Download BIO 141 PTC DNA Fingerprint Analysis

Bio. 141 Lab
BIO 141 PTC DNA Fingerprint Analysis
(Modified 3/14)
PTC DNA Fingerprint Gel
taster
100 bp
ladder
Tt
nontaster
tt
303 bp
303 bp
taster
Tt
taster
TT
500 bp
239 bp
300 bp
239 bp
100 bp
64 bp
64 bp
1
nontaster
tt
nontaster
tt
taster
Tt
nontaster
tt
Bio. 141 Lab
DNA Fingerprinting and its Role in Forensics
Genetic uniqueness is a fact of life. From generation to generation, characteristics are inherited,
combined, and assorted among individuals through a common denominator: the chemical
deoxyribonucleic acid or DNA. No two individuals have identical DNA sequences. Differences
in DNA sequences between individuals can be detected by using a technique called DNA
fingerprinting. This technique has wide-ranging applications including determining whether an
individual was present at a crime scene. By matching a suspect’s DNA sample with DNA
samples obtained at the crime scene, we can determine with a high degree of accuracy whether
the suspect might be guilty of the crime. DNA fingerprinting is extremely useful in exonerating
innocent people who are suspects in criminal cases.
DNA’s structure resembles a twisted ladder called the double helix. DNA in all organisms
consists of four bases called guanine, adenine, thymine, and cytosine. The unique order or
sequence of these bases in an individual’s cells serves as the blueprint for that individual. Of the
approximately 3.3 billion base pairs that make up a human genome, only a fraction (1%),
approximately 3 million base pairs, differs between any two individuals. This is the DNA used
to conduct a fingerprint analysis.
DNA can be found in almost all of your cells; one exception is red blood cells. Since blood
contains many other cell types (such as white blood cells) in addition to red blood cells, DNA
can be obtained for fingerprint analysis from blood. With few exceptions, the composition of a
person’s DNA does not vary from cell to cell. We can examine DNA from blood, a hair follicle,
semen, or any other tissue and if the samples are from the same person, the DNA banding pattern
(fingerprint) will be identical.
DNA fingerprint analysis is used in forensics to determine whether the biological material from a
known individual can be matched to a sample from an unidentified individual. Several methods
to detect DNA differences exist in DNA fingerprint analysis. Basically, scientists isolate DNA
from individuals, measure the size of certain variable fragments of DNA, and compare these
DNA fragments to each other using a technique called electrophoresis.
In order for you to better understand the technology used in DNA fingerprint analysis, it is
important that you understand how DNA fingerprint analysis works. I have planned two
laboratory exercises in which you will learn some basic molecular techniques that are used in
DNA fingerprint analysis. The first experiment revolves around a hypothetical crime you must
solve using DNA fingerprints. In the second laboratory experiment, you will isolate your DNA
and analyze your DNA fingerprint for a specific gene.
CRIME SCENE LAB
The Case of the Chewed Shoes
Ms. Becky Richtsmeier owns four dogs. Last week she noticed that one of her dogs chewed her
new pair of shoes. She wants to send the culprit to dog obedience school, but she does not know
which of her dogs chewed her shoes. Fortunately, the culprit left some strands of hair on the
chewed shoes. Ms. Richtsmeier put the hair in a plastic bag and labeled it sample A. She then
2
Bio. 141 Lab
took hair from each of her four dogs and labeled the samples dog 1, dog 2, dog 3, and dog 4. She
extracted DNA from the follicles at the end of the hair samples and labeled them with the dog
number. She is providing you with the samples and wants you to determine which dog chewed
her shoes based on the DNA fingerprint. Each group of two students will be provided with a
DNA sample from the culprit (sample A) and one of the four dogs. Your job is to determine
which of Ms. Richtsmeier’s dogs chewed her shoes so that she can send the dog to obedience
school.
DNA FINGERPRINT EXPERIMENT
1. In order to visualize your DNA sample, you need to make an agarose gel. Add gel buffer
into a 125 mL flask containing the pre-weighed agarose. Your lab instructor will
determine the volume of gel buffer you should add. Swirl the flask.
