
the origin of angiosperms. Trends in Ecology and Evolution 20,
591–597.
Saffron LYC subfunctionalization | 117
DellaPenna D, Pogson BJ. 2006. Vitamin synthesis in plants:
tocopherols and carotenoids. Annual Review of Plant Biology 57,
711–738.
Del Villar-Martı́nez AA, Garcı́a-Saucedo PA, Carabez-Trejo A,
Cruz-Hernández A, Paredes-López O. 2005. Carotenogenic gene
expression and ultrastructural changes during development in
marigold. Journal of Plant Physiology 162, 1046–1056.
Diretto G, Tavazza R, Welsch R, Pizzichini D, Mourgues F,
Papacchioli V, Beyer P, Giuliano G. 2006. Metabolic engineering of
potato tuber carotenoids through tuber-specific silencing of lycopene
epsilon cyclase. BMC Plant Biology 26, 6:13.
Doyle JJ, Doyle LH. 1990. Isolation of plant DNA from fresh tissue.
Focus 12, 13–15.
Fiore A, Dall’Osto L, Fraser P, Bassi R, Giuliano G. 2006.
Elucidation of the b-carotene hydroxylation pathway in Arabidopsis
thaliana. FEBS letters 580, 4718–4722.
Force A, Lynch M, Pickett FB, Amores A, Yan YL,
Postlethwait J. 1999. Preservation of duplicate genes by
complementary, degenerative mutations. Genetics 151, 1531–1545.
Hirschberg J. 2001. Carotenoid biosynthesis in flowering plants.
Current Opinion in Plant Biology 4, 210–218.
Hirokawa T, Boon-Chieng S, Mitaku S. 1998. SOSUI: classification
and secondary structure prediction system for membrane proteins.
Bioinformatics 14, 378–379.
Hofmann K, Stoffel W. 1993. A database of membrane spanning
protein segments. Biological Chemistry Hoppe-Seyler 374, 166.
Horton P, Park K-J, Obayashi T, Nakai K. 2006. Protein subcellular
localization prediction with WoLF PSORT. Proceedings of Asian Pacific
Bioinformatics Conference, Taipei, Taiwan.
Horton P, Ruban AV, Walters RG. 1996. Regulation of light
harvesting in green plants. Annual Review of Plant Physiology and
Plant Molecular Biology 47, 655–684.
Hugueney P, Badillo A, Chen HC, Klein A, Hirschberg J,
Camara B, Kuntz M. 1995. Metabolism of cyclic carotenoids:
a model for the alteration of this biosynthetic pathway in Capsicum
annuum chromoplasts. The Plant Journal 8, 417–424.
Fraser PD, Bramley PM. 2004. The biosynthesis and nutritional uses
of carotenoids. Progress in Lipid Research 43, 228–265.
Isaacson T, Ronen G, Zamir D, Hirschberg J. 2002. Cloning of
tangerine from tomato reveals a carotenoid isomerase essential for
production of b-carotene and xanthophylls in plants. The Plant Cell 14,
333–342.
Fraser PD, Pinto ME, Holloway DE, Bramley PM. 2000. Technical
advance: application of high-performance liquid chromatography with
photodiode array detection to the metabolic profiling of plant
isoprenoids. The Plant Journal 24, 551–558.
Kato M, Ikoma Y, Matsumoto H, Sugiura M, Hyodo H, Yano M.
2004. Accumulation of carotenoids and expression of carotenoid
biosynthetic genes during maturation in Citrus fruit. Plant Physiology
134, 824–837.
Fraser PD, Truesdale MR, Bird CR, Schuch W, Bramley PM.
1994. Carotenoid biosynthesis during tomato fruit development. Plant
Physiology 105, 405–413.
Krubasik P, Sandmann G. 2000. Molecular evolution of lycopene
cyclases involved in the formation of carotenoids with ionone end
groups. Biochemical Society Transactions 28, 806–810.
Galpaz N, Ronen G, Khalfa Z, Zamir D, Hirschberg J. 2006. A
chromoplast-specific carotenoid biosynthesis pathway is revealed by
cloning of the tomato white-flower locus. The Plant Cell 18,
1947–1960.
Lassmann T, Sonnhammer EL. 2005. Kalign-an accurate and fast
multiple sequence alignment algorithm. BMC Bioinformatics 6, 298.
Giorio G, Stigliani AL, D’Ambrosio C. 2008. Phytoene synthase
genes in tomato (Solanum lycopersicum L.): new data on the
structures, the deduced amino acid sequences and the expression
patterns. FEBS Journal 275, 527–535.
Giuliano G, Bartley GE, Scolnik PA. 1993. Regulation of carotenoid
biosynthesis during tomato development. The Plant Cell 5, 379–387.
Giuliano G, Tavazza R, Diretto G, Beyer P, Taylor MA. 2008.
Metabolic engineering of carotenoid biosynthesis in plants. Trends in
Biotechnology 26, 139–145.