2. Place the flask into the microwave oven and heat the agarose solution until it boils. BE
CAREFUL NOT TO LET THE AGAROSE SOLUTION BOIL OUT OF THE FLASK.
3. Place a thermometer into the flask and when the temperature reaches 60°C have the
instructor add ethidium bromide. Ethidium bromide stains the DNA so that it can be
visualized following electrophoresis. Be sure to wear protective gloves because
ethidium bromide is a mutagen.
4. Pour the hot agarose solution into a gel mold and allow the agarose to harden for about
20 minutes.
5. Each group of two students will be provided with a sample of the culprit’s DNA in a
microcentrifuge tube labeled A and a sample of one of Ms. Richtsmeier’s dogs in a tube
labeled either 1, 2, 3, or 4. Add 10 l of dH2O to each sample. Add 5 l of tracking dye
to each sample. The tracking dye is used to keep the sample in the well and to monitor
the migration of the DNA in the agarose gel during electrophoresis.
6. Mix the samples well. Place the samples in the microcentrifuge and centrifuge them for 5
seconds.
7. After the gel has hardened, remove the side supports and comb. Place the tray into the
electrophoretic chamber and fill the chamber with gel buffer.
8. Using a micropipette, suck your sample out of the tube. Place the top of the pipette tip
into the top of the well and dispense the DNA into the well. Do not let the pipette tip
touch the bottom of the well because it will puncture the gel. Discard the pipette tip in
the trash after loading your sample and use a new tip for the next sample.
9. Your instructor will show you how to run the gel.
10. Following electrophoresis, you can view the DNA under an ultraviolet light source. The
DNA will appear bright orange.
3
Bio. 141 Lab
11. From the DNA patterns observed on the gel, determine which of the dogs will spend next
month in obedience school.
HUMAN DNA FINGERPRINT ANALYSIS
Reading the newspaper today you undoubtedly have come across numerous uses for DNA
fingerprinting. Establishing a sexual relationship between a certain President and an intern,
determining whether two babies were switched at birth in a hospital, or determining whether a
certain suspect committed a crime are only a few of the many uses of DNA fingerprinting. More
and more today, our legal system is turning to biotechnology for a solution to these problems.
Human DNA typing is a powerful tool in biotechnology that can definitively determine identity
by examining an individual’s genetic code. However, given that human and chimpanzee DNA
are between 98-99% identical, you can imagine how tiny the differences are between DNA from
two people. However, there are specific regions in the DNA of your chromosomes in which
variability between individuals can easily be found.
The lab we are about to undertake uses one of these variable regions to distinguish differences in
individuals. We will be identifying two different forms, (alleles), of a gene related to your
ability to taste a chemical compound called phenylthiocarbamate, or PTC (Figure 1). This
compound is
Figure 1. The structure of PTC.
often used as a classroom demonstration to illustrate the Mendelian inheritance of a physical trait
or phenotype, so some of you may already know that you are a “taster”. Within the general
population, about 70% of the people tested can taste PTC, whereas the other 30% cannot.
Your ability to taste PTC is controlled by a single gene that exists either as a dominant, taster
allele (T) or as a recessive, non-taster allele (t). You inherit one maternal copy of the gene and
one paternal copy. The combination of these different alleles within an individual is referred to
as a genotype, which in turn dictates whether or not you have the “taster” or “non-taster”
phenotype. People who can taste PTC have one of two possible genotypes; either they are
homozygous dominant and have two copies of the taster allele (TT), or they are heterozygous
and have one taster allele and one non-taster allele (Tt). “Non-tasters” are homozygous recessive
and have two copies of the non-taster allele (tt).
The PTC gene is also found in other primate populations, and apparently, someone has figured
out a way to tell which monkeys can and which cannot taste PTC. The interesting thing is that
not all of the PTC genes are the same among primate populations (including humans), suggesting
4
Bio. 141 Lab
that this trait is important and therefore has been maintained through evolution. Perhaps the PTC
genes help to influence food preferences, maybe to avoid a bitter tasting toxin, which helps
ensure reproductive success.
Ho w th e alle le s d iffe r
The PTC gene is located on the long arm of your 7th chromosome and encodes a protein
containing 333 amino acids that, for tasters, forms a taste receptor sensitive to PTC. For those of
us who possess a taster allele, the gene sequence contains a C at nucleotide position 145, another
C at position 785, and a G at position 886. Each of these nucleotides is part of a distinct codon,
which will translate to an amino acid within the PTC protein; for tasters their protein has the
amino acids proline at amino acid position 49, alanine at position 262, and a valine at position
296. Each of the amino acids has a one-letter abbreviation, which provides a convenient way to
rename the taster allele as the PAV allele (Figure 2).
PAV taster allele
145
785
886
5’ ---------- CCA-------------------------------------GCT ------ GTC ----- 3’
NH2 --------- proline --------------------------------- alanine ---- valine ---- COOH
49
262
296
AVI non-taster allele
5’ ---------- GCA ------------------------------------GTT------- ATC ----- 3’
NH2 --------- alanine ---------------------------------- valine --- isoleucine -- COOH
Figure 2. Relevant codons and their corresponding amino acid residues within the two PTC
alleles. The single nucleotide polymorphisms are underlined in the gene sequence. The
number at the top represents position in the nucleotide sequence and the number on the
bottom represents the position in the amino acid sequence.
The most commonly encountered non-taster allele is called the AVI allele. The AVI allele gets
its name from the different amino acids found at the same locations as mentioned for the PAV
allele. The reason the AVI allele contains different amino acids is due to three single nucleotide
substitutions, or polymorphisms, within the gene sequence. By replacing the C145 with a G, the
C785 with a T, and the G886 with an A, the PTC protein ends up having an alanine, a valine, and
an isoleucine replacing the respective amino acids (Figure 2). These three simple changes are
enough to make the protein receptor non-functional (the protein does not fold properly); thus,
non-tasters (those with the tt genotype) are no longer sensitive to the taste of PTC.
Ho w w e can te ll th e m ap art ?
Knowing that you could have one or the other or both of the PTC alleles encoded in your DNA is
interesting, but not nearly as interesting a being able to experimentally “see” the difference
between both forms of the gene. One way to tell the difference between the PAV and AVI
alleles is to take advantage of the C to T change at nucleotide position 785. The nucleotide
sequence surrounding this position forms a binding site for a type of enzyme called a restriction
endonuclease. Restriction endonucleases are a large family of enzymes that can “cut” double
5
Bio. 141 Lab
stranded DNA (break phosphodiester bonds on both strands), but they can only “cut” DNA at
specific nucleotide sequences. Often these recognition sites are 4 to 8 bases long and have a
palindromic sequence, meaning that the forward and reverse complement strands of DNA have
the same sequence. The restriction site surrounding nucleotide position 785 in the taster PAV
allele has the DNA sequence 5’-GCTGC-3’ and is recognized by a restriction endonuclease
3’-CGACG-5’
called Fnu4HI, which can cut both strands of the DNA at this 5 base pair region (Figure 3).
However, the DNA sequence of the AVI allele in non-tasters is changed to 5’-GTTGC-3’ and the
3’-CAACG-5’
Fnu4HI restriction enzyme can no longer cut the DNA (notice that the palindrome no longer
exists). Therefore, to tell the difference between PAV and AVI alleles, all we need to do is treat
the DNA with Fnu4HI and see if the DNA is cut (Figure 3).
PAV allele
AVI allele
5’-ctgtGCTGCcttc-3’
3’-gacaCGACGgaac-5’
5’-ctgtGTTGCcttc-3’
3’-gacaCAACGgaac-5’
Figure 3. Double-stranded DNA sequence of the PTC gene surrounding nucleotide position 785
(underlined base).
Before we go into the details about how to actually perform the lab, here is a brief summary that
highlights the essential information regarding how we can genetically distinguish between a
taster and a non-taster.
 You have 2 copies (alleles) of the PTC gene. These alleles control your ability to taste
PTC.