Ha SH, Kim JB, Park JS, Lee SW, Cho KJ. 2007. A comparison of
the carotenoid accumulation in Capsicum varieties that show different
ripening colours: deletion of the capsanthin-capsorubin synthase gene
is not a prerequisite for the formation of a yellow pepper. Journal of
Experimental Botany 58, 3135–3144.
Harjes CE, Rocheford TR, Bai L, et al. 2008. Natural genetic
variation in lycopene epsilon cyclase tapped for maize biofortification.
Science 319, 330–333.
Hertz GZ, Stormo GD. 1995. Identification of consensus patterns in
unaligned DNA and protein sequences: a large-deviation statistical
basis for penalizing gaps. In: Lim HA, Cantor CR eds. Proceedings of
the third international conference on bioinformatics and genome
research. Singapore: World Scientific Publishing Co., Ltd, 201–216.
Lee YS, Kim TH, Kang TW, Chung WH, Shin GS. 2008.
WSPMarker: a web tool for calculating selection pressure in proteins
and domains using window-sliding. BMC Bioinformatics 12, 9 Suppl
12:S13.
Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de
Peer Y, Rouzé P, Rombauts S. 2002. PlantCARE, a database of
plant cis-acting regulatory elements and a portal to tools for in silico
analysis of promoter sequences. Nucleic Acids Research 30,
325–327.
Leyser O. 2008. Strigolactones and shoot branching: a new trick for
a young dog. Developmental Cell 15, 337–338.
Li F, Murillo C, Wurtzel ET. 2007. Maize Y9 is essential for 15-ciszetacarotene isomerization. Plant Physiology 144, 1181–1189.
Li F, Vallabhaneni R, Yu J, Rocheford T, Wurtzel ET. 2008a. The
maize phytoene synthase gene family: overlapping roles for
carotenogenesis in endosperm, photomorphogenesis, and thermal
stress tolerance. Plant Physiology 147, 1334–1346.
Li F, Vallabhaneni R, Wurtzel ET. 2008b. PSY3, a new member of
the phytoene synthase gene family conserved in the Poaceae and
regulator of abiotic stress-induced root carotenogenesis. Plant
Physiology 146, 1333–1345.
Lynch M, Connery J. 2003. The evolutionary demography of
duplicate genes. Journal of Structural and Functional Genomics 3,
489–505.
118 | Ahrazem et al.
Maere S, De Bodt S, Raes J, Casneuf T, Van Montagu M,
Kuiper M, Van de Peer Y. 2005. Modeling gene and genome
duplications in eukaryotes. Proceedings of the National Academy of
Sciences, USA 102, 5454–5459.
Römer S, Hugueney P, Bouvier F, Camara B, Kuntz M. 1993.
Expression of the genes encoding the early carotenoid biosynthetic
enzymes in Capsicum annuum. Biochemical and Biophysical
Research Communications 196, 1414–1421.
Marty I, Bureau S, Sarkissian G, Gouble B, Audergon JM,
Albagnac G. 2005. Ethylene regulation of carotenoid accumulation
and carotenogenic gene expression in colour-contrasted apricot
varieties (Prunus armeniaca). Journal of Experimental Botany 417,
1877–1886.
Ronen G, Carmel-Goren L, Zamir D, Hirschberg J. 2000. An
alternative pathway to beta-carotene formation in plant chromoplasts
discovered by map-based cloning of beta and old-gold colour
mutations in tomato. Proceedings of the National Academy of
Sciences, USA 97, 11102–11107.
Misawa N, Shimada H. 1998. Metabolic engineering for the
production of carotenoids in non-carotenogenic bacteria and yeasts.
Journal of Biotechnology 59, 169–181.
Ronen G, Cohen M, Zamir D, Hirschberg J. 1999. Regulation of
carotenoid biosynthesis during tomato fruit development: expression
of the gene for lycopene epsilon cyclase is down regulated during
ripening and is elevated in the mutant delta. The Plant Journal 17,
341–351.
Moehs CP, Tian L, Osteryoung KW, DellaPenna D. 2001. Analysis
of carotenoid biosynthetic gene expression during marigold petal
development. Plant Molecular Biology 45, 281–293.
Moller S, Croning MDR, Apweiler R. 2001. Evaluation of methods
for the prediction of membrane spanning regions. Bioinformatics 17,
646–653.
Moraga AR, Nohales PF, Pérez JA, Gómez-Gómez L. 2004.
Glucosylation of the saffron apocarotenoid crocetin by
a glucosyltransferase isolated from Crocus sativus stigmas. Planta
219, 955–966.
Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M,
Niwa Y, Toyooka K, Matsuoka K, Jinbo T, Kimura T. 2007.
Development of a series of gateway binary vectors, pGWBs, for
realizing efficient construction of fusion genes for plant transformation.
Biosciences and Bioengineering 104, 34–41.
Osborn TC, Pires JC, Birchler J, et al. 2003. Understanding
mechanisms of novel gene expression in polyploids. Trends in
Genetics 19, 141–147.