 Each copy is either the PAV allele (dominant; T) or the AVI allele (recessive; t).
 PAV and AVI have a different nucleotide at position 886.
 The nucleotide at position 886 controls the ability of the Fnu4HI endonuclease to cut
DNA.
 The enzyme Fnu4HI binds to a 5 base pair DNA sequence found in the PAV allele.
Fnu4HI cuts the DNA at this site. The DNA of the AVI allele does not contain this 5
base pair sequence, so Fnu4HI does not cut the DNA of this allele.
How can we generate a DNA Fingerprint using the PTC gene?
Isolating your DNA
The first thing you need to accomplish is to isolate your DNA. Any cell that contains DNA
(skin, blood, hair follicles, etc.) can be used for the DNA fingerprint. You will use your own
cheek cells to obtain DNA for our experiment. You will collect several thousand cheek cells by
using a saline mouthwash. This procedure is bloodless and noninvasive. The cells will be
collected by centrifugation and re-suspended with Chelex resin, which binds and removes metal
ions that can inhibit the other steps in our procedure. Your cells are lysed by boiling and the
cellular debris is removed by centrifugation leaving your chromosomal DNA in the supernatant
(liquid portion). The end result of this brief process is the isolation of your DNA.
6
Bio. 141 Lab
Polymerase Chain Reaction (PCR)
Unfortunately, we now have a new problem. The amount of DNA you isolated from your cheek
cells is not nearly enough for you to visualize a DNA fingerprint of the PTC gene. How do we
overcome this problem? A technique called Polymerase Chain Reaction or PCR is used to
make copies of (amplify) your PTC DNA. PCR allows you to do two things; first, it allows you
to take a few copies of DNA and amplify them into millions of copies, and second, it allows you
to copy and amplify a specific region of DNA. A PCR reaction contains a specific pair of
primers, which are single-stranded DNA molecules. These primers are homologous to small
stretches (20-30 base pairs) of DNA sequence on opposite sides of the region of the PTC gene
you want to copy. The primers allow you to synthesize millions of copies of that specific region
of the PTC gene. The polymerase chain reaction amplifies DNA located between the two primer
sequences. (Figure 4).
4D
4A
4B
4C
40
cycles
Figure 4 PCR amplification (copying) of the PTC gene.
The DNA to be copied (part of your PTC gene) is then heated (95°C) to denature (separate) the
double stranded DNA (Figure 4A). The temperature is lowered (55°C) so that the primers
anneal (bind) to the DNA sequence on either side of the PTC gene (Figure 4B). The
temperature is raised to 72°C and a thermally stable polymerase called Taq DNA polymerase is
added along with a supply of nucleotides (A,C,T,&G). Each strand serves as a template to
synthesize another copy of the PTC gene (Figure 4C). At the completion of the first cycle, the
number of copies of the PTC gene has been doubled (Figure 4C). This amplification process
can be repeated many times producing many copies of the PTC gene. A single copy of DNA
from a single cell can be amplified 1 million times in twenty cycles and 1 billion times in 30
cycles all in one afternoon (Figure 4D). The segment of the PTC gene that the primers allow us
to copy is 330 base pairs in size. This 330 base pair piece of DNA that you will amplify
represents a small fraction (33%) of the length of entire PTC gene, which is 1002 base pairs.
Recall that PCR allows you to copy (amplify) a specific region of DNA.
7
Bio. 141 Lab
Visualizing your DNA fingerprint: Are you a taster or a non-taster?
The next step is to cut your DNA with Fnu4HI to determine if you are a taster or non-taster. If
you are a non-taster, you will be missing the Fnu4HI restriction enzyme site located at nucleotide
position 785 and the fragment of DNA generated by PCR will be 303 base pairs in length. If you
are a taster, you have the Fnu4HI restriction enzyme site and Fnu4HI will cut the DNA piece that
was generated during PCR. Digesting the PTC DNA fragment with Fnu4HI results in the
generation of two pieces (fragments) of DNA (239 base pairs and 64 base pairs).
DNA fragments generated by restriction enzymes can be viewed on agarose gels following
electrophoresis. Samples of DNA can be placed in a horizontal solid matrix (agarose) through
which DNA can migrate. Since DNA is uniformly negatively charged, it will travel toward the
positive pole (cathode) in an electric field. Restriction digested DNA fragments are separated
according to their linear size. Agarose gels serve as a molecular sieve; the smaller DNA
fragments travel through the matrix faster than the larger DNA fragments. The DNA can be
stained and visualized with ethidium bromide, a fluorescent agent that intercalates between the
bases of DNA. When the gel is placed on an ultraviolet light source, the DNA can be seen
(Figure 5). DNA standards of known molecular size are normally electrophoresed along with the
samples to provide a size comparison. We will use a 100 base pair ladder as our size marker.
Lane
1
2
3
4
5
Figure 5. Results from a DNA fingerprint experiment after running PCR amplified PTC DNA
digested with Fnu4HI on an agarose gel. Lane 1 – 100 base pair ladder; Lane 2 – heterozygous
taster, Tt (one AVI allele – 303 bp and one PAV allele – 239 and 64 bp); Lane 3 – homozygous
non-taster,tt (two AVI alleles- each AVI allele has a fragment at 303 bp); Lane 4 – heterozygous
taster, Tt (one AVI allele – 303 bp and one PAV allele – 239 and 64 bp); Lane 5 – homozygous
taster, TT (two PAV alleles – each PAV allele has a fragment at 239 and 64 bp).
8
Bio. 141 Lab
Human PTC DNA Fingerprint protocol
DAY 1
A. Isolation of Cheek Cell DNA
NOTE: It is not advisable to eat immediately before this experiment. Although food particles
rinsed from the mouth appear to have little effect on PCR amplification, they usually obstruct
passage of fluid through pipette tips making pipetting difficult.
1. Pour 10 mL of saline solution (0.9% NaCl) into a 50 mL blue centrifuge tube.
2. Pour the saline into your mouth and vigorously rinse your mouth for 30 seconds. Be sure to
only work with your sample.
3. Expel the saline wash solution back into the 50 mL blue centrifuge tube. Carefully pour the
solution into a 15 mL blue centrifuge tube (labeled with your name) and cap tightly.
4. Place your centrifuge tube into a clinical centrifuge and spin the sample at top speed for 10
minutes. Be sure to balance the rotor prior to operating the centrifuge.
5. Carefully pour the supernatant (liquid) into your original 50 mL blue centrifuge tube. Be
careful not to disturb the pellet of cheek cells at the bottom of the 15 mL blue centrifuge
tube. If you are successful in removing the supernatant without disturbing the pellet, you can
now pour the supernatant down the drain. If you disturbed the pellet, add the supernatant
back to the 15 mL blue centrifuge tube and repeat steps 4 and 5.
6. Set a micropipete to 500 l. Mix the 10% Chelex suspension vigorously to suspend the resin
beads. Before the resins settle, rapidly remove 500 l of Chelex suspension with the
micropipette and add the Chelex suspension into the 15 mL blue centrifuge tube that contains
your pellet of cheek cells. The Chelex solution will remove contaminants that will inhibit the
PCR reaction.
7. Resuspend the cells by pipetting in and out with a plastic pipette until the cells are
completely suspended. Examine the cells against a light source to confirm that no visible
clumps of cells remain.
8. Remove the suspension from the 15 mL blue centrifuge tube and place it into a labeled 1.5
mL microcentrifuge tube. Close the lid of the tube.
9. Place your sample in a float and put the float into a beaker of boiling water for 10 minutes.
Be sure to watch your sample in case the lid pops open. If the lid pops open, quickly remove
the sample and close the lid. This will prevent boiling water from entering the tube and
contaminating your DNA sample. The boiling water will lyse the cells allowing the
liberation of your DNA.
9
Bio. 141 Lab
10. Following the 10 minute incubation in boiling water, remove your sample (using forceps)
and allow the DNA to cool for 2 minutes on ice.
11. Place your sample into a microcentrifuge and centrifuge the sample at top speed for 1 minute.
Be sure to balance the rotor prior to operating the centrifuge.