Otto SP, Whitton J. 2000. Polyploid incidence and evolution. Annual
Review of Genetics 34, 401–437.
Park H, Kreunen SS, Cuttriss AJ, DellaPenna D, Pogson BJ.
2002. Identification of the carotenoid isomerase provides insight into
carotenoid biosynthesis, prolamellar body formation, and
photomorphogenesis. The Plant Cell 14, 321–332.
Pecker I, Gabbay R, Cunningham FX, Hirschberg J. 1996.
Cloning and characterization of the cDNA for lycopene beta-cyclase
from tomato reveals decrease in its expression during fruit ripening.
Plant Molecular Biology 30, 807–819.
Pogson B, McDonald KA, Truong M, Britton G, DellaPenna D.
1996. Arabidopsis carotenoid mutants demonstrate that lutein is not
essential for photosynthesis in higher plants. The Plant Cell 8,
1627–1639.
Popovsky S, Paran I. 2000. Molecular genetics of the y locus
in pepper: its relation to capsanthin-capsorubin synthase
and to fruit colour. Theoretical and Applied Genetics 101,
86–89.
Rouseff R, Raley L, Hofsommer HJ. 1996. Application of diode
array detection with a C-30 reversed phase column for the separation
and identification of saponified orange juice carotenoids. Journal of
Agricultural and Food Chemistry 44, 2176–2181.
Rubio A, Rambla JL, Ahrazem O, Granell A, Gómez-Gómez L.
2009. Metabolite and target transcript analyses during Crocus sativus
stigma development. Phytochemistry 70, 1009–1016.
Rubio A, Rambla JL, Santaella M, Gómez MD, Orzaez D,
Granell A, Gómez-Gómez L. 2008. Cytosolic and plastoglobuletargeted carotenoid dioxygenases from Crocus sativus are both
involved in beta-ionone release. Journal of Biological Chemistry 283,
24816–24825.
Steinbrenner J, Linden H. 2001. Regulation of two carotenoid
biosynthesis genes coding for phytoene synthase and carotenoid
hydroxylase during stress-induced astaxanthin formation in the green
alga Haematococcus pluvialis. Plant Physiology 125, 810–817.
Tadmor Y, King S, Levi A, Davis A, Meir A, Wasserman B,
Hirschberg J, Lewinsohn E. 2005. Comparative fruit colouration in
watermelon and tomato. Food Research International 38, 837–841.
Thorup TA, Tanyolac B, Livingstone KD, Popovsky S, Paran I,
Jahn M. 2000. Candidate gene analysis of organ pigmentation loci in
the Solanaceae. Proceedings of the National Academy of Sciences,
USA 97, 11192–11197.
Verma SK, Bordia A. 1998. Antioxidant property of Saffron in man.
Indian Journal of Medical Sciences 52, 205–207.
Walsh J. 1995. How often do duplicated genes evolve new functions?
Genetics 139, 421–428.
Wendel JF. 2000. Genome evolution in polyploids. Plant Molecular
Biology 42, 225–249.
Wierenga RK, Terpstra P, Hol WGL. 1986. Prediction of the
occurrence of the ADP-binding b’b-fold in proteins, using an amino
acid sequence fingerprint. Journal of Molecular Biology 187, 101–107.
Prince VE, Pickett FB. 2002. Splitting pairs: the diverging fates of
duplicated genes. Nature Reviews Genetics 3, 827–837.
Wong JC, Lambert RJ, Wurtzel ET, Rocheford TR. 2004. QTL
and candidate genes phytoene synthase and zeta-carotene
desaturase associated with the accumulation of carotenoids in maize.
Theoretical and Applied Genetics 108, 349–359.
Rodrigo MJ, Marcos JF, Zacarı́as L. 2004. Biochemical and
molecular analysis of carotenoid biosynthesis in flavedo of orange
(Citrus sinensis L.) during fruit development and maturation. Journal of
Agricultural and Food Chemistry 52, 6724–6731.
Wu Y, Zhu Z, Ma L, Chen M. 2008. The preferential retention of
starch synthesis genes reveals the impact of whole-genome
duplication on grass evolution. Molecular Biology and Evolution 25,
1003–1006.
Saffron LYC subfunctionalization | 119
Yu B, Lydiate DJ, Young LW, Schäfer UA, Hannoufa A. 2008.
Enhancing the carotenoid content of Brassica napus seeds by
downregulating lycopene epsilon cyclase. Transgenic Research 17,
573–585.
Zhu C, Yamamura S, Koiwa H, Nishihara M, Sandmann G. 2002.
cDNA cloning and expression of carotenogenic genes during
flower development in Gentiana lutea. Plant Molecular Biology 48,
277–285.
Zhu C, Yamamura S, Nishihara M, Koiwa H, Sandmann G. 2003.
cDNAs for the synthesis of cyclic carotenoids in petals of Gentiana
lutea and their regulation during flower development. Biochimica et
Biophysica Acta 1625, 305–308.