12. Using a micropipette, remove 200 l of the supernatant (DNA) and transfer the solution to a
new 1.5 mL microcentrifuge tube. Be careful not to remove or disturb the Chelex/cell debris
at the bottom of the tube. Store the tube containing the 200 l of DNA on ice and discard the
tube containing the Chelex mixture.
B. PCR Reaction
1. Your lab instructor will provide you with a microcentrifuge tube containing the components
needed to carry out the PCR amplification. The tube will contain the following:





5 l of 5X Taq PCR buffer
0.25 l of 10 mM dNTPs (nucleotides)
5 l (50 pmol) of forward primer 5’ AACTGGCAGAATAAAGATCTCAATTTAT 3’
5 l (50 pmol) of reverse primer 5’ AACACAAACCATCACCCCTATTTT 3’
0.25 l of Taq DNA polymerase (1.25 Units)
2. Add 9.5 l of your cheek cell DNA into the tube described in step #1 and mix the contents of
the tube well. Place the tube into the microcentrifuge and spin for 5 seconds. Be sure to
balance the rotor prior to operating the centrifuge.
3. Following centrifugation, store your sample on ice until the class is ready to load the thermal
cycler (PCR machine).
4. Place your tube into the thermal cycler. The lab instructor will program the following profile
into the thermal cycler:
1 cycle of:
95°C for 10 minutes
55°C for five minute
40 cycles of:
72°C for 90 seconds
95°C for 45 seconds
55°C for 45 seconds
1 cycle of:
72°C for 10 minutes
5. Run the PCR profile.
10
Bio. 141 Lab
DAY 2
C.
Digestion of your PTC gene with Fnu4HI
1. Add 2.8 l of 10X restriction endonuclease buffer into the tube containing your PCR
amplified DNA. Mix well and centrifuge your sample for 5 seconds.
2. Heat the sample at 65°C for 5 minutes.
3. Keep the tubes on ice.
4. Add 1.0 l of Fnu4HI restriction endonuclease, mix well and centrifuge for 5 seconds.
5. Incubate the samples at 37°C for at least 3 hours.
DAY 3
D.
Agarose gel electrophoresis
1. Weigh out the appropriate amount of agarose to make a 2% gel and place the agarose into a
flask. Add the appropriate amount of tris borate EDTA buffer into the flask.
2. Place the flask into the microwave oven and heat the agarose solution until it boils. BE
CAREFUL NOT TO LET THE AGAROSE SOLUTION BOIL OUT OF THE FLASK.
3. Allow the agarose to cool to 60°C. While the agarose is cooling, place the comb into the gel
tray and attach the sides of the tray. Your lab instructor will add ethidium bromide when the
agarose cools to 60°C. WEAR GLOVES FROM THIS POINT ON BECAUSE
ETHIDIUM BROMIDE IS A MUTAGEN!
4. Pour the agarose solution into the gel tray until the volume reaches the top of the comb’s teeth.
Allow the gel to harden for 20 minutes.
5. Add 5 l of sterile loading dye to your sample and mix well.
6. Place your sample into a microcentrifuge and spin the sample for 5 seconds. Be sure to balance
the rotor prior to operating the centrifuge.
7. Heat your sample at 65ºC for 5 minutes and then place the sample on ice.
8. After your gel has hardened, gently remove the comb and the side supports from the gel. Place
the gel into the chamber and add enough tris borate EDTA buffer to cover the gel.
9. Carefully load your entire sample into the gel using a micropipette. Be careful not to push the
pipette tip through the bottom of the sample well. Record what samples you loaded into each
well.
11
Bio. 141 Lab
10. Place the cover onto the electrophoretic chamber and connect the electrodes to the power
supply. Run the gel at about 100 volts until the loading dye has migrated about half way
through the agarose gel.
11. View and photograph the gel under an ultraviolet light. Be sure to record your results.
Compare your predicted results to the bands that appear in the gel.
12. Discard the gel in specifically marked waste containers. These waste containers are ONLY
for ethidium bromide waste material.
12